SNP (Single Nucleotide Polymorphism) molecular marker related to glucoraphanin content of leaf mustard, primer, kit and application
By developing SNP molecular markers and primers related to glucosinolate content in leaf mustard, and combining them with KASP-PCR technology, the problem of identifying glucosinolate content in leaf mustard breeding was solved, enabling early and efficient screening and breeding, and improving breeding efficiency and accuracy.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- HUNAN AGRI UNIV
- Filing Date
- 2026-03-26
- Publication Date
- 2026-04-28
AI Technical Summary
The lack of stable molecular markers closely linked to the glucosinolate content in leaf mustard greens in existing technologies leads to low breeding efficiency, and traditional phenotypic identification is time-consuming, costly, and highly susceptible to environmental influences.
We developed SNP molecular markers related to glucosinolate content in leaf mustard, designed specific primers, and provided corresponding kits. Through KASP-PCR amplification and fluorescence signal detection, we achieved early genotyping and screened germplasm with high glucosinolate content.
It enables rapid and accurate screening of germplasm with high glucosinolate content during the seedling stage, significantly shortening the breeding cycle, reducing costs, improving breeding efficiency, and providing an efficient molecular marker-assisted selection tool.
Smart Images

Figure CN121931284A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant molecular breeding technology, and in particular relates to an SNP molecular marker, primer, kit and application related to the glucosinolate content of leaf mustard. Background Technology
[0002] Leaf mustard ( Brassica juncea Glucosamine is an important specialty vegetable in my country, and its unique flavor and health value mainly come from glucosinolates (abbreviated as glucosinolates). Glucosinolates ( Glucoraphanin GRA is a key aliphatic glucosinolate, and its hydrolysis product is sulforaphane (GRA). Sulforaphane) It has excellent anti-cancer activity and has become a core target trait for functional mustard breeding.
[0003] Currently, the selection of glucosinolate content in leaf mustard greens mainly relies on traditional phenotypic identification, which requires detection using methods such as high-performance liquid chromatography after the plants have grown to a suitable stage. This process is characterized by long cycles, high costs, and significant susceptibility to environmental influences, severely hindering the breeding process. Marker-assisted selection (MAS) technology can achieve early and precise screening of target traits, significantly improving breeding efficiency. However, existing technologies lack stable molecular markers closely linked to glucosinolate content in leaf mustard greens, thus hindering efficient molecular breeding of this trait. Therefore, identifying key genetic loci related to glucosinolate content and developing efficient molecular markers is of great significance for accelerating the breeding of high-nutritional-value leaf mustard greens. Summary of the Invention
[0004] The technical problem to be solved by the present invention is to overcome the deficiencies and defects mentioned in the background art above, and to provide an SNP molecular marker, primer, kit and application related to the glucosinolate content of leaf mustard.
[0005] To solve the above-mentioned technical problems, the technical solution proposed by this invention is as follows:
[0006] A SNP molecular marker associated with glucosinolate content in leaf mustard greens, wherein the SNP molecular marker is located at 29599150 bp on chromosome B01 of leaf mustard greens, and the base at this site is G or A, and its flanking sequence (SEQ ID NO: 1) is shown below: G / A A) TTCTTGGGACAAGGGAATTGACTTTGGGTGATCAAGGTTCAATCAAAGATGCCAACTTTTCAATCAATCTAATTCCTTATGCCTAGACAACAAAACTAAGCAAGCTCTATCCCTAGATGAATGCTCTTTTGCAATGATCACCCAAGTACACCAAATCCCTTTGGCTGTAATTGATCAAAGCAAACATAAGAATGAGTCTA.
[0007] Based on a general inventive concept, the present invention also provides primers for amplifying SNP molecular markers related to the glucosinolate content of leaf mustard, comprising: Forward primer F1: 5'-GAAGGTGACCAAGTTCATGCTTCTTTCTCAATGAGGAAAGGGGG-3' (SEQ ID NO: 2); Forward primer F2: 5'-GAAGGTCGGAGTCAACGGATTTCTTTCTCAATGAGGAAAGGGGA-3' (SEQ IDNO: 3); Reverse primer R: 5'-GGGATAGAGCTTGCTTAGTTTTGTTG-3' (SEQ ID NO: 4).
[0008] Based on a general inventive concept, the present invention also provides a kit for identifying SNP molecular markers related to the glucosinolate content of leaf mustard, including the primers described above.
