Aleurites montana anthocyanin reductase VmANR gene and application thereof

By cloning and overexpressing the VmANR gene of anthocyanin reductase in Tungus tung, the problem of insufficient flavonoid production was solved, the inhibitory ability of Tungus tung against Fusarium wilt was improved, and the flavonoid content was significantly increased.

CN121950860APending Publication Date: 2026-05-01RES INST OF SUBTROPICAL FORESTRY CHINESE ACAD OF FORESTRY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
RES INST OF SUBTROPICAL FORESTRY CHINESE ACAD OF FORESTRY
Filing Date
2025-12-19
Publication Date
2026-05-01

AI Technical Summary

Technical Problem

Existing technologies have failed to effectively clone the tung anthocyanin reductase gene (VmANR) and its application in increasing the content of flavonoids in plants, especially the generation and antibacterial effects of flavonoids in the fight against Fusarium wilt infection have not been fully studied.

Method used

The VmANR gene of anthocyanin reductase in *Tungus tung* was cloned and introduced into *Tungus tung* plants via Agrobacterium-mediated transformation, resulting in overexpression and increased production of flavonoids, including catechins, phlorizin, myricetin, (-)-epicatechin, and dihydromyricetin.

Benefits of technology

It significantly increased the content of flavonoids in the Ficus microcarpa, especially the inhibitory effect of catechins and (-)-epigallocatechin on Fusarium wilt, thus enhancing the plant's disease resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121950860A_ABST
    Figure CN121950860A_ABST
Patent Text Reader

Abstract

The invention discloses an aleurites montana anthocyanin reductase VmANR gene and application thereof. The amino acid sequence of the aleurites montana anthocyanin reductase VmANR gene is shown as SEQ ID NO. 2. The content of compounds such as catechin, (-)-epicatechin, (-)-epigallocatechin, phlorizin and dihydromyricetin in transgenic hairy root plants over-expressed by the VmANR obtained by a transgenic means is remarkably increased, so that more flavonoid compounds can be extracted, separated and purified, and greater economic benefits are created; the method provides an important theoretical basis for increasing the content of flavonoid compounds in plants by using a biotechnological means in the future, and has a relatively high application value.
Need to check novelty before this filing date? Find Prior Art

Description

The VmANR gene of anthocyanin reductase and its application Technical Field

[0001] This application relates to the field of plant genetic engineering technology, and more specifically, to a VmANR gene of anthocyanin reductase from the tung tree and its application. Background Technology

[0002] *Vernicia montana*, a deciduous tree belonging to the genus *Vernicia* in the family Euphorbiaceae, is distributed in Shaanxi, Henan, Jiangsu, Anhui, Zhejiang, Jiangxi, Fujian, Hunan, Hubei, Guangdong, Hainan, Guangxi, Sichuan, Guizhou, and Yunnan provinces of my country. It is typically cultivated in hilly and mountainous areas below 1000 meters in altitude. It is an important woody oilseed tree species in my country and a native species with a cultivation history of over a thousand years. More importantly, compared to its relative *Vernicia fordii* (also known as the Chinese tung tree), *Vernicia montana* exhibits high resistance to Fusarium wilt (caused by *Fusarium oxysporum* f. sp. *Fordiis* (Fof-1)). Grafting *Vernicia fordii* onto *Vernicia montana* rootstock is an effective method for controlling Fusarium wilt. Therefore, *Vernicia montana* and *Vernicia fordii* are important materials for studying the mechanisms of resistance and susceptibility to Fusarium wilt in the Chinese tung tree.

[0003] Secondary metabolites produced by plants, such as alkaloids, flavonoids, and triterpenoids, play a crucial role in mediating plant defense responses. Among them, flavonoids are diverse, widely distributed, and possess rich biological activities. Numerous studies have demonstrated that flavonoids play important roles in antibacterial, antioxidant, and antiviral activity. For example, complex catechins ((-)-epicatechin, (-)-epigallocatechin, epicatechin gallate, and epigallocatechin gallate) exhibit superior DPPH free radical scavenging ability and inhibitory effects against Staphylococcus aureus and Escherichia coli. Phlorizin extracted from the old leaves of Litsea cubeba has significant antioxidant activity and a significant inhibitory effect on Escherichia coli and Staphylococcus aureus. Phlorizin also has antioxidant and lipid-lowering effects against Caenorhabditis elegans. Dihydromyricetin has broad-spectrum antibacterial activity, showing good antibacterial effects against Staphylococcus aureus, Escherichia coli, Shigella flexneri, Proteus mirabilis, Pseudomonas aeruginosa, and Salmonella pullorum.

