Preparation and application of porcine interleukin 17, 22 and 29 co-expression biological agent

Abstract

The invention discloses preparation and application of a porcine interleukin 17, 22 and 29 co-expression biological agent. The invention provides a fusion protein. The fusion protein comprises a porcine interleukin 17, a porcine interleukin 22 and a porcine interleukin 29. The recombinant yeast Po1h-IL17 / 22 / 29 capable of expressing porcine IL-17, IL-22 and IL-29 fusion molecules is constructed, and cells and mice are treated by the recombinant yeast Po1h-IL17 / 22 / 29, so that the cells and the mice obtain higher immune resistance to virus and bacterial infection. Subsequently, the piglets are orally inoculated with Po1h-IL17 / 22 / 29, and it is proved that the Po1h-IL17 / 22 / 29 obviously improves the growth performance and the whole body immunity of the piglets.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to the preparation and application of a biological agent co-expressing porcine interleukins 17, 22, and 29. Background Technology

[0002] Pork is the primary source of animal protein for Chinese residents, with China ranking first in the world in both annual pork production and consumption. To meet the nation's meat needs, the pig farming industry is expanding. However, the promotion of intensive farming increases the risk of infectious disease outbreaks, potentially leading to significant economic losses. Furthermore, the widespread use of antibiotics as feed additives to promote growth and enhance disease resistance in pigs has resulted in the proliferation of drug-resistant bacteria over the years, leading to substantial antibiotic residues in food products and posing a significant threat to human health.

[0003] Employing biocontrol techniques as an alternative to antibiotics in the prevention and treatment of livestock and human diseases is crucial for curbing the spread of antibiotic-resistant bacteria. Livestock diseases can also be prevented and treated by enhancing animal immunity, and cytokines play a vital role in regulating animal immunity. Therefore, cytokine treatment holds promise for improving the prevention and treatment of animal diseases by replacing antibiotics. Summary of the Invention

[0004] This invention claims protection for the preparation and application of a biological agent co-expressing porcine interleukins 17, 22 and 29.

[0005] Firstly, this invention claims protection for a fusion protein.

[0006] The fusion proteins claimed in this invention include porcine interleukin-17, porcine interleukin-22, and porcine interleukin-29.

[0007] Furthermore, the fusion protein comprises, from the N-terminus to the C-terminus, the following components in sequence: porcine interleukin-17, purification tag, self-cleaving polypeptide, secretion signal peptide, porcine interleukin-22, purification tag, self-cleaving polypeptide, secretion signal peptide, porcine interleukin-29, and purification tag.

[0008] Furthermore, the fusion protein comprises, from the N-terminus to the C-terminus, the following components in sequence: porcine interleukin 17, histidine tag, linker peptide GSG, self-cleaving polypeptide 2A, secretion signal peptide XPR2Pre, porcine interleukin 22, histidine tag, linker peptide GSG, self-cleaving polypeptide 2A, secretion signal peptide XPR2Pre, porcine interleukin 29, and histidine tag.

[0009] In a specific embodiment of the present invention, the fusion protein is the protein shown in SEQ ID No. 1.

[0010] In SEQ ID No. 1, positions 1-131 are porcine interleukin-17, positions 132-137 are histidine tags, positions 138-140 are linker peptides (GSG), positions 141-159 are P2A autosplicing peptides, positions 160-174 are secretion signal peptides (XPR2Pre), positions 175-364 are porcine interleukin-22, positions 365-370 are histidine tags, positions 371-373 are linker peptides (GSG), positions 374-392 are P2A autosplicing peptides, positions 393-407 are secretion signal peptides (XPR2Pre), positions 408-580 are porcine interleukin-29, and positions 581-586 are histidine tags.

[0011] Secondly, the present invention claims protection for nucleic acid molecules encoding the fusion protein described in the first aspect above.

[0012] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.

[0013] Furthermore, the nucleic acid molecule may be any of the following:

[0014] (b1) DNA molecules with coding regions as shown in SEQ ID No. 2;

[0015] (b2) A DNA molecule that hybridizes under stringent conditions with the DNA molecule defined in (b1) and encodes the fusion protein;

[0016] (b3) A DNA molecule that has at least 99%, 95%, 90%, 85%, or 80% homology with the DNA molecule defined in (b1) or (b2) and encodes the fusion protein.

[0017] The stringent conditions for the above nucleic acid molecules can be as follows: hybridization at 50°C in a mixed solution of 7% sodium dodecyl sulfate (SDS), 0.5M Na3PO4, and 1mM EDTA, followed by rinsing at 50°C in 2×SSC and 0.1% SDS; or hybridization at 50°C in a mixed solution of 7% SDS, 0.5M Na3PO4, and 1mM EDTA, followed by rinsing at 50°C in 1×SSC and 0.1% SDS; or hybridization at 50°C in a mixed solution of 7% SDS, 0.5M Na3PO4, and 1mM EDTA, followed by rinsing at 50°C in 0.5×SSC and 0.1% SDS; or hybridization at 50°C in a mixed solution of 7% SDS, 0.5M Na3PO4, and 1mM EDTA, followed by rinsing at 50°C in 0.1×SSC and 0.1% SDS. Alternatively, the membrane can be rinsed in SDS; or hybridized at 50°C in a mixed solution of 7% SDS, 0.5M Na3PO4 and 1mM EDTA, and then rinsed at 65°C in 0.1×SSC and 0.1% SDS; or hybridized at 65°C in a solution of 6×SSC and 0.5% SDS, and then washed once each with 2×SSC and 0.1% SDS and 1×SSC and 0.1% SDS.

[0018] In the aforementioned nucleic acid molecules, homology refers to the similarity of nucleotide sequences. The similarity of nucleotide sequences can be determined using homology search sites on the internet, such as the BLAST page on the NCBI website. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing a search for the similarity of a pair of nucleotide sequences, the homology value (%) can be obtained.

[0019] In the aforementioned nucleic acid molecules, the homology of 95% or more can be at least 96%, 97%, or 98%. The homology of 90% or more can be at least 91%, 92%, 93%, or 94%. The homology of 85% or more can be at least 86%, 87%, 88%, or 89%. The homology of 80% or more can be at least 81%, 82%, 83%, or 84%.

[0020] Thirdly, the present invention claims protection for any of the following biological materials:

[0021] (c1) An expression cassette containing the nucleic acid molecules described in the second aspect above;

[0022] (c2) A recombinant vector containing the nucleic acid molecules described in the second aspect above;

[0023] (c3) Transgenic cell lines containing the nucleic acid molecules described in the second aspect above;

[0024] (c4) Recombinant bacteria containing the nucleic acid molecules described in the second aspect above;

[0025] The supernatant of the recombinant bacteria described in (c5) and (c4);

[0026] The fermentation products of the recombinant bacteria described in (c6) and (c4).

[0027] In (c5), the supernatant is the supernatant collected by centrifugation (e.g., 4°C, 10000rpm) after ultrasonic lysis treatment of the fermentation broth of the recombinant bacteria (e.g., power 200W, ultrasonic for 3s, interval 10s, repeated 30 times).

[0028] In (c6), the fermentation product is the entire fermentation system obtained by fermenting and culturing the recombinant bacteria, and its OD... 600 Approximately 10. Or, OD 600 It is 80.

[0029] The expression cassette refers to DNA capable of expressing the fusion protein in a host cell. This DNA may include not only a promoter to initiate transcription of the nucleic acid molecule but also a terminator to terminate its transcription. Furthermore, the expression cassette may also include an enhancer sequence.

[0030] The recombinant bacteria may be recombinant yeast.

[0031] Furthermore, the recombinant yeast is obtained by introducing the recombinant vector described in (c2) into a host yeast, and the host yeast may be Yersinia lipophila.