[0009] Based on a general inventive concept, the present invention also provides the application of the primers or kits described above in the identification of glucosinolate content in leaf mustard germplasm.
[0010] Based on a general inventive concept, the present invention also provides the application of the primers or kits described above in molecular-assisted breeding for determining the glucosinolate content of leaf mustard.
[0011] Based on a general inventive concept, the present invention also provides a method for screening leaf mustard germplasm with high glucosinolate content, comprising the following steps: (1) Extract genomic DNA from the leaf mustard germplasm to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform KASP-PCR amplification using the primers described above or the kit described above; (3) Detect fluorescence signals and perform genotyping on the amplification products; (4) Based on the genotyping, leaf mustard germplasm carrying the G allele homozygous at position 29599150 of chromosome B01 was selected as a candidate germplasm with high glucosinolate content.
[0012] In the above method, preferably, in step (2), the KASP-PCR amplification program is as follows: KASP-PCR amplification program is as follows: pre-denaturation at 94℃ for 15 minutes; followed by 10 cycles of falling PCR: denaturation at 94℃ for 20 seconds, initial annealing at 61℃ and extension for 60 seconds, with the annealing temperature decreasing by 0.6℃ for each cycle; then 26 cycles of conventional PCR: denaturation at 94℃ for 20 seconds, annealing at 55℃ and extension for 60 seconds.
[0013] In the above method, preferably, in step (3), if only the FAM fluorescence signal corresponding to the fluorescent sequence connected by the forward primer F1 is detected, the detection site is a homozygous GG genotype; if only the HEX fluorescence signal corresponding to the fluorescent sequence connected by the forward primer F2 is detected, the detection site is a homozygous AA genotype; if the fluorescence signals corresponding to both the forward primer 1 and the forward primer 2 are detected simultaneously, the detection site is a heterozygous GA genotype.
[0014] The above method preferably selects germplasm with homozygous GG genotype at the detection site, which is a candidate germplasm with high glucosinolate content.
[0015] Compared with the prior art, the beneficial effects of the present invention are as follows: (1) Through genome-wide association analysis, this invention has for the first time identified a SNP locus (29599150 bp, G / A) on chromosome B01 of leaf mustard that is highly significantly associated with glucosinolate content. Based on this, molecular markers, primers and kits developed can stably and accurately distinguish between germplasm with high and low glucosinolate content, which provides a core tool for marker-assisted selection (MAS) breeding.
[0016] (2) Using the molecular marker primers and kits of the present invention, only a small amount of leaf DNA needs to be extracted during the seedling stage of leaf mustard to complete the genotyping, without waiting for the plants to grow to the harvest period. This shortens the screening cycle from several months to 1-2 days and avoids the later planting and testing costs of a large number of invalid materials, significantly improving the breeding efficiency.
[0017] (3) The molecular markers, primers and reagent kits of the present invention are easy to detect and screen, have high throughput and intuitive results, and can realize rapid screening of large-scale breeding materials. They provide efficient technical tools for the precision breeding of functional varieties of leaf mustard with high glucosinolate content and promote the quality upgrading of the mustard industry. Attached Figure Description
[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0019] Figure 1 The Manhattan plot for genome-wide association analysis of glucosinolate content in leaf mustard in this embodiment of the invention: the horizontal axis represents the chromosome number of leaf mustard, the vertical axis represents the association signal intensity of SNP sites (-log10 (P)), the red line represents the significance threshold (-log10 (P)>8.0), and the arrows indicate the significant associated SNP site at 29599150 bp on chromosome B01.
[0020] Figure 2 This is a validation plot showing the association between glucosinolate content in leaf mustard and the B01A marker genotype. Blue circles represent leaf mustard resources with high glucosinolate content, and red circles represent leaf mustard resources with low glucosinolate content. Detailed Implementation
[0021] To facilitate understanding of the present invention, the present invention will be described more fully and in detail below with reference to the accompanying drawings and preferred embodiments, but the scope of protection of the present invention is not limited to the following specific embodiments.
[0022] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by those skilled in the art. The technical terms used herein are for the purpose of describing particular embodiments only and are not intended to limit the scope of the invention.
[0023] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be purchased from the market or prepared by existing methods.