[0004] Anthocyanidin reductase (ANR) is a key enzyme in the proanthocyanidin biosynthesis pathway, belonging to the reductase-epimerase-dehydrogenase (RED) family. ANR is present in many plants, and the ANR gene has been cloned from species such as Arabidopsis thaliana, alfalfa, grape, tea, cocoa, apple, pear, and raspberry, and its proanthocyanidin synthesis pathway has been studied. Initially, ANR enzymes were isolated and identified from Arabidopsis thaliana and Alfalfa bursa-pastoris. They can generate (-)-epicatechin (and catechins simultaneously) using cyanidin as a substrate, and can catalyze delphinidin to (-)-gallicatechin and (-)-epigallocatechin in vitro. Subsequent studies revealed the diversity of ANR enzyme functions in different species. For example, tea ANR (CsANR) generates only (-)-epicatechin in vivo, while recombinant CsANR mainly generates (+)-epicatechin. -Epicatechin, and can catalyze (+)-catechin to (-)-epicatechin in vitro; in maize, the ANR1 enzyme converts cyanidin to (+)-epicatechin in vitro, which then forms a proanthocyanidin dimer with 2,3-cis-resveratrol or 4β-(S-cysteyl)-epicatechin; biochemical analysis further shows that ANRs have dual activities, participating in both the generation of (-)-epicatechin initiating units and the formation of 2,3-cis-resveratrol extension units. The study also found that the expression of the cassava ANR gene was highly positively correlated with most metabolites in the tannin biosynthesis pathway, and overexpression of the ANR gene in transgenic cassava plants increased tannin concentration. Loss-of-function mutations in the strawberry ANR gene activated the anthocyanin synthesis pathway, leading to increased anthocyanin and flavonol levels, while decreasing proanthocyanidin levels. Based on the genomic and transcriptomic data of bamboo, 24 late-stage flavonoid biosynthesis genes were identified, among which PeANR4, after heterologous expression in Arabidopsis thaliana, showed higher proanthocyanidin content than the wild type and mutants. Currently, the ANR gene of *Dendrobium nobile* has not been cloned, nor has the function of the *Dendrobium nobile* ANR enzyme been studied; its application in increasing the content of flavonoids in plants requires further research. Summary of the Invention

[0005] This invention provides a *VmANR* gene for *Symplocos urinaria* anthocyanin reductase, the amino acid sequence of which is shown in SEQ ID NO.2. The nucleotide sequence of the *VmANR* gene is shown in SEQ ID NO.1.

[0006] The present invention also provides a recombinant vector, expression cassette, or recombinant bacteria for the aforementioned tung anthocyanin reductase VmANR gene.

[0007] This invention also provides an application of the aforementioned *Pterocarya stenoptera* anthocyanin reductase VmANR gene, or the aforementioned recombinant vector, expression cassette, or recombinant bacteria, in increasing the content of flavonoids in plants. The flavonoids are catechins, phlorizin, myricetin, (-)-epicatechin, dihydromyricetin, (-)-epigallocatechin, naringenin, and / or luteolin. The plant is *Pterocarya stenoptera*.

[0008] This invention also provides a method for increasing the content of flavonoids in plants. The method involves introducing the *Pterocarya stenoptera* anthocyanin reductase VmANR gene (as described in claim 1 or 2) into a recipient plant via transgenic means and expressing it, resulting in a transgenic plant with a higher flavonoid content than the recipient plant. The flavonoids are catechins, phlorizin, myricetin, (-)-epicatechin, dihydromyricetin, (-)-epigallocatechin, naringenin, and / or luteolin. Specifically, the *Pterocarya stenoptera* anthocyanin reductase VmANR gene is introduced into the recipient plant using Agrobacterium-mediated transformation; the transformed Agrobacterium-mediated transformation competent cells are then injected into the rhizome. The plant is *Pterocarya stenoptera*.

[0009] The beneficial effects of this invention include: Research has shown that extracts from the xylem of *Tung Tree* roots can inhibit the growth of *Fusarium wilt*, the pathogen of *Tung Tree* wilt. Combined with transcriptomic and metabolomic analyses, this invention screened 13 increased flavonoids and 8 upregulated flavonoid biosynthetic genes in the xylem of *Tung Tree* roots after *Fusarium wilt* infection. Among these, catechins, (-)-epicatechin, and (-)-epigallocatechin showed significant inhibitory effects on *Fusarium wilt* growth. Overexpression of the *Tung Tree* anthocyanin reductase VmANR gene (A008279) increased the content of flavonoids such as catechins, (-)-epicatechin, (-)-epigallocatechin, phlorizin, and dihydromyricetin. Further research revealed that *Tung Tree* anthocyanin reductase VmANR can catalyze the synthesis of (-)-epigallocatechin from the substrate cyanidin, providing an important theoretical basis for future use of biotechnology to increase the content of flavonoids in plants and possessing high application value. Attached Figure Description