[0032] In a specific embodiment of the present invention, the recombinant vector is specifically obtained by cloning the DNA molecule shown in SEQ ID No. 2 into pINA1297, and then transforming the recombinant vector (named pINA1297-IL-17 / 22 / 29) into Yersinia lipolyticis Po1h competent cells after linearization treatment to obtain the recombinant yeast (named Po1h-pINA1297).

[0033] Fourthly, the present invention claims protection for the use of the fusion protein described in the first aspect above, the nucleic acid molecule described in the second aspect above, or the biological material described in the third aspect above, in any of the following:

[0034] (d1) Prepare products that enhance animal immunity, or enhance animal immunity;

[0035] (d2) Prepare products that resist pathogenic microbial infection, or products that resist pathogenic microbial infection;

[0036] (d3) Prepare products that promote animal growth and development, or promote animal growth and development;

[0037] (d4) Prepare products that promote the proliferation of immune cells (such as porcine lymphocytes), or promote the proliferation of immune cells (such as porcine lymphocytes);

[0038] (d5) Prepare products that enhance humoral immunity, or enhance humoral immunity;

[0039] (d6) Prepare products that increase the expression of total IgG in plasma, or increase the expression of total IgG in plasma;

[0040] (d7) Prepare products that increase the expression of sIgA in feces, or increase the expression of sIgA in feces;

[0041] (d8) Prepare animal feed or use as an animal feed additive;

[0042] (d9) Prepare products that increase the total weight gain of animals, or increase the total weight gain of animals;

[0043] (d10) Prepare products that increase the average daily weight gain of animals, or increase the average daily weight gain of animals;

[0044] (d11) Prepare products that reduce the average daily feed intake of animals, or reduce the average daily feed intake of animals;

[0045] (d12) Prepare products that reduce the feed efficiency of animals, or reduce the feed efficiency of animals.

[0046] In a specific embodiment of the present invention, the pathogenic microorganism is Salmonella typhimurium, Staphylococcus aureus, porcine epidemic diarrhea virus (PEDV), or / and porcine diarrhea coronavirus (PDCoV).

[0047] Furthermore, the animal in question is a mammal;

[0048] In a specific embodiment of the present invention, the mammal is a pig or a mouse.

[0049] Fifthly, this invention claims protection for a product.

[0050] The product claimed in this invention is composed of porcine interleukin-17, porcine interleukin-22, and porcine interleukin-29; the product has any of the following functions:

[0051] (e1) Improve animal immunity;

[0052] (e2) Resistance to pathogenic microbial infections;

[0053] (e3) Promotes animal growth and development;

[0054] (e4) Promotes the proliferation of immune cells (such as porcine lymphocytes);

[0055] (e5) Enhances humoral immunity;

[0056] (e6) Increases the expression of total IgG in plasma;

[0057] (e7) Increases the expression of sIgA in feces;

[0058] (e8) As an animal feed additive;

[0059] (e9) Increase the overall weight gain of animals;

[0060] (e10) Increase the average daily weight gain of animals;

[0061] (e11) Reduce the average daily feed intake of animals;

[0062] (e12) Reduce the feed efficiency of animals.

[0063] Furthermore, the pathogenic microorganism may be a pathogenic bacterium or a virus; even further, the pathogenic bacterium may be Salmonella typhimurium or Staphylococcus aureus; the virus may be porcine epidemic diarrhea virus (PEDV) or / and porcine diarrhea coronavirus (PDCoV).

[0064] In a specific embodiment of the present invention, the *Salmonella typhimurium* is specifically *Salmonella typhimurium* (ATCC 14028). The *Staphylococcus aureus* is *Staphylococcus aureus* (ATCC25920). The porcine epidemic diarrhea virus is porcine epidemic diarrhea virus strain CV777 or porcine diarrhea coronavirus (PDCoV) strain SCCZ18.

[0065] Furthermore, the animal may be a mammal.

[0066] Furthermore, the mammal may be a pig or a mouse.

[0067] Sixthly, the present invention claims protection for any of the following methods:

[0068] (f1) A non-disease treatment method for enhancing the immunity of an animal, comprising the steps of administering to the animal the fusion protein described in the first aspect above, or the nucleic acid molecule described in the second aspect above, or the biological material described in the third aspect above, or the product described in the fifth aspect above.

[0069] (f2) A method for promoting animal growth and development, comprising the steps of adding the fusion protein described in the first aspect above, or the nucleic acid molecule described in the second aspect above, or the biological material described in the third aspect above, or the product described in the fifth aspect above, to the animal feed.

[0070] (f3) A method for promoting the proliferation of immune cells in vitro, comprising the following steps: adding the fusion protein described in the first aspect above, the nucleic acid molecule described in the second aspect above, the biological material described in the third aspect above, or the product described in the fifth aspect above to an immune cell culture system.

[0071] In (f1) and (f2), further, the animal may be a mammal. Even further, the mammal may be a pig or a mouse.

[0072] This invention constructs a recombinant yeast strain, Po1h-IL17 / 22 / 29, that expresses a fusion molecule of porcine IL-17, IL-22, and IL-29. Treatment of cells and mice with this strain confers enhanced immune resistance to viral and bacterial infections. Subsequent oral inoculation of piglets with Po1h-IL17 / 22 / 29 confirmed that it significantly improved growth performance and systemic immunity in piglets. Attached Figure Description

[0073] Figure 1 Results of lymphocyte proliferation activity stimulated by recombinant expression of IL-17, IL-22 and IL-29 fusion molecules.

[0074] Figure 2 The changes in the expression levels of the N virus gene in each group after Vero cells were infected with porcine epidemic diarrhea virus (PEDV).

[0075] Figure 3 The figure shows the changes in the expression levels of M and N viral genes in different groups after PDCoV infection of ST cells. In the figure, Po1h-IL-17 / 22 / 29-1 is the original recombinant yeast culture medium; Po1h-IL-17 / 22 / 29-2 is the original recombinant yeast culture medium diluted 10 times.

[0076] Figure 4 The change in body weight of mice in each experimental group.

[0077] Figure 5 The following table shows the changes in the proportion of T cell subsets at different time points: a represents cytotoxic T cells, b represents helper T cells, c represents naive T cells, d represents central memory T cells, e represents effector memory T cells, and f represents regulatory T cells.

[0078] Figure 6The following figures show the changes in the proportion of B cell subsets at different time points: a represents plasma cells, b represents naive B cells, c represents non-switched memory B cells, and d represents switched memory B cells.

[0079] Figure 7 The changes in immune-related genes in mouse peripheral blood are shown. a represents IFN-γ; b represents IL-7; c represents IL-15; d represents IL-22; e represents IL-23; and f represents TNF-α.

[0080] Figure 8 This shows the changes in total IgG levels in the peripheral blood of mice.

[0081] Figure 9 The images show changes in immune-related genes in the small intestinal tissue of mice after challenge with Staphylococcus aureus; image a shows challenge with Salmonella typhimurium; image b shows challenge with Salmonella typhimurium.

[0082] Figure 10 The level of sIgA in mouse feces.

[0083] Figure 11 Morphological changes in small intestinal tissue in mice after viral challenge.

[0084] Figure 12 This is a statistical chart showing the morphological changes in small intestinal tissue. a) shows Staphylococcus aureus challenge; b) shows Salmonella typhimurium challenge.

[0085] Figure 13 The values ​​represent the survival rate of mice after challenge with the virus. a) St. aureus challenge; b) Salmonella typhimurium challenge.

[0086] Figure 14 The changes in growth performance of piglets during the nursery period under different treatments are shown in Figure a. Average total weight gain of piglets; Figure b. Average daily weight gain of piglets; Figure c. Average daily feed intake of piglets; and Figure d. Feed efficiency of piglets.

