Cilp gene enhancer and application thereof
By screening and constructing the Cilp gene enhancer, the problem of gene delivery for cochlear target cell therapy was solved, achieving specific expression of the target gene in cochlear neurons and improving the safety and efficacy of gene therapy for deafness.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- CENT SOUTH UNIV
- Filing Date
- 2026-02-02
- Publication Date
- 2026-05-01
AI Technical Summary
Existing technologies struggle to efficiently and specifically deliver therapeutic genes to cochlear target cells, limiting the safety and effectiveness of gene therapy for deafness.
By integrating ATAC-seq maps, single-cell transcriptome datasets, and multi-omics data, we screened for Cilp gene enhancers and constructed recombinant vectors, such as adeno-associated virus vectors, for the specific expression of target genes, such as EGFP, in cochlear neurons.
This achievement enables the specific expression of the target gene in cochlear neurons, improving the safety and efficacy of gene therapy and providing a new targeting tool.
Smart Images
Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, specifically to the Cilp gene enhancer and its applications. Background Technology
[0002] Sensorineural hearing loss is the most common sensorineural disorder worldwide. Hair cells, key receptors that convert mechanical sound signals into electrical neural signals, lack the ability to regenerate spontaneously in mammals; damage to them leads to permanent hearing loss. Furthermore, cochlear neurons are also crucial. The spiral ganglion neurons of the cochlea are the primary afferent neurons of the auditory system; their peripheral processes form synapses with the inner hair cells, and their central processes converge to form the auditory nerve. These neurons are responsible for encoding the mechanical stimuli of sound and converting them into electrical neural signals for transmission; irreversible damage to these neurons is the direct cause of sensorineural hearing loss.
[0003] Gene therapy offers the possibility of fundamentally curing this type of hereditary deafness. However, the cochlea has a complex and sophisticated structure containing various cell types. One of the main challenges in achieving effective gene therapy lies in how to efficiently and specifically deliver therapeutic genes to cochlear target cells, avoiding off-target effects and toxicity that may result from expression in non-target cells, thereby improving the safety and efficacy of the treatment. Summary of the Invention
[0004] In view of this, the technical problem to be solved by the present invention is to provide the Cilp gene enhancer and its application. The present invention provides the Cilp gene enhancer by integrating and validating ATAC-seq maps, single-cell transcriptome datasets and multi-omics data, and further verifies its application in the specific expression of cochlear neuron genes.
[0005] This invention provides the application of nucleic acid molecules as enhancers as described in at least one of (1) to (4) below:
[0006] (1) A nucleic acid molecule having the nucleotide sequence shown in SEQ ID NO:1;
[0007] (2) A nucleotide sequence obtained by modifying, substituting, deleting, or adding one or more bases to the nucleotide sequence of the nucleic acid molecule described in (1); or
[0008] (3) A sequence having at least 90% homology with the nucleotide sequence of the nucleic acid molecule described in (1) or (2); or
[0009] (4) The complementary sequence of the nucleotide sequence of the nucleic acid molecule as described in (1), (2) or (3).