[0010] Figure 1 shows the inhibition of *Fusarium wilt* pathogens by extracts from the xylem of *Tungus tung* and *Tungus thunbergii* roots, where a represents colony growth and b represents the inhibition rate curve. Figure 2 shows the metabolomics analysis of the xylem of *Tungus tung* and *Tungus thunbergii* roots, where a represents a heatmap of 269 metabolites at four stages of *Fusarium wilt* infection; b represents a scatter plot of the top 20 KEGG pathways of the 269 differentially expressed metabolites; c represents the fold change in the content of 13 flavonoids in the biosynthetic pathway of flavonoids. Figure 3 shows the inhibition of *Fusarium wilt* pathogens by (-)-epigallocatechin, catechin, and (-)-epicatechin at different concentrations, where a represents colony growth and b represents the inhibition rate curve. Figure 4 shows the transcriptomics analysis of the xylem of *Tungus tung* and *Tungus thunbergii* roots, where a represents the Venn diagram of upregulated genes in groups M1vsM0, M2vsM0, and M3vsM0; b represents the upregulated genes in groups F1vsF0, F2vsF0, and F3vF0. Figure 5 shows the Venn diagram of gene regulation; c is a scatter plot of the top 20 KEGG pathways of 483 upregulated genes in the xylem of *Tungus tuldoides* roots; d is a scatter plot of the top 20 KEGG pathways of 1956 upregulated genes in the xylem of *Tungus thunbergii* roots; e is a heatmap of 8 upregulated genes in the biosynthetic pathways of flavonoids during *Fusarium wilt* infection; Figure 5 shows the comprehensive analysis of 13 flavonoids and 4 genes in the biosynthetic pathways of flavonoids; where a is a summary of the biosynthetic pathways of flavonoids, b is the correlation analysis of 13 flavonoids and 2 ANR genes in the biosynthetic pathways of flavonoids; c is the qRT-PCR verification of the response of the ANR gene (A008279) in the xylem of *Tungus tuldoides* and *Tungus thunbergii* roots to *Fusarium wilt* infection; Figure 6 shows the qRT-PCR of the VmANR gene in the hairy roots of *Tungus tuldoides* overexpressing VmANR. The content of nine flavonoids was verified and detected; where a is qRT-PCR verification and b is the detection of the content of nine flavonoids; Figure 7 shows the SDS-PAGE electrophoresis detection results of VmANR protein prepared and purified by prokaryotic expression; Figure 8 shows the in vitro enzyme activity of tung oil anthocyanin reductase VmANR against cyanidin. Detailed Implementation

[0011] The present invention will be further described and illustrated below with reference to embodiments. However, the described embodiments are only a part of the embodiments of the present invention, and not all of them. Based on the present invention and the embodiments, all other inventions and embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0012] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0013] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0014] Example 1: Screening of antibacterial compounds in the root xylem of *Tungus tung* (1) Extraction of antibacterial compounds from the root xylem of *Tungus tung* and *Tungus thunbergii* and comparison of their antibacterial effects against *Fusarium wilt*. Several healthy seedlings of *Tungus tung* and *Tungus thunbergii* with 3-5 leaves were taken. The roots were rinsed with sterile water and the root xylem was separated. All of them were placed in an oven and dried at 65°C for 72 hours. After drying, they were pulverized and passed through a 60-mesh sieve and stored for later use. 20g of dried and pulverized root xylem of *Tungus tung* and *Tungus thunbergii* were weighed and extracted with 200mL of 95% ethanol using ultrasound for 2 hours. After filtering with filter paper, they were extracted with 100mL of anhydrous ethanol using ultrasound for 1 hour. After filtering with filter paper, they were concentrated by evaporation using a rotary evaporator (temperature 50°C, speed 90r / min). Water was added to dilute to 30mL and extracted with the same volume of ethyl acetate. The organic samples were evaporated and concentrated to a paste, dissolved in ethyl acetate to 4mL and stored in a refrigerator for later use. Equal amounts of root extracts from *Tung Tree* and *Tung Tree* (1 mL each) as well as an extractant control and a blank control, were evenly spread (using a spreader) onto PDA plates. The experimental groups were as follows: ① *Tung Tree* root extract; ② *Tung Tree* root extract; ③ Extractant (ethyl acetate) control; ④ Pure PDA control, with three replicates for each group. After drying the plates, a 5 mm diameter circular *Fusarium oxysporum* f. sp. fordii (Fof-1) bacterial block was picked up with an inoculation needle and placed in the center of the PDA plate. The plates were incubated in the dark at 28 ℃, and the growth and diameter of the colonies were recorded. The colony diameter was measured using the cross-cross method, and the relative inhibition rate was calculated.

[0015] As shown in Figure 1, compared with the root xylem of *Tungus tung*, the root xylem extract of *Tungus thunbergii* showed a significant inhibitory effect on the growth of *Fusarium oxysporum*, with the inhibition rate reaching its highest level of 59.15% on the second day. To directly compare the differences in the inhibition rates of *Fusarium oxysporum* and *Tungus thunbergii* root xylem extracts against *Fusarium oxysporum*, we calculated the average inhibition rates of the root xylem extracts of *Tungus thunbergii* and *Tungus thunbergii* during the colony growth process (2–8 days). The results showed that the average inhibition rates of *Tungus thunbergii* and *Tungus thunbergii* root xylem were 52.43% and 20.95%, respectively.

[0016] (2) Collection of root xylem samples from *Tungus tung* and *Tungus tung* at different stages of infection by *Fusarium wilt* a. Under aseptic conditions, *Fusarium tung* strains were collected. After inoculating onto PDA medium and activating in an incubator at 28°C for 3–5 days, pick 5 mm bacterial blocks and inoculate them onto SNA medium. Incubate at 28°C for 7 days. Add a small amount of sterile water to the plate, brush off the spores with a sterile soft brush, and filter out excess medium through three layers of gauze to prepare a 1 L concentration of 2 × 10⁻⁶ spores. 6 A suspension of Fusarium oxysporum spores per mL.

[0017] b. Take 3-year-old and 1000-year-old *Paulownia tomentosa* seedlings with 3-4 leaves each. Carefully remove and wash away the soil around the roots of the seedlings, then rinse them three times with sterile water. Using a pipette, take 10 mL of the *Fusarium oxysporum* spore suspension prepared in step a) and apply it evenly around the roots of the 3-year-old and 1000-year-old *Paulownia tomentosa*. Replant the inoculated plants in pots containing sterilized organic matter (ensuring soil moisture so that water oozes out when the soil is squeezed by hand) and cultivate them in an artificial climate chamber. The photocycle remains 16 days of light and 8 days of darkness, with humidity controlled at around 90% and light intensity at 5000 lx. To maintain better spore growth, pay attention to maintaining soil moisture and water regularly, including the soil and trays. Observe and record the growth, phenotypic changes, and symptom reactions of the 3-year-old and 1000-year-old *Paulownia tomentosa* every 24 hours until wilt symptoms appear.