[0087] Figure 15 The dynamic changes in leukocyte (a), neutrophil (b), lymphocyte (c), erythrocyte (d), hemoglobin concentration (e), and platelet count (f) in peripheral blood of piglets.

[0088] Figure 16 The dynamic changes in the expression levels of Th1 / Th2 cytokines IL-2(a), IL-12(b), IL-10(c), IL-4(d) and IL-6(e) in porcine PBMCs.

[0089] Figure 17 The dynamic changes in the expression levels of immune memory-related cytokines IL-15(a), IL-23(b), and CD62L(c) in porcine PBMCs.

[0090] Figure 18 For the dynamic changes in the expression levels of TLR1 (a), TLR2 (b), TLR3 (c), TLR5 (d), TLR7 (e), TLR8 (f) and TLR9 (g) in porcine PBMC.

[0091] Figure 19 For the dynamic changes in the contents of cytokines IL-17 (a), IL-22 (b) and IL-29 (c) in porcine peripheral blood plasma. Specific implementation manners

[0092] The present invention will be further described in detail below in conjunction with specific implementation manners. The provided examples are only for clarifying the present invention and not for limiting the scope of the present invention. The following examples can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.

[0093] The experimental methods in the following examples are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product specifications. The materials, reagents, etc. used in the following examples can be obtained from commercial channels unless otherwise specified.

[0094] The Kunming mice in the following examples: Experimental Animal Center of Sichuan University, production license number: SCXK (Sichuan) 2018-026. Chuanxiang black pigs: Products of the Pig Research Institute of Sichuan Academy of Animal Science. 100× penicillin-streptomycin mixture: HyClone company. The pINA1297 vector and the Yarrowia lipolytica Po1h strain were both kindly donated by Professor Madzak of the French Academy of Agricultural Sciences, and are all recorded in the following literature: Madzak C, Gaillardin C, Beckerich JM. Heterologous protein expression and secretion in the non-conventional yeast Yarrowia lipolytica: a review. J Biotechnol. 2004 Apr 8; 109(1-2):63-81. doi:10.1 / j.jbiotec.2003.10.027. PMID: 15063615. The public can obtain it from the applicant and can only be used for repeating the experiments of the present invention and cannot be used for other purposes.

[0095] Example 1: Construction of a co-expression system of porcine interleukin 17, 22 and 29 fusion genes in Yarrowia lipolytica and in vitro activity research

[0096] I. Design of fusion protein IL-17 / 22 / 29 and its encoding gene

[0097] The amino acid sequence of the fusion protein IL-17 / 22 / 29 is shown in SEQ ID No. 1. In SEQ ID No. 1, positions 1-131 are porcine interleukin-17, positions 132-137 are histidine tags, positions 138-140 are linker peptides (GSG), positions 141-159 are P2A autosplicing peptides, positions 160-174 are secretion signal peptides (XPR2Pre), positions 175-364 are porcine interleukin-22, positions 365-370 are histidine tags, positions 371-373 are linker peptides (GSG), positions 374-392 are P2A autosplicing peptides, positions 393-407 are secretion signal peptides (XPR2Pre), positions 408-580 are porcine interleukin-29, and positions 581-586 are histidine tags.

[0098] The DNA molecule shown in SEQ ID No. 2 encodes the fusion protein IL-17 / 22 / 29, and this DNA molecule is named the IL-17 / 22 / 29 gene. In SEQ ID No. 2, nucleotides 1-393 encode porcine interleukin-17, nucleotides 394-411 encode a histidine tag, amino acids 412-420 encode a linker peptide, nucleotides 421-477 encode a P2A autosplicing peptide, nucleotides 478-522 encode a secretion signal peptide XPR2Pre, nucleotides 523-1092 encode porcine interleukin-22, nucleotides 1093-1110 encode a histidine tag, nucleotides 1111-1119 encode a linker peptide, nucleotides 1120-1176 encode a P2A autosplicing peptide, nucleotides 1177-1221 encode a signal peptide XPR2Pre, nucleotides 1222-1740 encode porcine interleukin-29, nucleotides 1741-1758 encode a histidine tag, and nucleotides 1759-1761 are stop codons.

[0099] The IL-17 / 22 / 29 fusion gene fragment (SEQ ID No. 2) was synthesized by Nanjing Genscript Biotech Co., Ltd. and constructed between the BamHI and KpnHI recognition sequences on the self-cloning shuttle vector pINA1297. The recombinant shuttle vector was named pINA1297-IL-17 / 22 / 29.

[0100] pINA1297-IL-17 / 22 / 29 Structural Description: A recombinant vector obtained by replacing the fragment between the BamHI and KpnHI recognition sequences in the pINA1297 vector with the DNA fragment shown in SEQ ID No. 2.

[0101] II. Transformation of E. coli with recombinant shuttle vector and large-scale plasmid extraction

[0102] 1. Transformation of Escherichia coli using recombinant shuttle vectors

[0103] (1) The constructed recombinant shuttle vector pINA1297-IL-17 / 22 / 29 was transformed into Escherichia coli competent cells Top10. The bacterial culture was spread on Luria-Bertani (LB) medium plates containing kanamycin, placed upright for 30 min, and then placed in an incubator at 37℃ and inverted overnight.

[0104] (2) Pick a single colony from the LB plate and put it into 1 mL of LB liquid medium containing 50 mg / mL kanamycin. Incubate on a shaker for 2 h. Then transfer the bacterial culture to 5 mL of fresh LB liquid medium and incubate overnight for 12-16 h. Preserve the bacterial culture for the next step of the experiment.

[0105] 2. Screening and identification of positive clones

[0106] The positive transformants were identified by colony PCR and sequencing.

[0107] 3. Extraction of recombinant self-cloning vector pINA1297-IL17 / 22 / 29

[0108] According to the instructions of the OMEGA plasmid mini-extraction kit, the bacterial culture in step 1 (2) was extracted with the self-cloning vector pINA1297-IL17 / 22 / 29. The extracted product was detected by 1.5% agarose gel electrophoresis.

[0109] III. Construction of recombinant Yersinia lipolyticis Po1h-IL-17 / 22 / 29

[0110] 1. Linearization and transformation of recombinant plasmid pINA1297-IL-17 / 22 / 29

[0111] (1) The recombinant plasmid pINA1297-IL-17 / 22 / 29 was linearized using the restriction endonuclease Not I. The recovered linearized fragment was transformed into Yeast lipolyticis Po1h competent cells to obtain recombinant yeast, named Po1h-IL17 / 22 / 29.

[0112] (2) Take the empty vector plasmid pINA1297 and linearize it with the restriction endonuclease NotⅠ. Transform the linearized fragment into Yeast lipolyticis Po1h competent cells to obtain recombinant yeast, named Po1h-pINA1297.

[0113] IV. Expression and in vitro activity of the IL-17 / 22 / 29 fusion gene in *Yarrowia lipolytica*

[0114] 1. Protein level detection

[0115] The recombinant yeast Po1h-IL-17 / 22 / 29 and recombinant yeast Po1h-pINA1297 prepared above were inoculated into 250ml shake flasks containing 100ml YPD liquid medium and cultured at 28℃ and 200rpm in an air bath for 48h. The fermentation broth was then subjected to ultrasonic lysis (200W power, 3s sonication, 10s interval, repeated 30 times). The supernatant was collected by centrifugation at 4℃ and 10000rpm for determination of recombinant protein expression levels. The recombinant protein expression in the supernatant of the lysed yeast was detected according to the instructions of the Porcine Interleukin17(IL-17)ELISA Kit (CUSABIO, China), Porcine Interleukin 22(IL-22)ELISA Kit (CUSABIO, China) and Porcine Interleukin 29(IL-29)ELISA Kit (CUSABIO, China).