[0010] In some embodiments, the nucleotide sequence of the nucleic acid molecule is as follows:
[0011] TTTATACCCCAAAGCCTGATTTGATAGACACACCAGAAACCTTTCTGTGGTCCTTGCCCTCTGCTCCCACACTCCGATGACCAGAAGATCAGAGAGAAGGTGGCTGCTGGAGCTGTTGGCTACCTGAGCTGCTGCACCCCTTTGGAGATCTCTCACTCTCCCACCTTGCCTGCCTCCCCTTATTTCCAATTATACTGCTGATGCAGCTTGCTCACAGCCCTCTTTTAAAGCTGCATGCCCTGCAGGCTCCTGGCCAGAGAAGCAGGAACAAAGGAAGCCCCTGCACAGAGCCAGCCCTGTGTGTGCCCGCCTCCTGCCTCGCCCTTTCCACCTTGGCAGCTGCTGTTTGTGAAGATGATTAACATTCAGCCATCTGAGGGGAAATCAGATTAGGTTGATTAAACGGGCTCCCATCACCCCAATTAAGCAGCACAGAGAATTCTGACTTGGCTCCTTGCCTGGGAGTTAATTGCCTTTCAAGGCTTTTGCAGGCCTCTGCTCTCCCCTCTCCTGCTTCTGCAGTCTTCATTCCAGCTTTATGTAGAGAAGGGCTGGGGAAGGCTGCCCCTATCCTGAGGATTCTCTGCTCATCCTCACGGCTGAACAATGAAGACCACAGCCCAGTTAGTTCACCGAGTCCTTTGTGGGATGGTGGATCTCAGTGCCAAGCAGTCAAGCGAAAGTGACCTCCACTCTTTGCCAGGCTCTGAGTTAGAAGAGCTTTCTGACATTTACTCAGTATGTAGAGTGTTCTGAGGCAGCACTTCTCAGCCTTCTCAATGCCGCAACCCTTTAACACAGTTCCTCATGTTATGCTGACCCCCCCAGTCATACAATGATG (SEQ ID NO:1).
[0012] The present invention provides a Cilp gene enhancer, which has:
[0013] (5), having the nucleotide sequence shown in SEQ ID NO:1;
[0014] (6) A nucleotide sequence obtained by modifying, substituting, deleting, or adding one or more bases to the nucleotide sequence described in (5); or
[0015] (7) A sequence having at least 90% homology to the nucleotide sequence described in (5) or (6); or
[0016] (8) The complementary sequence of the nucleotide sequence described in (5), (6) or (7).
[0017] The present invention provides a recombinant vector comprising a backbone vector and the Cilp gene enhancer.
[0018] In some embodiments, the backbone vector includes an adeno-associated virus vector.
[0019] In some embodiments, it further includes at least one of a promoter, a terminator, a protein tag, and an resistance gene, and a target gene.
[0020] In some embodiments, the target gene includes a fluorescent protein-encoding gene.
[0021] In some specific embodiments, the target gene includes the Cilp gene and / or the EGFP gene.
[0022] The present invention provides host cells for transfection or transformation of the recombinant vector described herein.
[0023] In some embodiments, the host cell includes at least one of microorganisms, animal cells, and plant cells.
[0024] This invention provides the use of at least one of the following (9) to (11) in the preparation of a reagent that promotes the specific expression of a target gene in cochlear neurons:
[0025] (9) The Cilp gene enhancer described above;
[0026] (10) The recombinant vector;
[0027] (11) The host cell.
[0028] In some embodiments, the cochlear intraneuron is a type 2 cochlear intraneuron.
[0029] This invention provides the use of at least one of the following (12) to (14) in screening and / or preparing medicaments for treating deafness:
[0030] (12) The Cilp gene enhancer described above;
[0031] (13) The recombinant vector;
[0032] (14) The host cell.
[0033] This invention provides a method for gene expression, which uses at least one of the following (15) to (17) to express a gene:
[0034] (15) The Cilp gene enhancer described above;
[0035] (16) The recombinant vector;
[0036] (17) The host cell.