[0018] c. Based on our continuous observation, we found that the phenotypic changes of *Pterocarya stenoptera* were not obvious on the first day after inoculation. From the third to the fifth day, the leaves showed signs of wilting, and the lateral roots began to rot and gradually expand. From the eighth to the fifteenth day, the leaves turned yellow, curled up, dried out, and began to fall off, while the stems softened and gradually became hollow. In contrast, the phenotypic changes of *Pterocarya stenoptera* after inoculation were not significant. On the fourth day after inoculation, some of the lateral roots of *Pterocarya stenoptera* rotted, but the new roots grew rapidly. After continuous cultivation for one month, the inoculated *Pterocarya stenoptera* plants maintained a healthy growth state. Based on the symptoms of wilt disease, roots were collected on days 0, 1, 5, and 8 after inoculation, flash-frozen in liquid nitrogen, and stored at -80°C. Root xylem samples from *Pterocarya stenoptera* and *Pterocarya stenoptera* were labeled as uninfected (F0; M0), early-stage infected (F1; M1), mid-stage infected (F2; M2), and late-stage infected (F3; M3), respectively. Gently wash the roots collected at each stage with water, absorb excess moisture with filter paper, and separate the xylem samples of *Tung Tree* and *Tung Tree*. Quickly grind the samples in liquid nitrogen, ensuring thorough grinding and keeping them frozen to prevent thawing. Label the ground samples and store them in the laboratory. The samples were stored in a refrigerator for subsequent metabolomics and transcriptomics analysis.

[0019] (3) Metabolite analysis of the xylem of *Tungus tung* and *Tungus thunbergii* roots at different stages of *Fusarium wilt* infection. a. Metabolites were first extracted from xylem samples (F0, M0; F1, M1; F2, M2; F3, M3) of *Tungus tung* and *Tungus thunbergii* roots using the organic reagent precipitation protein method. Quality control (QC) samples were prepared simultaneously (equal amounts of the prepared experimental samples were mixed together). The QC samples were used for repeated evaluation of the experimental techniques. Mass spectrometry was performed on the samples in both positive and negative ion modes.

[0020] b. Use Proteowizard's MSConvert software to convert the raw mass spectrometry data into a readable data format—mzXML; use XCMS software for peak extraction and quality control; use CAMERA for additive ion annotation of the extracted substances; and use metaX software for metabolite identification (primary mass spectrometry information is matched with the database for identification, and secondary mass spectrometry information is matched with the in-house standard database for identification). Then, use databases such as HMDB and KEGG to annotate the metabolites, interpret the physicochemical properties and biological functions of the metabolites, and finally use metaX software to quantify the metabolites and screen for differential metabolites.

[0021] As shown in Figure 2a, the content of 269 metabolites continuously increased in the M2 and M3 stages of the xylem of *Paulownia tomentosa* roots. However, in the xylem of three-year-old *Paulownia tomentosa* roots, these 269 metabolites showed a lag effect, increasing only in the F3 stage. Furthermore, KEGG enrichment analysis revealed that these 269 differentially expressed metabolites were significantly enriched in the following pathways (p<0.05): "Biosynthesis of flavonoids, starch and sucrose metabolism, galactose metabolism, biosynthesis of flavonoids and flavonols, and vitamin B6 metabolism" (Figure 2b). Notably, the p-value for the biosynthesis pathway of flavonoids was the most significant (marked with a red box). As shown in Table 1, metabolites of 18 flavonoids in their biosynthetic pathways were identified and classified into 13 flavonoids, including catechin, (-)-epigallocatechin, (-)-epigallocatechin, dihydromyricetin, luteolin, myricetin, myricetin, phloretin, phloretin, naringenin chalcone, naringenin, stigmosiderin, and taxol. The fold changes in the content of these 13 flavonoids at different stages of pathogen infection are shown in Figure 2c. We observed that the fold changes in the xylem of the 13 flavonoids in the root of the thousand-year-old tung tree (left of Figure 2c) were significantly higher than those in the xylem of the three-year-old tung tree (right of Figure 2c). Among them, the fold changes in naringenin, (-)-epigallocatechin, taxol, naringenin chalcone, and catechin exceeded 5 times (see Table 1).

[0022] Table 1. Information on 18 flavonoids in the biosynthetic pathway of flavonoids

[0023] (4) Antibacterial activity of 13 flavonoids against Fusarium wilt pathogens: The above 13 flavonoids were dissolved in dimethyl sulfoxide (DMSO) solvent to prepare gradient concentrations of 0.125, 0.25, 0.5, 1.0, 2.0, and 4.0 mg / ml. Fusarium wilt pathogens with a diameter of 3 to 5 mm were inoculated into PDA medium containing the 13 different concentrations of flavonoids. DMSO was used as an extractant control and a blank control were set up. The petri dishes were placed in an incubator at 28°C for 7 days. The diameter of the colony circles was measured by the cross-cross method, and the average diameter of each treatment was calculated. The inhibition rate was calculated (inhibition rate = ((control colony diameter - treatment colony diameter) / control colony diameter) × 100%), and the differences in inhibition rates of the 13 flavonoids at different concentrations were compared.