[0024] Example 1: Screening and identification of SNP molecular markers related to glucosinolate content This embodiment aims to identify SNP sites that are significantly associated with glucosinolate content in leaf mustard greens through genome-wide association analysis (GWAS).
[0025] 1. Experimental materials 175 leaf mustard germplasm resources preserved at the Germplasm Center of Hunan Agricultural University were selected as the experimental population. These mustard germplasm resources include various germplasm resources from Sichuan, Chongqing, Hubei, Hunan, Guizhou, Zhejiang, Fujian, Anhui, and Guangdong provinces in China, exhibiting good genetic diversity and representativeness, and meeting the population structure requirements for genome-wide association analysis. All materials were cultivated at the experimental base of the Changde Academy of Agricultural and Forestry Sciences in Hunan Province, and underwent standardized field management until harvest.
[0026] 2. Phenotypic identification of glucosinolate content Representative functional leaf samples were collected at the maturity stage of each germplasm. After flash freezing in liquid nitrogen, the samples were freeze-dried and ground into a fine powder. High-performance liquid chromatography (HPLC) was used to accurately determine the glucoraphane content in the dried leaf powder of each material. Based on the results, 14 extreme phenotypic materials with the highest (>9.0 μmol / g DW) and 14 with the lowest (<2.0 μmol / g DW) glucoraphane content were selected, totaling 28 materials, for subsequent genomic analysis. The origin, glucoraphane content, and phenotypic grouping of these 28 extreme phenotypic materials are shown in Table 1.
[0027] Table 1: Information on 28 extreme phenotypic materials
[0028] 3. Whole-genome resequencing and association analysis (1) DNA extraction and sequencing: Genomic DNA was extracted from the above 28 extreme phenotype materials using a modified CTAB method. After passing quality testing, whole-genome resequencing was performed to obtain high-quality sequence data.
[0029] The simplified steps of DNA extraction using the modified CTAB method are as follows: ① Sample preparation: Take an appropriate amount of fresh leaves (approximately 0.1-0.2 g) and place them in a pre-cooled mortar. Add liquid nitrogen and grind rapidly into a fine powder. Quickly transfer the ground powder to a 2 mL centrifuge tube. ② Cell lysis: Add 700 μL of 2×CTAB extraction buffer preheated to 65 °C to the centrifuge tube containing the plant powder. Gently invert to mix and ensure the powder is fully suspended. Place the centrifuge tube in a 65 °C water bath for 30 min, gently inverting to mix every 15 min to promote cell lysis and DNA release. ③ Removal of proteins and impurities: Remove the centrifuge tube from the water bath and cool to room temperature. Add an equal volume (approximately 700 μL) of chloroform-isoamyl alcohol (24:1), gently invert to mix for 15 min to ensure thorough mixing of the organic and aqueous phases. Centrifuge at 12000 rpm for 15 min, and transfer the upper aqueous phase to a new 1.5 mL centrifuge tube. ④ Precipitate DNA: Add 2 / 3 volume (approximately 450 μL) of pre-chilled anhydrous ethanol to the centrifuge tube, gently invert to mix, and place the centrifuge tube in a -20°C freezer for 30 min. ⑤ Wash DNA: Centrifuge at 12000 rpm for 10 min at 4°C, discard the supernatant, and collect the DNA precipitate. Add 1 mL of 70% ethanol, gently invert to wash the precipitate three times to remove residual salts and impurities. Centrifuge at 12000 rpm for 5 min at 4°C, and discard the supernatant. ⑥ Dissolve DNA: Allow the centrifuge tube to air dry at room temperature until the ethanol has completely evaporated. Add 100 μL of TE buffer, gently pipette or invert to mix, and ensure the DNA is fully dissolved. Store the dissolved DNA solution at 4°C for later use, or at -20°C for long-term storage.
[0030] The DNA quality testing and sequencing process can be summarized as follows: ① DNA quality monitoring: The concentration and purity of DNA are measured using a NanoDrop 2000 spectrophotometer and 1.0% agarose gel electrophoresis. ② DNA sequencing: Qualified DNA samples are placed in dry ice and processed and sequenced by Beijing Novogene Technology Co., Ltd. The sequencing library construction process is as follows: First, high-quality genomic DNA is randomly fragmented using a Covaris ultrasonic disruptor. Then, through end repair, A-tailing, sequencing adapter ligation, fragment selection, PCR amplification, and purification, the sequencing library is constructed, and paired-end sequencing is performed using the Illumina NovaSeq 6000 platform.