[0037] This invention, through the integration and validation of ATAC-seq maps, single-cell transcriptome datasets, and multi-omics data, screened and obtained the Cilp gene enhancer. Further verification using a mouse microinjection system confirmed that the Cilp gene enhancer significantly enhances the transcriptional activity of the EGFP protein gene in cochlear type 2 neurons. Compared to other sequences of similar size, the Cilp gene enhancer provided by this invention can drive the specific expression of the reporter gene or the Cilp gene in cochlear neurons, particularly type 2 neurons, and significantly enhance gene expression levels. The Cilp gene enhancer provided by this invention is suitable for recombinant DNA, vectors, or adenoviruses and can be used to promote the transcription of the EGFP gene or other genes in cochlear neurons, providing a new targeting tool for hereditary deafness. Attached Figure Description
[0038] Figure 1 This shows the results of identifying the Cilp gene enhancer by integrating histone modification markers, routine and single-cell ATAC-seq chromatin accessibility data;
[0039] Figure 2 Plasmid map of the target plasmid AAV-Transgene;
[0040] Figure 3 The results show that AAV containing the Cilp enhancer specifically enhances the transcriptional activity of EGFP in neurons within the cochlea. From top to bottom, the results are as follows: (top) AAV control group without the enhancer, where EGFP is at a basal transcriptional level in neurons; (middle) AAV experimental group containing the Cilp enhancer, where the transcriptional activity of the EGFP protein gene in neurons is significantly enhanced, and its expression is cell type specific; (bottom) Enlarged view within the white dashed box, scale bar shown in the figure. DAPI (blue) labels the cell nucleus, and EGFP (green) labels the reporter gene expression. Detailed Implementation
[0041] This invention provides the Cilp gene enhancer and its applications. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired results. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to implement and apply the technology of this invention.
[0042] The test materials used in this invention are all commercially available products. The invention will be further illustrated below with reference to specific embodiments.
[0043] Example 1: Identification, cloning, and activity analysis of the Cilp gene enhancer sequence
[0044] I. Identification of the Cilp gene enhancer sequence
[0045] We used previously published data and single-cell transcriptome data (scRNA-seq or snRNA-seq) from cochlear tissue in other studies, along with single-cell ATAC-seq sequencing of cochlear tissue at three different developmental stages in the previous phase of this invention, to identify intentionally cochlear cell type-specific marker genes. By analyzing peaks with different modifications, we integrated and validated the single-cell ATAC-seq atlas with existing corresponding single-cell transcriptome datasets and other multi-omics data. The single-cell ATAC-seq data was of good quality, and we further compared this data with published datasets. Specifically for the Cilop gene, we identified chromatin accessibility peaks for this gene, which exhibited highly specific ATAC peaks in neurons, and screened out the most significant enhancer elements. Furthermore, the conserved chromatin accessibility peaks of the selected enhancer maintained stable accessibility in the three developmental stages we selected (results are shown in Figure 1). Figure 1 (As shown). Figure 1 The dataset integrates histone modification markers, general and single-cell ATAC-seq chromatin accessibility data to reveal the regulatory landscape of the Cilop gene locus. Single-cell ATAC-seq data from neurons at three different developmental stages (17.5 days embryonic time, 8 days postnatal time, and adulthood) showed similar accessibility characteristics. A conserved enhancer regulatory element is highlighted in red in the figure, exhibiting open chromatin accessibility, active histone modifications, transcription factor enrichment, and high sequence conservation.