[0024] The antibacterial activity of the 13 flavonoids against *Fusarium wilt* was evaluated under different concentration conditions. As shown in Figure 3a, compared with the DMSO extract control and the blank control group, three flavonoids ((-)-epigallocatechin, catechin, and (-)-epicatechin) significantly inhibited the growth of *Fusarium wilt*, with (-)-epigallocatechin exhibiting the strongest antibacterial activity. As shown in Figure 3b, (-)-epicatechin showed the best inhibitory effect at concentrations of 0.125 and 0.25 mg / ml, while it exhibited the strongest inhibitory effect at concentrations exceeding 0.5 mg / ml. At a concentration of 4 mg / ml, the inhibition rate of (-)-epigallocatechin reached a maximum of 54.71%.

[0025] Example 2: Screening of genes involved in the synthesis of antibacterial compounds in the xylem of *Tungus tung* roots (1) Transcriptome analysis of xylem of *Tungus tung* and *Tungus tung* roots at different stages of *Fusarium wilt* infection a. Extraction of RNA from xylem of *Tungus tung* and *Tungus tung* roots at different stages of *Fusarium wilt* infection (F0, M0; F1, M1; F2, M2; F3, M3) The plant RNA rapid extraction kit from Beijing Tiangen Biotech Co., Ltd. was used according to its instructions. The concentration and purity (OD260 / OD280, OD260 / OD230) of RNA were controlled by a NanoDrop ND-1000 micro-spectrophotometer (NanoDrop, Wilmington, DE, USA). The integrity of RNA was detected by a Bioanalyzer 2100 (Agilent, CA, USA). The quality of RNA was verified by 1% agarose gel electrophoresis. Sequencing analysis was performed on samples with a concentration >50 ng / μL, RIN value >7.0, OD260 / 280 >1.8, and total RNA >1 μg.

[0026] b. To ensure accurate and reliable analytical results, the raw data after sequencing was preprocessed to remove impurity sequences (including reads with sequencing adapters, reads containing more than 5% N, and low-quality reads). Based on existing *Pterocarya stenoptera* genome data, Hisat was used to align the preprocessed valid data with a reference genome.

[0027] c. Gene expression level analysis mainly focuses on the protein-coding genes (mRNA) annotated in the genome, and the expression levels of genes are statistically analyzed. The FPKM value (Fragments Per Kilobase of exon model per Million mapped reads) represents the number of sequencing fragments per thousand transcripts per million sequencing bases. The FPKM value is used to statistically analyze gene expression levels in different samples. Based on the FPKM values, we use the DESeq R software package to identify differentially expressed genes (fold change ≥2 or ≤0.5, P<0.05). Here, we mainly focus on genes upregulated in the xylem of *Tung Tree* and *Tung Tree* roots after *Fusarium wilt* infection, and perform KEGG enrichment analysis on the upregulated genes.

[0028] As shown in Figure 4, Venn diagram analysis reveals that in the xylem of the thousand-year-old tung tree roots (Figure 4a), compared to the uninfected period (M0), there were 1368, 1236, and 1003 differentially upregulated genes in the early, middle, and late stages of infection (M1, M2, M3), respectively. Among these, 483 genes were upregulated in all three stages after infection. In the xylem of the three-year-old tung tree roots (Figure 4b), compared to the uninfected period (F0), there were 3656, 3886, and 3887 differentially upregulated genes in the early, middle, and late stages of infection (F1, F2, F3), respectively. Among these, 1956 genes were upregulated in all three stages after infection. For *Tungus tung*, KEGG enrichment analysis showed that 483 upregulated differentially expressed genes were significantly enriched in pathways including metabolic pathways, glutathione metabolism, cyanoamino acid metabolism, photosynthesis, biosynthesis of various plant secondary metabolites, starch and sucrose metabolism, arachidonic acid metabolism, biosynthesis of secondary metabolites, tryptophan metabolism, diterpene biosynthesis, isoflavone biosynthesis, galactose metabolism, linoleic acid metabolism, flavonoid biosynthesis, ABC transporter, thiamine metabolism, and rutin biosynthesis (p<0.05) (Figure 4c). In *Tungus thunbergii*, the upregulated differentially expressed genes were enriched in KEGG pathways including mRNA surveillance, protein export, and biosynthesis of other types of O-glycosides (p<0.05) (Figure 4d). Consistent with the metabolomics results, the upregulated differentially expressed genes were also enriched in the flavonoid biosynthesis pathway in the xylem of *Tungus tung* roots. However, these pathways were not enriched in the xylem of *Tungus thunbergii* roots. Eight differentially expressed genes upregulated in the flavonoid biosynthesis pathway were identified, including anthocyanin reductase (ANR, A008266, A008279), chalcone-flavonoid isomerase (CHI, A005627), caffeoyl-CoA O-methyltransferase (CCoAMT, A015555), cytochrome CYP75B1 (CYP75B1, A021985), SRG1-like protein (A015265), and downy mildew resistance protein (A019046, A015445). A heatmap of these eight differentially expressed genes in the flavonoid biosynthesis pathway in the xylem of *Tungus tectorius* and *Tungus thunbergii* roots is shown in Figure 4e (the histogram on the right side of figure 4e shows the average FPKM value). These results indicate a recessive link between genes and metabolites in the flavonoid biosynthesis pathway of *Tungus tectorius* roots during *Fusarium wilt* infection.