[0116] The results showed that protein standard curves for detecting porcine IL-17, IL-22, and IL-29 were established using the kit and the standard proteins, respectively (y = 173.97x - 10.549, R0). 2 =0.9915; y=725.38x+6.3755, R 2 =0.9946;y=75.734x-4.0126,R 2 =0.9939; where x is the OD450 value and y is the protein content (in pg / mL). Expression of the target protein was detected in the supernatant of recombinant yeast Po1h-IL17 / 22 / 29 fragments, with porcine IL-17, IL-22, and IL-29 levels of 413.25 pg / mL, 2763.91 pg / mL, and 1002.85 pg / mL, respectively. No expression of the corresponding target protein was detected in the supernatant of recombinant yeast Po1h-pINA1297 fragments.

[0117] 2. Lymphocyte proliferation assay - CCK8

[0118] (1) Preparation of lymphoblasts

[0119] Under aseptic conditions, 5 mL of peripheral blood from the anterior vena cava of pigs was collected, anticoagulated with EDTA-2K, and porcine lymphocytes were isolated according to the instructions of the porcine peripheral blood lymphocyte separation solution KIT (Tianjin Haoyang Huake Biotechnology Co., Ltd., China). The isolated cells were diluted with complete 1640 culture medium (containing 10% fetal bovine serum, 100 μg / mL ampicillin, and 100 μg / mL streptomycin) to a final cell concentration of 2 × 10⁻⁶ cells / mL. 6Dispense 10 mL of the solution per 10 cm diameter cell culture dish, and finally add the solution to a final concentration of 10 μg / mL. Stimulated with Con A (L7647, Merck KGaA, Germany), the cells were cultured at 37°C in a 5% CO2 incubator for 24 hours.

[0120] (2) Detection of biological activity

[0121] After culturing for 24 hours, the porcine lymphoblasts in the culture dish were collected into a clean centrifuge tube and centrifuged at 1500 rpm for 15 min to collect the cells. The cells were washed twice with 1640 complete culture medium (containing antibiotics and serum) and centrifuged at 1500 rpm for 15 min.

[0122] The cells were adjusted to approximately 6 × 10⁶ cells using 1640 medium containing 20 mg / mL α-MM. 6 100 μL of target cells (porcine lymphoblasts) and the same volume of Po1h-IL-17 / 22 / 29 lysate supernatant (see step 1) and Po1h-pINA1297 lysate supernatant (see step 1) were added to each well of a 96-well plate. Each sample was tested in triplicate, with a control well included. The plates were incubated at 37°C in a 5% CO2 incubator for 48 h. After 48 h, the 96-well plate was removed, and 10 μL of CCK8 was added to each well. The plates were gently mixed and incubated for another 2 h. The OD values ​​of each well were then measured using a Bio-Reader 680. 450 .

[0123] See results Figure 1 The ability of the supernatant of recombinant yeast Po1h-IL-17 / 22 / 29 to promote the proliferation of porcine lymphoblasts was detected using a CCK-8 assay. The results showed that the supernatant of Po1h-IL-17 / 22 / 29 significantly increased the proliferation of lymphoblasts compared with the empty vector group Po1h-pINA1297 and the blank control group PBS (P<0.01), indicating that the recombinant protein has good immunobiological activity.

[0124] (3) In vitro anti-PEDV virus proliferation effect of recombinant protein

[0125] Adjust Vero cell density to 1.86 × 10⁻⁶ 5 Add 1 mL of the solution per well to a 6-well cell culture plate and incubate. Once approximately 70%-80% cell confluence has been achieved, dilute the initial concentration of the Po1h-pINA1297 and Po1h-IL-17 / 22 / 29 lysate supernatant to 450 μg / well (based on total protein) using DMEM medium containing 6% FBS, within a safe concentration range, and add to the 6-well plate. A blank control is also included, pretreated in an incubator for 24 hours.

[0126] Vero cells treated with lysed supernatant for 24 h were infected with PEDV strain CV777 (MOI = 0.01). At 48 h post-infection, a large number of control cells died. To detect the total viral load in cells and culture medium, infected cells were harvested, and primers designed based on the PEDV N-protein gene (PEDV-N-protein-F: CGTACAGGTAAGTCAATTAC; PEDV-N-protein-R: GATGAAGCATTGACTGAA) were used to perform absolute quantitative PCR to detect the expression level of the PEDV N-protein gene.

[0127] See results Figure 2 Vero cells treated with Po1h-IL-17 / 22 / 29 showed a significant reduction in viral proliferation (P<0.01), which significantly enhanced the anti-PEDV proliferation effect.

[0128] (4) In vitro anti-PDCov virus proliferation effect of recombinant protein:

[0129] 1) Resuscitation and passage culture of porcine testicular cells (ST)

[0130] Preheat and equilibrate the DMEM medium containing 10% FBS to 37°C in a water bath. Remove a vial of frozen ST cells from the -80°C freezer and quickly place it in clean water at 37°C until just thawed. Add the thawed cells to 3 mL of preheated DMEM medium containing 10% FBS and gently resuspend until the cells are completely dispersed. Place the resuspended cells into a 3 cm cell culture dish, label it, mix well, and incubate at 37°C in a 5% CO2 incubator. Remove cells that have reached 95% confluence from the incubator, discard the culture medium in a laminar flow hood, and wash the cells twice with 1 mL of sterile PBS. Digestion: Add 1 mL of trypsin, shake the cell culture flask horizontally to ensure the trypsin covers all cells, and place the flask in a 37°C incubator in a 5% CO2 incubator. After 3-4 minutes, observe under a microscope; increased intercellular spaces, rounded cells, and cells falling off easily when gently tapped indicate complete digestion. Dispersing: Add 1 mL of DMEM medium containing 10% FBS to the cell culture dish to neutralize trypsin. Gently pipette the cells from the flask wall until they are dispersed individually or in uniform clusters of three to five. Collect the dispersed cell suspension into a 15 mL centrifuge tube and centrifuge at 1000 rpm for 5 min. Discard the supernatant, add 2 mL of DMEM medium containing 10% FBS to the centrifuge tube, gently pipette the resuspended cells, and count the cells using a cell counting chamber. The cell density of the suspension is 1.32 × 10⁻⁶ cells / mL. 6Cells / ml. Subculturing: Dilute the cell suspension 10-fold with DEME medium containing 10% FBS, then transfer 1 ml of the diluted cell suspension to two six-well plates, add medium, shake well, and incubate at 37°C in a 5% CO2 incubator.

[0131] 2) Treatment of porcine testicular cells (ST) with recombinant fusion cytokines

[0132] Once the cells have grown to approximately 70%-80%, within a safe concentration range, the initial concentration of the recombinant fusion cytokines (i.e., the supernatant of the recombinant yeast Po1h-IL-17 / 22 / 29 lysate and the supernatant of the Po1h-pINA1297 lysate obtained in step 1) is uniformly diluted to 410 μg / well (based on total protein) using DMEM medium containing 6% FBS. The loading order is shown in Table 1. A blank control was also set up and pretreated in an incubator for 24 h.

[0133] Table 1. Recombinant protein loading sequence

[0134]

[0135] ST cells treated with the supernatant of Z9 (recombinant yeast Po1h-IL-17 / 22 / 29) and Po1h-pINA1297 for 24 h were infected with PDCoV SCCZ18 strain (MOI = 0.1). At 48 h post-infection, a large number of cells in the control group (cells cultured in DMEM medium only) died. To detect the total viral load in the cells and culture medium, infected cells were harvested, and primers were designed based on the M and N protein genes of PDCoV.