[0031] (2) SNP detection and filtering: GATK software was used to align and detect variants in the sequencing data to obtain SNP sites across the entire genome. The process is briefly as follows: Quality control (QC) was performed on the raw data produced by the sequencing platform to remove low-quality reads and adapter sequences, obtaining high-quality clean data. The clean data was then aligned to the mustard reference genome using BWA software. Brassica juncea var.tumida -AABB, Tumida- T84-66-v1.5 Based on the alignment results, the sequencing depth and genome coverage of each sample were statistically analyzed. SNP loci were detected using GATK (Genome Analysis Toolkit) software, and the results were rigorously filtered to ensure the accuracy of variation information for subsequent association analysis. The SNP loci filtering criteria were as follows: Fisher test for strand bias (FS) ≤ 60, haplotype score ≤ 13.0, alignment quality (MQ) ≥ 40, quality depth (QD) ≥ 2, read position rank sum (ReadPosRankSum) ≥ -8.0, alignment quality rank sum (MQRankSum) > -12.5, and substitution alleles must be present in ≥ 4 reads. Loci with missing genotypes were removed. After the above filtering, the SNP loci significantly associated with glucosinolate content identified in this embodiment are shown in Table 2, including the chromosome, physical location, allelic base type, and genotype distribution in the 28 extreme phenotypic materials.
[0032] (3) Genome-wide association analysis (GWAS): Representative accessions with high and low glucoraphane content were selected to construct an association analysis population. GEMMA software was used to perform association analysis based on a mixed linear model (MLM). The significance threshold for the association analysis was set to -log10(P)>8.0, and SNP loci significantly associated with the target trait were screened. Finally, the Manhattan plot was generated using the 'qqman' package in R to visualize the association results.
[0033] 4. Results Manhattan diagrams generated by association analysis, such as Figure 1As shown, a peak with a highly significant association to glucosinolate content exists on chromosome B01 of leaf mustard. This significantly associated SNP site is located at 29599150 bp on chromosome B01, with an association significance level of -log10 (P) > 8.0. This site exhibits allelic variation, with a base type of G or A (i.e., G→A mutation). This SNP site has been identified as a molecular marker closely linked to glucosinolate content in leaf mustard. Its flanking sequence is as follows: G / A A) TTCTTGGGACAAGGGAATTGACTTTGGGTGATCAAGGTTCAATCAAAGATGCCAACTTTTCAATCAATCTAATTCCTTATGCCTAGACAACAAAACTAAGCAAGCTCTATCCCTAGATGAATGCTCTTTTGCAATGATCACCCAAGTACACCAAATCCCTTTGGCTGTAATTGATCAAAGCAAACATAAGAATGAGTCTA.
[0034] The specific genotype distribution of this SNP locus in 28 extreme phenotypic materials is shown in Table 2.
[0035] Table 2: SNP locus information in 28 extreme phenotypic materials
[0036] 5. Explanation of the repeatability of this embodiment Based on the following information disclosed in this embodiment, those skilled in the art can reproduce the technical solution of the present invention and obtain the SNP molecular markers related to glucosinolate content: (1) Screening criteria for extreme phenotype materials: Based on the measured values of glucosinolate content, extreme materials with contents >9.0 μmol / g DW and <2.0 μmol / g DW were selected; (2) The source distribution and phenotypic value range of the 28 extreme phenotypic materials disclosed in Table 1; (3) Table 2 discloses the core SNP loci information and their genotype distribution in extreme materials; (4) Specific methods for whole genome resequencing, SNP detection and GWAS analysis.
[0037] Using the same screening criteria and analysis methods as described above, significant associated SNP sites consistent with those in this embodiment can be obtained.
[0038] Example 2: Design, Validation and Application of KASP Primers Based on SNP Sites Based on the key SNP sites identified in Example 1, this embodiment develops a matching KASP (competitive allele-specific PCR) molecular marker and verifies its genotyping effect and phenotypic prediction accuracy.