[0029] (2) The VmANR gene of anthocyanin reductase in *Torreya grandis* may be involved in the synthesis of antibacterial compounds in the root xylem. The above results indicate that *Fusarium wilt* infection triggers a direct defense response in *Torreya grandis*, including the production of flavonoids and the upregulation of related genes in this pathway. More specifically, in *Torreya grandis*, the content of 13 flavonoids, including catechins, (-)-epicatechin, (-)-epigallocatechin, and dihydromyricetin, increased significantly in the M2 stage and remained at a high level in the M3 stage (Figure 2c). However, these flavonoids only increased in the F3 stage of *Torreya grandis*. Similar to the increasing trend of flavonoid content, after *Fusarium wilt* infection, the expression of 8 genes involved in the biosynthetic pathway of flavonoids in the root xylem of *Torreya grandis* was also continuously upregulated. Among them, four genes encoding key metabolic enzymes in the biosynthetic pathway of flavonoids, including ANR (A008279, A008266), CHI (A005627), and CYP75B1 (A021985), are involved in the biosynthesis of the above 13 flavonoids (Figure 5a). Based on the antibacterial experiments on 13 flavonoids, we found that (-)-epigallocatechin, catechin, and (-)-epicatechin significantly inhibited the growth of *Fusarium wilt* (Figure 3a). The ANR genes (A008279, A008266) directly participated in the biosynthesis of (-)-epicatechin and (-)-epigallocatechin (as shown in Figure 5a, the heatmap displays the abundance of 13 flavonoids and four genes in the flavonoid biosynthesis pathway during *Fusarium wilt* infection; the antibacterial (-)-epigallocatechin, catechin, and (-)-epicatechin) are marked in blue, and the anthocyanin reductase ANR gene is marked in red). Therefore, we selected them for further analysis and functional verification. Correlation analysis showed that the expression of ANR genes (A008279, A008266) was positively correlated with the abundance of most flavonoids, such as catechins, naringenin, (-)-epicatechin, naringenin chalcone, and (-)-epigallocatechin (Figure 5b, where...). , and The values ​​represent significant (p<0.05), highly significant (p<0.01), and extremely significant (p<0.001), respectively. We used the NCBI database to search for conserved domains in the nucleotide sequences of the two ANR genes. The results showed that the conserved domain of the ANR gene (A008266) was incomplete, so we selected the ANR gene (A008279) to verify its potential resistance function. Real-time quantitative PCR analysis showed that the ANR gene (A008279) was continuously upregulated in the xylem of *Paulownia tomentosa* roots during the M2 and M3 stages, while in the xylem of three-year-old *Paulownia tomentosa* roots, it was only upregulated in the F3 stage (Figure 5c).

[0030] Example 3: Cloning and Overexpression of VmANR Gene in *Dendrobium nobile* (1) Cloning of VmANR Gene in *Dendrobium nobile* Root tissue was taken from *Dendrobium nobile*, ground into powder with liquid nitrogen, and RNA was extracted using the RN38 EASY spinplus plant RNA rapid extraction kit. The first strand of cDNA was synthesized according to the instructions of the Goldenstar RT6 cDNA Synthesis Kit. Based on the nucleotide sequence of VmANR obtained from *Dendrobium nobile* genome sequencing, primers primer F (ATGGAGTACTGTCACACCAAAGTCT, SEQ ID No. 3) and primer R (TCATGTAATTATATCTCCTAATCGCCTTC, SEQ ID No. 4) were designed, and the cDNA sequence of *Dendrobium nobile* VmANR was amplified using MCLAB high-fidelity enzyme.

[0031] PCR reaction system:

[0032] Reaction program: 98℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 60℃ annealing for 15 s, 72℃ extension for 30 s, for a total of 35 cycles; 72℃ extension for 5 min.

[0033] The PCR products were separated by electrophoresis on a 1% agarose gel. The gel containing the target fragment was cut off, weighed, and then purified and recovered using a DNA gel recovery kit (the amplified target fragment was 1032 bp, and its sequence is shown in SEQ ID No. 1).

[0034] (2) Thousand-year-old paulownia Construction reaction system of overexpression vector:

[0035] Add the sample at room temperature, mix gently, and incubate at 25 °C for 10 min. Add 5 μL of the ligation product to 50 μL of E. coli DH5α competent cells in an ice-water mixture, gently tumble to mix, and incubate on ice for 30 min. Heat shock at 42 °C for 60 s. Incubate on ice for 2–3 min. Add 700 μL of antibiotic-free LB broth. Incubate at 37 °C with shaking at 200 rpm for 1 h. Centrifuge at 3,000 rpm for 1 min. Discard the supernatant, resuspend the bacterial cells, and spread an appropriate amount of the bacterial suspension onto cells containing… Kanamycin sulfate (Kan) was incubated overnight at 37 °C inverted on LB solid medium until a single colony grew.