[0136] PDCoV-M-protein-F: CTTATTCTGCTTTGGCTGCTC-3';

[0137] PDCoV-M-protein-R: 5'-GGATATGAAGGTTAGTACGGC-3';

[0138] PDCoV-N-protein-F: 5'-ATCGACCACATGGCTCCAA-3';

[0139] PDCoV-N-protein-R: 5'-CAGCTCTTGCCCATGTAGCTT-3';

[0140] Absolute quantitative PCR was used to detect the expression levels of the M and N protein genes of PDCoV. The β-actin gene was used as an internal reference gene: ST-β-actin-F: 5'-CTGCGGCATCCACGAAACT-3', ST-β-actin-R: 5'-AGGGCCGTGATCTCCTTCTG-3'.

[0141] 3) Results

[0142] from Figure 3 It can be seen that the relative expression levels of PDCoV M and N genes in ST cells treated with Z9 (recombinant yeast Po1h-IL-17 / 22 / 29) were significantly lower than those in the PBS group and the Po1h-pINA1297 group (P<0.05). This indicates that the supernatant of Z9 (recombinant yeast Po1h-IL-17 / 22 / 29) lysate has a significant inhibitory effect on PDCoV proliferation.

[0143] Example 2: Bioactivity study of recombinant Yersinia lipolyticis Po1h-IL-17 / 22 / 29 in mice

[0144] I. Preparation of Recombinant Yeast Fermentation Broth

[0145] 1. After the recombinant yeast Po1h-pINA1297 constructed in Example 1 was revived and activated by streak inoculation on YPD plates, a single colony was picked and inoculated into a 100 mL shake flask containing 30 mL of YPD medium. The culture was then incubated at 28°C with air bath shaking at 220 rpm for 48 h to allow OD to reach the target concentration. 600 Approximately 10, yielding the Po1h-pINA1297 fermentation broth.

[0146] 2. Following the above method, replace the recombinant yeast Po1h-pINA1297 with the recombinant yeast Po1h-IL-17 / 22 / 29 (see Example 1), with all other steps remaining unchanged, to obtain the Po1h-IL-17 / 22 / 29 recombinant yeast fermentation broth.

[0147] II. Mouse Experimental Protocol

[0148] 1. Mouse grouping and experimental treatment

[0149] (1) Thirty healthy female Kunming mice, aged 4-5 weeks and weighing about 18 grams, were randomly divided into 3 groups of 10 mice each.

[0150] (2) Blank control group:

[0151] Mice were administered phosphate-buffered saline (PBS) by gavage at a dose of 100 μL per mouse per gavage, once every 3 days, for a total of 9 times.

[0152] (3) No-load control group:

[0153] Mice were administered Po1h-pINA1297 recombinant yeast fermentation broth by gavage at a volume of 4 × 10⁻⁶. 8 CFU / animal / time (100μL), administered by gavage once every 3 days, for a total of 9 times.

[0154] (4) Experimental group:

[0155] Mice were administered Po1h-IL-17 / 22 / 29 recombinant yeast fermentation broth via gavage at a volume of 4 × 10⁻⁶. 8 CFU / animal / time, administered by gavage once every 3 days, for a total of 9 times.

[0156] (5) Attacking the poison

[0157] Twenty-eight days after gavage treatment, challenge was initiated. Challenge procedure: Salmonella typhimurium (ATCC 14028) was concentrated and resuspended in fresh liquid LB medium to obtain 1.0 × 10⁻⁶ spores. 10 A bacterial suspension of CFU / mL was used as the challenge solution. Mice were administered the solution via gavage once every other day for a total of three times. Each gavage administration consisted of 300 μL of the bacterial suspension per mouse (5 mice per group). Mice were fasted for 2 hours before each gavage, but allowed free access to water. The day of gavage was designated as day 0 post-challenge. Mice were observed for disease progression and survival rates every 24 hours. Internal organ changes in dead mice were examined by dissection. The same method was used for Staphylococcus aureus (ATCC 25920) challenge experiments.

[0158] 2. Sample and data collection

[0159] (1) Body weight index

[0160] The mice were weighed weekly for four consecutive weeks (starting from the day before gavage administration before the challenge), and the dynamic changes in body weight of each group were recorded.

[0161] See results Figure 4 The body weights of mice in each group did not differ significantly at days 0, 7, 14, and 28 (P>0.05), indicating that the recombinant yeast has reliable biosafety.

[0162] (2) Blood immune indicators

[0163] Peripheral blood was collected from the tail vein of mice on days 7, 14, 21, and 28 after gavage before challenge and on day 3 after challenge.

[0164] (3) Fecal / intestinal immune markers

[0165] Fresh feces were collected from mice on day 28 before and day 3 after the challenge. Small intestinal tissue was collected after the mice were sacrificed at the end of the challenge for morphological and transcriptional analysis.

[0166] 3. Flow cytometry analysis of changes in immune cells in mouse peripheral blood

[0167] Anticoagulated blood samples collected from mice on days 7, 14, and 28 after gavage administration prior to viral challenge were analyzed by flow cytometry. Peripheral anticoagulated blood samples from mice at each time point were labeled with fluorescent antibodies, and flow cytometry analysis was used to analyze changes in lymphocyte counts in the PBS group, Po1h-pINA1297 group, and Po1h-IL-17 / 22 / 29 group. T lymphocyte immunophenotyping yielded Th, Tc, Naive T Cell, Tcm, Tem, Teff, and Treg types, while B lymphocyte immunophenotyping yielded Plasma Cell, Naive BCell, Switched Memory BCell, and Non-switched Memory B Cell types. The markers for lymphocyte typing are shown in Table 2.

[0168] Table 2. Markers for lymphocyte typing

[0169] Lymphocyte subsets Immune cell markers T cells CD3+ Cytotoxic T cells (Tc) CD3+ / CD8+ Helper T cells (Th) CD3+ / CD4+ <![CDATA[Central memory T cells (T CM )]]> CD3+ / CD4+ / CD44+ / CD62L+ <![CDATA[Effector memory T cells (T EM )]]> CD3+ / CD4+ / CD44+ / CD62L2- Naïve T cells CD3+ / CD4+ / CD44- / CD62L+ Regulatory T cells (Tregs) CD3+ / CD4+ / CD25+ / FoxP3+ B cells CD19+ <![CDATA[Non-switched memory B cells (B NSM )]]> CD19+ / CD27+ / IgD+ <![CDATA[Switched memory B cells (B SM )]]> CD19+ / CD27+ / IgD- Nascent B cells CD19+ / CD27- / IgD+ plasma cells CD27+ / CD38+

[0170] Figure 5The following table shows the changes in the proportion of T cell subsets at different time points: a) cytotoxic T cells, b) helper T cells, c) naive T cells, d) central memory T cells, e) effector memory T cells, and f) regulatory T cells. In a) the number of cytotoxic T cells in the PBS group decreased over time, while the number of cytotoxic T cells in the Po1h-pINA1297 and Po1h-IL-17 / 22 / 29 groups showed a trend of first increasing and then decreasing, reaching a peak on day 14 and then gradually decreasing. In b) the number of helper T cells in the PBS and Po1h-pINA1297 groups showed a gradual decreasing trend, while the number of helper T cells in the Po1h-IL-17 / 22 / 29 group showed a trend of first increasing and then decreasing. In c) the number of helper T cells in the Po1h-IL-17 / 22 / 29 group showed a trend of first increasing and then decreasing. The number of naive T cells in the PBS group peaked on day 14 and then decreased, while the number of naive T cells in the Po1h-pINA1297 group gradually increased; in group d, the number of central memory T cells in all three groups showed an increasing trend; in group e, the number of effector memory T cells in all three groups showed a trend of first decreasing and then increasing; in group f, the number of regulatory T cells in the PBS group and the Po1h-pINA1297 group remained basically the same at the three time points, while the number of regulatory T cells in the Po1h-IL-17 / 22 / 29 group was basically the same on days 7 and 14, but showed a significant increase on day 28. These results indicate that IL-17 / 22 / 29 can significantly increase the number of CD4+ T and naive T cells (on day 14) and increase T cell count. EM Compared with Treg cell levels (28 days); it has a significant biological effect of regulating the increase in the number of active T cells.