[0039] 1. KASP primer design Based on the SNP site (G / A) at 29599150 bp on chromosome B01, specific KASP primers were designed within a genomic flanking region approximately 200 bp upstream and downstream. The primer sequences are as follows: Forward primer F1 (corresponding to the G allele): 5'-GAAGGTGACCAAGTTCATGCTTCTTTCTCAATGAGGAAAGGGGG-3', with a universal tail sequence of the FAM fluorescent reporter group at its 5' end; Forward primer F2 (corresponding to the A allele): 5'-GAAGGTCGGAGTCAACGGATTTCTTTCTCAATGAGGAAAGGGGA-3', with a universal tail sequence of the HEX fluorescent reporter group at its 5' end; Reverse primer R: 5'-GGGATAGAGCTTGCTTAGTTTTGTTG-3'.
[0040] The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0041] 2. KASP tag verification (1) Validation materials: 45 leaf mustard materials with known glucosinolate content were selected from 175 germplasm resources as the validation set, including 13 materials with high glucosinolate content and 32 materials with low glucosinolate content.
[0042] (2) DNA extraction: Genomic DNA was extracted from 45 validation materials using a modified CTAB method.
[0043] (3) KASP-PCR amplification and typing: Reaction system (5 μL): 2× KASP Master Mix 2.5 μL, KASP Assay Mix (containing the above three primers) 0.25 μL, template DNA (concentration 20-50 ng / μL) 1 μL, add ddH2O to make up to 5 μL.
[0044] Reaction procedure: 94℃ pre-denaturation for 15 minutes; followed by 10 cycles of landing PCR: 94℃ denaturation for 20 seconds, 61℃ initial annealing / extension for 60 seconds (annealing temperature decreased by 0.6℃ per cycle); then 26 cycles of conventional PCR: 94℃ denaturation for 20 seconds, 55℃ annealing / extension for 60 seconds.
[0045] Fluorescence detection and genotyping: After the reaction, the fluorescence signal was detected and genotyped using an ABI 7500 real-time PCR instrument: If only the FAM fluorescence signal corresponding to the fluorescent sequence linked by the forward primer F1 was detected, the detection site was homozygous GG genotype (this germplasm corresponds to a candidate germplasm with high glucosinolate content); if only the HEX fluorescence signal corresponding to the fluorescent sequence linked by the forward primer F2 was detected, the detection site was homozygous AA genotype (this germplasm is a candidate germplasm with low glucosinolate content); if the fluorescence signals corresponding to both forward primer 1 and forward primer 2 were detected simultaneously, the detection site was heterozygous GA genotype.
[0046] 3. Verification Results KASP genotyping results clearly distinguished three genotypes: GG, AA, and GA. Statistical analysis showed that... Of the 13 materials with high glucosinolate content, 11 (84.6%) were classified as GG homozygous (mainly showing FAM fluorescence signal).
[0047] Among the 32 materials with low glucosinolate content, 26 (81.3%) were classified as AA homozygous (mainly showing HEX fluorescence signal).
[0048] Therefore, the KASP marker genotype showed an 82.2% match with the glucoraphane content phenotype (high / low), confirming that this molecular marker can effectively distinguish between leaf mustard germplasm with high and low glucoraphane content. The association verification results can be found in [link to relevant documentation]. Figure 2 .
[0049] Example 3: Screening for leaf mustard breeding materials with high glucosinolate content using KASP markers This embodiment utilizes the KASP marker and method developed in Example 2 to conduct early and rapid screening of conventional leaf mustard breeding materials with unknown glucosinolate content, such as Er Yue Qing, Jian Gan Qing Cai, Xue Li Hong, Hua Jie No. 1, Hua Jie No. 2, Hua Jie No. 3, and Hua Rong Daye Jie, in actual breeding work.
[0050] 1. Material to be screened The glucosinolate content of 50 leaf mustard seedlings was unknown.
[0051] 2. Genomic DNA extraction A small piece of young leaf was taken from each sample, and genomic DNA was rapidly extracted using a modified CTAB method. The concentration and purity of the DNA were measured using a NanoDrop 2000 spectrophotometer to ensure that the OD260 / OD280 values were between 1.8 and 2.0 for subsequent experiments.
[0052] 3. KASP marker detection Following the KASP-PCR amplification and typing method in Example 2, DNA samples from all 50 materials were amplified and typed.
[0053] 4. Screening Results and Phenotypic Validation (1) Genotype screening: 23 materials with the GG homozygous genotype (FAM fluorescence signal) were screened from 50 materials by fluorescence typing. These materials were initially identified as candidate germplasms with high glucosinolate content.