[0036] (3) PCR detection of positive clones: Single colonies were picked with a sterile pipette tip and transferred to 1 mL of LB liquid medium containing 50 μg / mL Kan antibiotic. The culture was carried out at 200 rpm and 37°C for 10 h until the bacterial solution became turbid. The positive clones were identified by PCR using the M13 universal primers. The reaction system was the same as that in step (1) of this embodiment. The reaction program was as follows: 98°C pre-denaturation for 2 min; 98°C denaturation for 10 s, 60°C annealing for 30 s, 72°C extension for 45 s, for a total of 25 cycles; finally, 72°C extension for 5 min. After detecting the PCR products by 1% agarose gel electrophoresis, bacterial solutions with band sizes consistent with the target fragment were selected for sequencing. The sequences obtained by sequencing were compared with the VmANR sequence of the *Dendrobium nobile* transcriptome using DNAMAN7 software. The comparison results were completely consistent. The nucleotide sequence of the anthocyanin reductase VmANR gene is shown in SEQ ID NO.1, encoding 344 amino acids. The amino acid sequence is shown in SEQ ID NO.2.

[0037] (4) Plasmid extraction: Select positive clones and inoculate single colonies into 50 mL of LB liquid medium (50 μg / mL Kan), incubate overnight at 37°C with shaking at 200 rpm. Take 2–4 mL of bacterial culture and extract plasmids using the Axygen plasmid mini-DNA extraction kit for subsequent experiments. Centrifuge the remaining bacterial culture at 12000 rpm for 1 min, resuspend the precipitate in LB liquid medium containing 20% ​​glycerol, aliquot and store. .

[0038] (5) Overexpression of VmANR in the hairy roots of *Tungus tung* can increase the content of flavonoids. a. Screening of overexpression vectors Positive clones were transformed into Agrobacterium K599 competent cells. Single colonies of positive Agrobacterium were picked and cultured until OD600 reached a certain value. Collect the bacterial cells by centrifugation at 2250 g for 1 min. Use the suspension (acetylsyleugenone) , Resuspend the bacterial culture with 10 mM MES (10 mM), adjust OD600 to 0.8, and then mix the two collected resuspensions at a 1:1 volume ratio. Let stand at room temperature for 2 hours (incubation) for later use.

[0039] b. Using the hairy root transformation technology of *Pterocarya stenoptera*, the VmANR gene can be overexpressed in the roots. Specifically, fully extended *Pterocarya stenoptera* seedlings that have grown for about one month are selected, and the mixed bacterial solution is injected into the rhizome of the *Pterocarya stenoptera* using a 1mL syringe (without the needle). (The text then repeats the process, mentioning empty vectors.) The bacterial culture was used as a control (CK) and compared with the target vector to be tested. bacterial solution Simultaneously, the injection was applied to the rhizomes of *Tung Tree* seedlings with uniform growth to ensure a consistent growth background. Each treatment was injected with... The seedlings of the thousand-year-old tung tree were subjected to more than four biological replicates. Samples were taken 3 days later for identification and screening of transgenic hairy-root positive plants. Control group CK and... RNA was extracted from the hairy roots that emerged from the group, and then... Detection of CK and The expression level was determined, and high performance liquid chromatography-tandem mass spectrometry was used to measure it. Testing the thousand-year-old paulownia The content of flavonoid compounds in hairy roots.

[0040] The results are shown in Figure 6. From Figure 6a, it can be seen that... The test showed that after the VmANR gene was introduced into the root of the Dracaena sanderiana, the gene was overexpressed (as shown in the figure). (This represents 0.001 ≤ p < 0.01). The results showed that The content of six flavonoids (catechin, (-)-epicatechin, (-)-epigallocatechin, myricetin, phlorizin and naringenin) in the transgenic hairy roots increased by 6.5 to 12.6 times compared with the control group, and the content of dihydromyricetin and luteolin increased by about 62.9 times and 21 times respectively compared with the control group (Figure 6b).

[0041] Example 4, Study on the catalytic substrate of anthocyanin reductase VmANR (1) Construction of anthocyanin reductase VmANR gene into prokaryotic expression vector pET32a and transformation into prokaryotic cells The cloned target fragment was transformed into the linearized pET32a vector by homologous recombination. The ligation reaction conditions were as follows: After mixing the reaction system, it was incubated at 50℃ for 45 min, then placed on ice for 2 min. 10 μL of the reaction solution was added to 100 μL of Escherichia coli DH5α competent cells, mixed well, placed on ice for 25 min, gently removed, heat-shocked at 42℃ for 45 s, immediately placed on ice for 2 min, and 500 μL of LB medium was added and cultured at 37℃ for 1 h. 100 μL of bacterial solution was spread on LB plates containing ampicillin (Amp) resistance and cultured overnight. Positive colonies obtained from antibiotic (Amp) screening were picked and plasmids were extracted. The constructed expression vector was then transferred to the pET32a linearized vector. It was transferred into Escherichia coli BL21 strain.