[0046] The nucleotide sequence of the Cilp gene enhancer obtained by identification is shown below:
[0047] TTTATACCCCAAAGCCTGATTTGATAGACACACCAGAAACCTTTCTGTGGTCCTTGCCCTCTGCTCCCACACTCCGATGACCAGAAGATCAGAGAGAAGGTGGCTGCTGGAGCTGTTGGCTACCTGAGCTGCTGCACCCCTTTGGAGATCTCTCACTCTCCCACCTTGCCTGCCTCCCCTTATTTCCAATTATACTGCTGATGCAGCTTGCTCACAGCCCTCTTTTAAAGCTGCATGCCCTGCAGGCTCCTGGCCAGAGAAGCAGGAACAAAGGAAGCCCCTGCACAGAGCCAGCCCTGTGTGTGCCCGCCTCCTGCCTCGCCCTTTCCACCTTGGCAGCTGCTGTTTGTGAAGATGATTAACATTCAGCCATCTGAGGGGAAATCAGATTAGGTTGATTAAACGGGCTCCCATCACCCCAATTAAGCAGCACAGAGAATTCTGACTTGGCTCCTTGCCTGGGAGTTAATTGCCTTTCAAGGCTTTTGCAGGCCTCTGCTCTCCCCTCTCCTGCTTCTGCAGTCTTCATTCCAGCTTTATGTAGAGAAGGGCTGGGGAAGGCTGCCCCTATCCTGAGGATTCTCTGCTCATCCTCACGGCTGAACAATGAAGACCACAGCCCAGTTAGTTCACCGAGTCCTTTGTGGGATGGTGGATCTCAGTGCCAAGCAGTCAAGCGAAAGTGACCTCCACTCTTTGCCAGGCTCTGAGTTAGAAGAGCTTTCTGACATTTACTCAGTATGTAGAGTGTTCTGAGGCAGCACTTCTCAGCCTTCTCAATGCCGCAACCCTTTAACACAGTTCCTCATGTTATGCTGACCCCCCCAGTCATACAATGATG (SEQ ID NO:1)
[0048] II. Synthesis of recombinant adeno-associated virus (rAAV) vector:
[0049] 1. Vector Construction: The Cilp enhancer sequence was cloned into an AAV vector with a minimal promoter to construct the target plasmid (AAV-Transgene, plasmid map shown) containing the above gene expression cassette (Cilp-Hsp68 mini promoter-SV40NLS-eGFP-SV40NLS –WPRE3–SV40LpA). Figure 2 As shown in the figure, the plasmid is flanked by inverted terminal repeat sequences (ITRs) of AAV2.
[0050] 2. Cell transfection: The target plasmid, adenovirus capsid plasmid (pAAV9-RC), and adenovirus helper plasmid (pHelper) were co-transfected into HEK293T cells at a certain molar ratio. Cells and cell supernatant were collected 48-72 hours after transfection.
[0051] 3. Virus purification and concentration: Virus purification was performed using iodixanol gradient centrifugation. Viral titers were expressed as genome copy number per milliliter (gc / mL). Real-time quantitative PCR (Universal SYBR Green Mix, BIO-RAD) was used to determine viral genome titers against ITRs or specific gene sequences, ensuring a target specification of 1E+13 GC / ml was achieved. Vectors meeting quality standards were aliquoted and stored at -80°C for later use.
[0052] III. Cochlear round window injection:
[0053] 1. Animals: ICR juvenile mice, purchased from Chengdu Dashuo Experimental Animal Co., Ltd., P2-P3, male or female. The inner ear is not fully ossified, making it easy for the virus to penetrate and providing a clear surgical field.
[0054] 2. Anesthesia: Ice surface hypothermia for 2-3 minutes.
[0055] 3. Surgery: The right ear was selected as the surgical ear. After the skin was incised, the sternocleidomastoid muscle was separated to expose the main trunk of the facial nerve and the bifurcation of the "Y"-shaped blood vessels (key anatomical landmarks). A hypoechoic area, the round window niche (RWM), can be seen at the lower edge of the facial nerve. This is the injection point.
[0056] 4. The glass microelectrode (tip 40-50 μm) penetrates the circular window membrane to a depth of 0.3 mm (avoiding contact with the internal structure of the step).
[0057] 5. Injection: 1 μL volume, 10 nL / s injection rate (Pump 11 Elite). After injection, allow to stand for 5 minutes, then slowly withdraw and suture the incision with 6-0 absorbable sutures.
[0058] 6. Reawakening: Reheat on a hot plate at 37 °C.
[0059] 7. Finally, control groups were set up simultaneously, namely, a viral vector containing the Cilp gene enhancer sequence was injected using the same method, and a viral vector without the Cilp gene enhancer sequence was used as a control.