[0171] Figure 6 The following table shows the changes in the proportion of B cell subsets at different time points: a) plasma cells, b) naive B cells, c) non-switched memory B cells, and d) switched memory B cells. In group a, the number of plasma cells in all three groups showed a trend of first increasing and then decreasing, with the number of plasma cells in the Po1h-IL-17 / 22 / 29 group significantly higher than the other two groups on day 14. In group b, the number of naive B cells in all three groups showed an increasing trend. In group c, the number of non-switched memory B cells in the PBS group and the Po1h-IL-17 / 22 / 29 group first increased and then decreased, while the proportion in the Po1h-pINA1297 group maintained an increasing trend. In group d, the number of switched memory B cells in all three groups decreased continuously over time. These results demonstrate that IL-17 / 22 / 29 can significantly promote the growth of plasma cells and B cells. NSM Increased BSM cell count (14 days); significantly enhanced specific humoral immune response and immune memory activity in experimental animals.

[0172] 4. Changes in immune-related genes in mouse peripheral blood

[0173] Total RNA was extracted from anticoagulated peripheral blood of mice on days 14 and 28 after gavage before challenge and on day 3 after challenge. cDNA was obtained by reverse transcription, and the expression of immune-related genes (IL-7, IL-15, IL-22, IL-23, IFN-γ, and TNF-α) in peripheral blood was detected by quantitative real-time PCR. Primers used to detect the target genes in mice are shown in Table 3.

[0174] Table 3. Primers for detecting target genes in mice

[0175]

[0176]

[0177] Note: PPIA is the quantitative internal reference gene - peptidyl prolyl isomerase A.

[0178] Figure 7 This shows the changes in immune-related genes in mouse peripheral blood.

[0179] The expression level of IFN-γ gene in the Po1h-IL-17 / 22 / 29 group was significantly higher than that in the PBS group on day 14 (P<0.05).

[0180] The expression level of IL-7 gene in the Po1h-IL-17 / 22 / 29 group was significantly higher than that in the PBS group on day 14 (P<0.01).

[0181] The expression level of IL-15 gene was significantly higher in the Po1h-IL-17 / 22 / 29 group than in the PBS group at days 14 and 28 and after Staphylococcus aureus challenge (P<0.05).

[0182] The expression level of IL-22 gene in the Po1h-IL-17 / 22 / 29 group was significantly higher than that in the PBS group on days 14 and 28 (P<0.01), and the expression level of IL-22 gene in the Po1h-IL-17 / 22 / 29 group was significantly higher than that in the PBS group after Salmonella typhimurium challenge (P<0.05).

[0183] The expression level of IL-23 gene was significantly higher in the Po1h-IL-17 / 22 / 29 groups after Salmonella typhimurium challenge on day 28 than in the PBS group (P<0.05).

[0184] The expression level of TNF-α gene was significantly higher in the Po1h-IL-17 / 22 / 29 groups after challenge with Salmonella typhimurium and Staphylococcus aureus on day 14 than in the PBS group (P<0.05).

[0185] The above results indicate that IL-17 / 22 / 29 can significantly upregulate the levels of IFN-γ, IL-7, and TNF-α, as well as IL-15 (14 days or after challenge), IL-22, and IL-23 (28 days or after challenge), thereby enhancing their immune response and anti-infection regulatory activities.

[0186] 5. Changes in total IgG in mouse plasma

[0187] 200 μL of EDTA-anticoagulated peripheral blood from the tail vein of mice was collected on days 7, 14, and 28 after gavage before challenge and on day 3 after challenge. The supernatant was centrifuged at 4000 rpm for 20 min to obtain plasma. The changes in total IgG in mouse plasma were measured according to the instructions of the mouse immunoglobulin G (IgG) kit (RX202736M, Ruixin Biotechnology).

[0188] See results Figure 8 On days 7, 14, and 28, and after challenge, the levels of IgG in the peripheral blood plasma of mice in the Po1h-IL17 / 22 / 29 group were significantly higher than those in the blank control group (PBS) (P<0.01). These results indicate that the fermentation product of recombinant yeast Po1h-IL-17 / 22 / 29 can stimulate mice to produce more total IgG, effectively enhancing their humoral immunity.

[0189] 6. Changes in immune-related genes in mouse small intestinal tissue

[0190] After the viral challenge, 25 mg of small intestinal tissue was collected from mice, ground with liquid nitrogen, and total RNA was extracted and reverse transcribed into cDNA. The expression of Jak-1, STAT1, IL-1β, IL-8, BD2, S100A8, RegⅢ, TGF-β, and TNF-α genes in the intestinal tissue was detected by quantitative real-time PCR. Primers used to detect immune-related genes in mouse small intestinal tissue are shown in Table 4.

[0191] Table 4. Primers for detecting immune-related genes in mouse small intestinal tissue

[0192]

[0193] Figure 9To investigate the changes in immune-related genes in the small intestine of mice after challenge with Staphylococcus aureus, under challenge conditions (a), the expression levels of immune-related genes Jak1 and STAT1 in the small intestine of mice in the Po1h-IL-17 / 22 / 29 group were significantly higher than those in the empty vector group (Po1h-pINA1297) and the blank control group (PBS) (P<0.05); under challenge conditions with Salmonella typhimurium, the expression levels of immune-related genes such as BD2, IL-1β, IL-8, RegIII, S100A8, and TNF-α in the small intestine of mice in the Po1h-IL-17 / 22 / 29 group were all significantly higher than those in the other two groups (P<0.01). These results indicate that IL-17 / 22 / 29 can significantly enhance the secretion of antimicrobial peptides in the intestinal mucosa and improve the beneficial biological effects of innate immune function in fighting infection.

[0194] 7. Mouse fecal sIgA levels

[0195] Fresh feces were collected from mice on day 28 after gavage before challenge and on day 3 after challenge. The feces were resuspended in 4 mL / g of 0.01 M PBS and 0.05 M EDTA buffer, vortexed on ice for 15 min, centrifuged at 10000 g for 5 min at 4 °C, and the supernatant was stored at -80 °C for later analysis. The fecal sIgA content was determined according to the instructions of the Mouse Secretory Immunoglobulin A (sIgA) Quantitative Detection Kit (ELISA) (RX-G202950M, Ruixin Biotechnology).

[0196] Figure 10 The fecal sIgA levels in mice were as follows: before and under different challenge conditions, the fecal sIgA content in the Po1h-IL-17 / 22 / 29 group was significantly higher than that in the PBS group and the empty vector group Po1h-pINA1297 (P<0.01), and its content was 4-5 times that of the PBS group and the Po1h-pINA1297 group, indicating that the fusion molecule IL-17 / 22 / 29 has a high effect on enhancing sIgA expression level.

[0197] 8. Morphological changes in small intestinal tissue after challenge in mice

[0198] After the challenge, small intestinal tissue was collected from mice in each group and stained with hematoxylin and eosin (H&E) for observation and measurement of villus height, crypt depth, and intestinal wall thickness to assess the structure and function of the small intestine.

[0199] Figure 11 Morphological changes in small intestinal tissue in mice after viral challenge. Figure 12The graph shows the statistical changes in small intestinal tissue morphology. In (a) under Staphylococcus aureus challenge conditions, the villus height in the Po1h-IL-17 / 22 / 29 group was significantly higher than that in the PBS group (P<0.01). In (b) under Salmonella typhimurium challenge conditions, the villus height and crypt depth in the Po1h-IL-17 / 22 / 29 group were significantly higher than those in the empty vector group and the blank control group (P<0.05). These results indicate that IL-17 / 22 / 29 has a significant and beneficial biological effect in protecting the structure and function of the intestinal mucosa.