[0042] (2) Anthocyanin reductase Purification and selection of recombinant proteins containing recombinant plasmids A single colony of *Escherichia coli* (BL21) was added to 3 mL of LB liquid medium (Amp resistant) and incubated overnight at 37°C. Preservation; collection and preservation 100 μL of the bacterial strain was inoculated into 100 mL of LB liquid medium (Amp resistant) and cultured overnight with shaking. 100 mL of the bacterial culture was then inoculated into 2000 mL of LB liquid medium and cultured at 37°C until the OD600 reached approximately 0.6. The culture temperature was then lowered to 30°C. IPTG inducer was added to a final concentration of 0.5 mM, and the culture was continued at 30°C with shaking for 3 hours. The bacterial cells were collected by centrifugation at 8000 rpm for 3 minutes and resuspended in 50 mL of pre-cooled medium. In a buffer solution, incubate on ice for 30 minutes; sonicate to disrupt bacterial cells using parameters set to 200W power, 3 seconds on, 4 seconds off, for 99 cycles; centrifuge at 16000 rpm at 4℃ for 50 minutes, and collect the supernatant and precipitate; take a small amount of supernatant and precipitate for further processing. After testing, the remaining supernatant and precipitate were stored at 4°C for later use. The supernatant protein solution was filtered through a 0.22 μm filter and prepared for use. Column; load supernatant protein solution at a flow rate of 1 mL / min; Wash the column with buffer (pH=8.0) until the eluent is free of protein (G250 detection solution remains colorless); elute with 20mM, 60mM, 200mM, and 500mM imidazole, collecting the eluent fractions until the G250 detection solution remains colorless; wash the column stock with 3 column volumes of deionized water and seal the column with 20% ethanol; purify the collected eluent. Electrophoresis results are shown in Figure 7 (lane 1 is the marker; lane 2 is the eluted protein, which includes a tag protein of approximately 18 kDa and a target protein of 38 kDa). The recombinant protein was successfully induced by the anthocyanin reductase VmANR, and the recombinant protein size was correct. This allows us to conduct further biochemical function tests on VmANR.

[0043] (3) The biochemical function of anthocyanin reductase VmANR was determined using cyanidin as a substrate. The 200 μL enzymatic reaction system consisted of: recombinant VmANR protein, 0.2 mg; NADPH, 2 mM; cyanidin, 100 M; phosphate buffer, 50 mM (pH 6.5). VmANR enzyme activity was determined at 40 °C using 100 mM... The reaction was carried out in buffer (pH 7.0) for 1 hour. The enzyme reaction was terminated by adding 500 μL of ethyl acetate and vigorously shaking for 1 minute. The ethyl acetate supernatant was transferred to a new 1.5 mL microcentrifuge tube and... Save it below for later use. analyze.

[0044] (4) The analytical instruments were provided by Shimadzu. Diode array detector System controller Degasser and autosampler Detection method: Chromatographic column: Agela Venusil C18 Plus 5 μm. Flow rate: 0.4 mL / min; Aqueous phase: 0.1% formic acid solution; Organic phase: Methanol; Needle wash solution: Methanol. Column oven temperature: 35℃, Autosampler temperature: 8.0℃. Needle height: 2.00 mm, Autosampler cleaning settings: AfterDraw, Autosampler needle wash volume: 200.0 μL. Immersion time during autosampler needle cleaning: 3.00 ms, Autosampler injection volume: 5.00 μL. Qualitative and quantitative analysis: Each component was searched and matched using the NIST08 standard spectral library, fragment comparison was performed, and qualitative analysis was conducted in conjunction with relevant literature reports and the relative retention times of each component. Quantitative analysis was performed by calculating the relative content of each peak area using the peak area normalization method. His protein was used as a negative control.

[0045] The results are shown in Figure 8. Anthocyanin reductase VmANR can catalyze the synthesis of (-)-epigallocatechin from the substrate cyanidin. The elution time and characteristic ion peaks can be matched with the NIST08 standard spectral library, thus the enzyme-catalyzed product can be qualitatively identified. Due to the limited enzyme content, the experiment cannot be quantified, but it can only prove that the enzyme has catalytic activity.

Claims

1. A VmANR gene for anthocyanin reductase in the ancient Chinese tung tree, characterized in that, The amino acid sequence of the tung anthocyanin reductase VmANR is shown in SEQ ID NO.

2.

2. The *VmANR* gene for anthocyanin reductase in *Tungus tungus* according to claim 1, characterized in that, The nucleotide sequence of the *VmANR* gene, which is anthocyanin reductase, is shown in SEQ ID NO.

1.

3. A recombinant vector, expression cassette, or recombinant bacteria containing the *VmANR* gene of anthocyanin reductase as described in claim 1 or 2.

4. The application of the *VmANR* gene of *Tungus tungus* anthocyanin reductase as described in claim 1 or 2, or the recombinant vector, expression cassette, or recombinant bacteria as described in claim 3, in increasing the content of flavonoids in plants, wherein the flavonoids are catechins, phlorizin, myricetin, (-)-epicatechin, dihydromyricetin, (-)-epigallocatechin, naringenin, and luteolin.

5. A method for increasing the content of flavonoids in plants, characterized in that, The *VmANR* gene of anthocyanin reductase as described in claim 1 or 2 is introduced into a recipient plant and expressed therein to obtain a transgenic plant with a higher content of flavonoids than the recipient plant; the flavonoids are catechin, phlorizin, myricetin, (-)-epicatechin, dihydromyricetin, (-)-epigallocatechin, naringenin and luteolin.

6. The method according to claim 5, characterized in that, The *Agrobacterium tungii* anthocyanin reductase VmANR gene was introduced into recipient plants using the *Agrobacterium tungii* transformation method.

7. The method according to claim 6, characterized in that, Transformed Agrobacterium competent cells were injected into recipient plants via root and stem injection.

8. The method according to any one of claims 5-7, characterized in that, The plant in question is a thousand-year-old tree.