[0054] (2) Phenotypic verification: The above 23 candidate germplasms were planted until maturity, and their actual content of glucosinolates was determined by HPLC method in Example 1.
[0055] (3) Screening accuracy assessment: The results showed that among the 23 GG genotype candidate germplasms, 20 materials had glucosinolate content greater than 7.5 μmol / g DW, meeting the high content standard. The accuracy rate of this screening was approximately 87.0%. This result fully demonstrates that the SNP molecular marker and KASP screening method provided by this invention can efficiently and accurately identify leaf mustard breeding materials with high glucosinolate content during the seedling stage, significantly shortening the breeding cycle.
[0056] The above are merely preferred embodiments of this application. It should be noted that this application is not limited to the above embodiments. For those skilled in the art, several improvements and modifications can be made without departing from the principles of this application. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should also be considered within the scope of protection of this application.
Claims
1. A SNP molecular marker associated with glucosinolate content in leaf mustard, characterized in that, The SNP molecular marker is located at 29599150 bp on chromosome B01 of leaf mustard, with the bases at this site being either G or A, and its flanking sequence is as follows: G / A A) TTCTTGGGACAAGGGAATTGACTTTGGGTGATCAAGGTTCAATCAAAGATGCCAACTTTTCAATCAATCTAATTCCTTATGCCTAGACAACAAAACTAAGCAAGCTCTATCCCTAGATGAATGCTCTTTTGCAATGATCACCCAAGTACACCAAATCCCTTTGGCTGTAATTGATCAAAGCAAACATAAGAATGAGTCTA.
2. A primer for amplifying SNP molecular markers related to the glucosinolate content of leaf mustard, characterized in that, include: Forward primer F1: 5'-GAAGGTGACCAAGTTCATGCTTCTTTCTCAATGAGGAAAGGGGG-3'; Forward primer F2: 5'-GAAGGTCGGAGTCAACGGATTTCTTTCTCAATGAGGAAAGGGGA-3'; Reverse primer R: 5'-GGGATAGAGCTTGCTTAGTTTTGTTG-3'.
3. A kit for identifying SNP molecular markers related to glucosinolate content in leaf mustard, characterized in that, Includes the primers as described in claim 2.
4. The application of the primer as described in claim 2 or the kit as described in claim 3 in the identification of glucosinolate content in leaf mustard germplasm.
5. The application of a primer as described in claim 2 or a kit as described in claim 3 in molecular-assisted breeding for determining the glucosinolate content of leaf mustard.
6. A method for screening leaf mustard germplasm with high glucosinolate content, characterized in that, Includes the following steps: (1) Extract genomic DNA from the leaf mustard germplasm to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform KASP-PCR amplification using the primers described in claim 2 or the kit described in claim 3; (3) Detect fluorescence signals and perform genotyping on the amplification products; (4) Based on the genotyping, leaf mustard germplasm carrying the G allele homozygous at position 29599150 of chromosome B01 was selected as a candidate germplasm with high glucosinolate content.
7. The method as described in claim 6, characterized in that, In step (2), the KASP-PCR amplification program is as follows: pre-denaturation at 94℃ for 15 minutes; followed by 10 cycles of landing PCR: denaturation at 94℃ for 20 seconds, initial annealing at 61℃ and extension for 60 seconds, with the annealing temperature decreasing by 0.6℃ per cycle; then PCR for 26 cycles: denaturation at 94℃ for 20 seconds, annealing at 55℃ and extension for 60 seconds.
8. The method as described in claim 6, characterized in that, In step (3), if only the FAM fluorescence signal corresponding to the fluorescent sequence linked by the forward primer F1 is detected, the detection site is the homozygous GG genotype; if only the HEX fluorescence signal corresponding to the fluorescent sequence linked by the forward primer F2 is detected, the detection site is the homozygous AA genotype; if the fluorescence signals corresponding to both the forward primer 1 and the forward primer 2 are detected simultaneously, the detection site is the heterozygous GA genotype.
9. The method as described in claim 8, characterized in that, Germplasm with homozygous GG genotype at the detection site was selected as a candidate germplasm with high glucosinolate content.
Citation Information
Patent Citations
Methods for producing plants with altered levels of sulphated secondary metabolites
CA2665735A1
Mustard core SNP (Single Nucleotide Polymorphism) molecular marker set as well as screening method and application thereof
CN121874387A
Plants with low seed glucosinolate content
WO2024105148A1