[0200] 9. Survival rate of mice after viral challenge

[0201] On day 28 after gavage administration to mice before challenge, 5 mice in each group were challenged with Staphylococcus aureus and 5 mice with Salmonella typhimurium. The daily change in the number of mice after challenge was recorded, the number of days the mice survived was counted, the survival rate was calculated, and the survival curve of mice after challenge was plotted.

[0202] Figure 13 Survival rate of mice after challenge. Under both challenge conditions, the survival rates of mice in the Po1h-IL-17 / 22 / 29 group were significantly different from those in the PBS group and the empty vector group (P<0.05), indicating that immunization with Po1h-IL-17 / 22 / 29 fermentation broth for 28 days significantly improved the survival rate of mice after challenge. Two weeks after Staphylococcus aureus challenge, only 20% of mice in the PBS group survived, while the survival rate in the Po1h-IL-17 / 22 / 29 group was 80%; two weeks after Salmonella typhimurium challenge, the survival rate of mice in the PBS group was 40%, while the survival rate in the Po1h-IL-17 / 22 / 29 group was 100%.

[0203] Example 3: Study on the biological activity of porcine interleukin 17, 22 and 29 fusion protein in pigs.

[0204] I. Preparation of Fermentation Products from Recombinant Yeast Po1h-IL17 / 22 / 29

[0205] 1. Recombinant yeast Po1h-IL17 / 22 / 29 (see Example 1) was inoculated into 2.5 mL of liquid YPD medium and cultured overnight at 28°C with shaking in an air bath at 200 rpm.

[0206] 2. Take the bacterial culture obtained in step 1 and inoculate it into a 2L shake flask containing 1L of liquid YPD medium. Incubate at 28℃ and 220rpm with air bath shaking until OD reaches 1000°C. 600 It is 20 (approximately 24 hours).

[0207] 3. Take the bacterial culture obtained in step 2 and inoculate it into a 15L fermenter containing 10L of BSM fermentation medium at an inoculation rate of 10% (volume percentage). Incubate at 28℃ and 400rpm with stirring until the OD reaches 1000%.600 The fermentation time was 80 (approximately 48 hours), and the entire fermentation system was named Po1h-IL17 / 22 / 29 fermentation product.

[0208] II. Grouping and processing of experimental animals

[0209] 1. 38 healthy Huaxin dolphins, with a birth weight of approximately 2.4 kg, were randomly and equally divided into 2 groups;

[0210] 2. Experimental group (Po1h-IL17 / 22 / 29 group): Starting from 10 days of age, the Po1h-IL17 / 22 / 29 yeast solution obtained in step one was added to the creep feed at a rate of 20 ml per piglet, once every two days until the end of the 28-day lactation period; after 28 days of age, the yeast solution was added to the nursery feed at a rate of 30 ml per piglet, once every two days until the end of the 56-day nursery period; the control group was fed with an equal amount of PBS added to the regular creep feed and nursery feed, without adding any other raw materials;

[0211] 3. Blood samples were collected from the jugular vein of each pig on days 14, 28, 42 and 56 after birth. The following experiments were conducted: 2.5 mL of anticoagulated blood was used for routine blood tests and to detect the expression of immune-related genes in PBMCs. The remaining anticoagulated blood was separated into plasma to detect changes in the content of related cytokines. The body weight of each group of experimental pigs was measured at birth and at the end of the nursery period.

[0212] III. Testing of Each Indicator

[0213] 1. Growth performance indicators of piglets

[0214] Figure 14 The study investigated the changes in growth performance of piglets during the nursery period under different treatments. The average total weight gain and average daily weight gain in the Po1h-IL-17 / 22 / 29 experimental group were significantly higher than those in the control group (PBS) (P<0.01); while the average daily feed intake and feed efficiency in the Po1h-IL-17 / 22 / 29 experimental group were significantly lower than those in the control group (PBS) (P<0.01). These results indicate that the fermentation product of recombinant yeast Po1h-IL-17 / 22 / 29 can effectively promote the weight gain of piglets and reduce feed efficiency.

[0215] 2. Complete blood count

[0216] Figure 15The study investigated the dynamic changes in the number of leukocytes (a), neutrophils (b), lymphocytes (c), erythrocytes (d), and platelets (f) and the hemoglobin concentration (e) in the peripheral blood of piglets. At most time points throughout the feeding process, there were no significant differences in the number of leukocytes, neutrophils, platelets, erythrocytes, and hemoglobin concentration in the peripheral blood of pigs in the Po1h-IL-17 / 22 / 29 group compared to the PBS control group (P>0.05), indicating that the recombinant yeast had good biosafety.

[0217] Figure 15 In the figure, c represents the dynamic change in the number of peripheral blood lymphocytes in piglets. On days 14 and 28 after feeding, the number of lymphocytes in the Po1h-IL-17 / 22 / 29 experimental group was significantly higher than that in the PBS control group (P<0.05), indicating that recombinant yeast can significantly improve the animals' resistance to infection.

[0218] 3. Detection of the expression of immune-related genes in PBMCs by real-time quantitative PCR

[0219] Figure 16 The dynamic changes in the expression levels of Th1 / Th2 cytokines IL-2 (a), IL-12 (b), IL-10 (c), IL-4 (d), and IL-6 (e) in porcine PBMCs were presented. Viral and intracellular parasitic infections primarily induce Th0 cells to differentiate into Th1 cells, while allergens (inducing allergic antigens) and parasitic infections primarily induce Th0 cells to differentiate into Th2 cells. IL-12 promotes the survival and growth of Th1 cells, maintaining a sufficient number of memory / effective Th1 cells. Furthermore, IL-12 also inhibits Th2 cell formation. Th1 cells are also the main source of IL-2 and IL-10. IL-2 secreted by Th1 cells can stimulate the growth, differentiation, and survival of antigen-selective cytotoxic T cells, and is essential for T cell memory, T cell development, and self- or non-self-recognition; IL-10 is an autoregulator of Th1 cell activation. Th2 cells are CD4+ cells... + Th2 helper cells are a subtype of cells that primarily respond to immune responses against extracellular multicellular parasites. They are mainly induced by IL-4. Th2 cells are also a source of IL-6 and IL-10. IL-6 secreted by Th2 cells plays a crucial role in the maturation of B cells into IgG-secreting cells. On day 56 after feeding, the expression levels of IL-2, IL-12, IL-10, IL-4, and IL-6 in PBMCs of pigs in the Po1h-IL-17 / 22 / 29 group were significantly higher than those in the blank control group (PBS) (P<0.01).

[0220] Figure 17This study describes the dynamic changes in the expression levels of immune memory-related cytokines IL-15(a), IL-23(b), and CD62L(c) in porcine PBMCs. Immune memory-related factors can promote the differentiation and development of immune memory-related cells, thus promoting the formation of immune memory and enhancing the body's immune response. IL-15 can stimulate the growth and development of intestinal epithelial cells, T cells, and NK cells, and enhance CD8+ expression. + Survival of memory T cells; IL-23 can induce the proliferation of TH17 memory T cells and increase the expression of IFN-γ. On day 56 after feeding, the expression levels of IL-15, IL-23, and CD62L in PBMCs of pigs in the Po1h-IL-17 / 22 / 29 group were significantly higher than those in the blank control group (PBS) (P<0.01). The results indicate that the fermentation product of recombinant yeast Po1h-IL-17 / 22 / 29 can promote the production of immune memory-related factors, thereby improving the immunity of pigs.