[0060] IV. After successful injection, wait for the required period to harvest the mouse cochlea for testing. Cut off the mouse embryo's head, open the skull, remove brain tissue, expose the temporal bone, and harvest the cochlea. After harvesting, transfer the cochlea to a culture dish containing pre-cooled 1×PBS. Under a dissecting microscope, use a sharp needle to pry open the bony wall of the cochlea at the apex, then peel away the cochlea along the gap between the spiral ligament and the cochlea until the complete spiral ligament is fully exposed. Next, use a sharp needle or forceps to separate and remove the entire spiral ligament, immediately transferring it to a 2ml centrifuge tube containing 4% paraformaldehyde and fixing it at 4℃ for 30 minutes. After 30 minutes, remove the spiral ligament under a dissecting microscope, and lay the entire cochlear basilar membrane flat on a glass slide, add DAPI, and mount. Finally, under a fluorescence microscope, select the DAPI fluorescence channel to observe the nuclear signal of the basilar membrane, and the 488nm laser excitation channel to observe the EGFP signal. Take images of the entire complete basilar membrane, as well as local images of the apex, middle, and basement of the basilar membrane. The results are as follows: Figure 3 As shown.
[0061] It can be seen that the Cilp enhancer can enhance the specific expression of the EGFP gene in cochlear neurons, while vectors without the Cilp gene enhancer sequence do not show EGFP expression (no fluorescent signal) in cochlear neurons.
[0062] In summary, we reconstructed the AAV vector using the enhancer identified from the Cilp gene and tested its activity via round window membrane injection (RWM). The results confirmed that the enhancer exhibited specific activity only in type II spiral ganglion neurons, precisely mimicking the natural expression pattern of the Cilp gene. This suggests that the enhancer has potential applications in gene therapy targeting neurons.
[0063] The above are merely preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. The use of nucleic acid molecules as enhancers as described in at least one of (1) to (4) below: (1) A nucleic acid molecule having the nucleotide sequence shown in SEQ ID NO:1; (2) A nucleotide sequence obtained by modifying, substituting, deleting, or adding one or more bases to the nucleotide sequence of the nucleic acid molecule described in (1); or (3) A sequence having at least 90% homology with the nucleotide sequence of the nucleic acid molecule described in (1) or (2); or (4) The complementary sequence of the nucleotide sequence of the nucleic acid molecule as described in (1), (2) or (3).
2. The Cilp gene enhancer, characterized in that, It has the following characteristics: (5) Has a nucleotide sequence as shown in SEQ ID NO:1; (6) A nucleotide sequence obtained by modifying, substituting, deleting, or adding one or more bases to the nucleotide sequence described in (5); or (7) A sequence having at least 90% homology to the nucleotide sequence described in (5) or (6); or (8) The complementary sequence of the nucleotide sequence described in (5), (6) or (7).
3. A recombinant vector, characterized in that, It includes a backbone vector and the Cilp gene enhancer as described in claim 2.
4. The recombinant vector according to claim 3, characterized in that, It also includes at least one of the promoter, terminator, protein tag, and resistance gene, and the target gene.
5. The recombinant vector according to claim 3 or 4, characterized in that, The target gene includes a fluorescent protein-encoding gene.
6. Transfecting or transforming host cells with the recombinant vector according to any one of claims 3 to 5.
7. The host according to claim 6, characterized in that, The host cell includes at least one of microorganisms, animal cells, and plant cells.
8. The use of at least one of the following (9) to (11) in the preparation of a reagent that promotes the specific expression of a target gene in cochlear neurons: (9) The Cilp gene enhancer as described in claim 2; (10) The recombinant vector according to any one of claims 3 to 5; (11) The host cell as described in claim 6 or 7.
9. The use of at least one of the following (12) to (14) in screening and / or preparing drugs for the treatment of deafness: (12) The Cilp gene enhancer as described in claim 2; (13) The recombinant vector according to any one of claims 3 to 5; (14) The host cell as described in claim 6 or 7.
10. A method for gene expression, characterized in that, Genes are expressed using at least one of the following methods (15) to (17): (15) The Cilp gene enhancer as described in claim 2; (16) The recombinant vector according to any one of claims 3 to 5; (17) The host cell as described in claim 6 or 7.