[0221] Figure 18 This study presents the dynamic changes in TLR expression levels in porcine PBMCs. Pattern recognition receptors (TRRs) act as a bridge between innate and specific immunity. TLR1, TLR2, and TLR5 primarily recognize bacteria, TLR3 recognizes viral double-stranded RNA, and TLR7 can directly recognize ligands such as single-stranded RNA or nucleic acid analogs. TLR7 binds to specific recruitment proteins and activates regulatory factors such as nuclear factor-κB, mitogen-activated protein kinase, and interferon, thereby initiating innate and adaptive immune responses and participating in anti-infection immunity. TLR8 is the only protein in the Toll-like receptor family capable of reversing immunosuppression induced by Treg cells, and TLR9 recognizes viral CpG DNA. On day 56 after feeding, the expression levels of TLR2(b), TLR3(c), TLR5(d), TLR7(e), TLR8(f), and TLR9(g) in porcine PBMCs of the Po1h-IL-17 / 22 / 29 group were significantly higher than those in the blank control group (PBS) (P<0.01). The results showed that the fermentation product of recombinant yeast Po1h-IL-17 / 22 / 29 could enhance the body's antigen recognition function and thus improve the specific immunity of pigs.

[0222] 4. ELISA detection of cytokine levels in porcine peripheral blood plasma

[0223] Figure 19 The dynamic changes in the levels of cytokines IL-17, IL-22, and IL-29 in porcine peripheral blood plasma.

[0224] On day 56 after feeding, the IL-17 level in peripheral blood plasma of pigs in the Po1h-IL-17 / 22 / 29 group was significantly higher than that in the blank control group (PBS) (P<0.01); on days 14 and 28 after feeding, the IL-29 and IL-22 levels in peripheral blood plasma of pigs in the Po1h-IL-17 / 22 / 29 group were both significantly higher than those in the blank control group (PBS) (P<0.05); Th17 cells are CD4 cells that are not part of the traditional Th1 and Th2 subtypes. + A subtype of helper cells. Th17 cells mainly secrete IL-17A, IL-17F, and IL-22, which are effector cytokines that mediate defense mechanisms, such as host responses to various infections, especially extracellular bacterial infections.

[0225] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A fusion protein comprising porcine interleukin-17, porcine interleukin-22 and porcine interleukin-29.

2. The fusion protein as described in claim 1, characterized in that: The fusion protein, from N-terminus to C-terminus, comprises: porcine interleukin 17, purification tag, self-cleaving polypeptide, secretion signal peptide, porcine interleukin 22, purification tag, self-cleaving polypeptide, secretion signal peptide, porcine interleukin 29, and purification tag. Furthermore, the fusion protein comprises, from the N-terminus to the C-terminus, the following components in sequence: porcine interleukin 17, histidine tag, linker peptide GSG, self-cleaving polypeptide 2A, secretion signal peptide XPR2Pre, porcine interleukin 22, histidine tag, linker peptide GSG, self-cleaving polypeptide 2A, secretion signal peptide XPR2Pre, porcine interleukin 29, and histidine tag. Furthermore, the fusion protein is the protein shown in SEQ ID No.

1.

3. A nucleic acid molecule encoding the fusion protein of claim 1 or 2.

4. The nucleic acid molecule as described in claim 3, characterized in that: The nucleic acid molecule is any one of the following: (b1) DNA molecules with coding regions as shown in SEQ ID No. 2; (b2) A DNA molecule that hybridizes under stringent conditions with the DNA molecule defined in (b1) and encodes the fusion protein; (b3) A DNA molecule that has at least 99%, 95%, 90%, 85%, or 80% homology with the DNA molecule defined in (b1) or (b2) and encodes the fusion protein.

5. Any of the following biological materials: (c1) An expression cassette containing the nucleic acid molecule of claim 3 or 4; (c2) A recombinant vector containing the nucleic acid molecule of claim 3 or 4; (c3) A transgenic cell line containing the nucleic acid molecule of claim 3 or 4; (c4) Recombinant bacteria containing the nucleic acid molecule of claim 3 or 4; The supernatant of the recombinant bacteria described in (c5) and (c4); The fermentation products of the recombinant bacteria described in (c6) and (c4).

6. The biomaterial as described in claim 5, characterized in that: The recombinant bacteria is recombinant yeast; Furthermore, the recombinant yeast is obtained by introducing the recombinant vector described in (c2) into a host yeast, wherein the host yeast is Yersinia lipolytica.

7. The use of the fusion protein of claim 1 or 2, the nucleic acid molecule of claim 3 or 4, or the biomaterial of claim 5 or 6 in any of the following: (d1) Prepare products that enhance animal immunity, or enhance animal immunity; (d2) Prepare products that resist pathogenic microbial infection, or products that resist pathogenic microbial infection; (d3) Prepare products that promote animal growth and development, or promote animal growth and development; (d4) Prepare products that promote the proliferation of immune cells, or promote the proliferation of immune cells; (d5) Prepare products that enhance humoral immunity, or enhance humoral immunity; (d6) Prepare products that increase IgG expression, or increase IgG expression; (d7) Prepare products that increase sIgA expression, or increase sIgA expression; (d8) Prepare animal feed or use as an animal feed additive; (d9) Prepare products that increase the total weight gain of animals, or increase the total weight gain of animals; (d10) Prepare products that increase the average daily weight gain of animals, or increase the average daily weight gain of animals; (d11) Prepare products that reduce the average daily feed intake of animals, or reduce the average daily feed intake of animals; (d12) Prepare products that reduce the feed efficiency of animals, or reduce the feed efficiency of animals.

8. The application as described in claim 7, characterized in that: The pathogenic microorganism is a pathogenic bacterium or virus; Furthermore, the pathogenic bacteria are Salmonella Typhimurium or Staphylococcus aureus; the virus is porcine epidemic diarrhea virus and / or porcine diarrhea coronavirus; and / or The animal in question is a mammal; Furthermore, the mammal is a pig or a mouse.

9. A product comprising porcine interleukin-17, porcine interleukin-22, and porcine interleukin-29; said product having any of the following functions: (e1) Improve animal immunity; (e2) Resistance to pathogenic microbial infections; (e3) Promotes animal growth and development; (e4) Promotes the proliferation of immune cells; (e5) Enhances humoral immunity; (e6) Increases IgG expression; (e7) Increase sIgA expression; (e8) As an animal feed additive; (e9) Increase the overall weight gain of animals; (e10) Increase the average daily weight gain of animals; (e11) Reduce the average daily feed intake of animals; (e12) Reduce the feed efficiency of animals; Furthermore, the pathogenic microorganism is a pathogenic bacterium or virus; Furthermore, the pathogenic bacteria are Salmonella Typhimurium or Staphylococcus aureus; the virus is porcine epidemic diarrhea virus or / and porcine diarrhea coronavirus; Furthermore, the animal is a mammal; even further, the mammal is a pig or a mouse.

10. Any of the following methods: (f1) A non-disease treatment method for enhancing the immune capacity of animals, comprising the steps of administering to the animal the fusion protein of claim 1 or 2, or the nucleic acid molecule of claim 3 or 4, or the biomaterial of claim 5 or 6, or the product of claim 9; (f2) A method for promoting animal growth and development, comprising the following steps: adding the fusion protein of claim 1 or 2, the nucleic acid molecule of claim 3 or 4, the biomaterial of claim 5 or 6, or the product of claim 9 to animal feed; (f3) A method for promoting the proliferation of immune cells in vitro, comprising the following steps: adding the fusion protein of claim 1 or 2, the nucleic acid molecule of claim 3 or 4, the biomaterial of claim 5 or 6, or the product of claim 9 to an immune cell culture system; Furthermore, the animal in question is a mammal; Furthermore, the mammal is either a pig or a mouse.

Images