Application of fish ptprfb gene in fish sex control breeding

By targeting and knocking out the ptprfb gene in zebrafish using CRISPR/Cas9 gene editing technology, the problems of cumbersome operation and significant environmental impact in existing fish sex control breeding technologies have been solved, enabling efficient and stable breeding of female fish strains.

CN121950869APending Publication Date: 2026-05-01INST OF AQUATIC LIFE ACAD SINICA
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
INST OF AQUATIC LIFE ACAD SINICA
Filing Date
2026-01-12
Publication Date
2026-05-01

AI Technical Summary

Technical Problem

Existing fish sex control breeding techniques suffer from problems such as cumbersome operation, low efficiency, and significant environmental impact. In particular, it is difficult to obtain stable female fish strains under hormone induction, and hormone treatment results in low fry survival rates.

Method used

By using CRISPR/Cas9 gene editing technology to target and knock out the ptprfb gene in zebrafish, causing it to lose its original function, a stable genetically inherited female fertile fish can be obtained. Sex control breeding can then be achieved through homologous recombination, RNA interference, or gene editing methods.

Benefits of technology

It achieves precise and efficient sex-controlled breeding, avoids the environmental impact of hormone treatment and the problem of fry survival rate, simplifies the operation process, and provides a stable female fish strain for the cultivation of new varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention belongs to the field of molecular biology, and discloses an application of a fish ptprfb gene in fish sex control breeding, and the applicant discovers that fish with partial female development can be obtained by knocking out the fish ptprfb gene. The method is easy to implement and has the advantages of simplicity in operation, no use of hormones, environmental friendliness and the like. The female fish strain is obtained by using a gene mutation method, the problem that in traditional sex control breeding, the environment is affected due to the fact that sexual transformation production needs to be conducted on pseudo-male fish through hormone treatment is solved, the slightly-female fish can be obtained without a large number of tedious hormone-induced sex inversion operation, and the method has important application value.
Need to check novelty before this filing date? Find Prior Art

Description

Application of the ptprfb gene in fish sex-controlled breeding Technical Field

[0001] This invention belongs to the field of molecular biology, specifically relating to the application of the fish ptprfb gene in fish sex control breeding. Using the gene provided by this invention as the target sequence, and employing conventional methods in the field to render it non-functional, fertile female fish can be obtained. Background Technology

[0002] Many fish exhibit significant sexual dimorphism in growth rate, with females growing faster, such as carp, mandarin fish, and tongue sole; while males grow faster, such as yellow catfish, snakehead, and tilapia. Establishing sex-controlled breeding techniques to cultivate superior, single-sex aquaculture varieties has significant application value.

[0003] Common sex determination mechanisms in fish include XY and ZW genotypes. For XY sex-determined fish such as carp and mandarin fish, sex control breeding is currently typically achieved through hormone induction. This process mainly involves the following steps: First, before the gonads of the XY fish differentiate and develop, they are fed diets containing androgens such as methyltestosterone or aromatase inhibitors that inhibit estrogen synthesis, at a rate of 8%-10% of the fish's body weight, for 30 to 90 consecutive days. This induces sex reversal in the gonads of the XY female fish, resulting in the development of testes. Then, from these androgen-treated populations, genetically female but physiologically male XY pseudo-males are selected and bred as parents. Finally, these XY pseudo-males are crossed with ordinary female fish to obtain female-developing offspring, thus breeding new varieties for aquaculture. This method requires extensive histological analysis of gonadal development to clarify the critical time window for gonadal differentiation and development in the recipient fish juveniles after hatching before determining the starting time for drug-induced sex reversal in XY female fish. Furthermore, extensive analysis is needed to determine the appropriate duration of drug treatment before achieving a satisfactory artificial sex reversal effect. Because juvenile fish are typically very sensitive to drug treatment and have poor tolerance, hormone treatment can easily cause fry mortality. Therefore, hormone-induced sex reversal is usually cumbersome and inefficient. Moreover, after the removal of exogenous hormones, many sex-reversed fish may revert to their natural female sex, making it difficult to obtain stable XX pseudo-male parent fish for sex control breeding. For ZW sex-determined fish such as the tongue sole, the ideal sex control breeding method is to first obtain super-female fish with WW chromosome composition, and then crossbreed these WW super-females with ordinary ZZ males to cultivate ZW all-female offspring. However, when using hormone treatment to develop ZW pseudo-males and then crossing them with normal ZW females, the WW super-females failed to survive during screening. Therefore, there are currently no reports of successful sex control breeding of ZW sex-determined fish through hormone-induced treatment. Considering the potential environmental impact of hormone treatment on recipient fish that induces sex reversal, there is an urgent need to establish precise, green, and safe new technologies for sex control breeding of fish.

[0004] Gene editing technologies, exemplified by CRISPR / Cas9, can precisely modify specific sites in an organism's genome and have been widely applied in fish genetic breeding, particularly in tilapia. Knockout of target genes such as amhy, gsdf, dmrt1, and cyp19a1a has led to sex reversal in tilapia. Targeting genes related to sex determination or differentiation in fish using gene editing technology has become an important direction in sex-controlled breeding of fish.

[0005] Zebrafish are widely used as an important model organism in research fields such as developmental biology, reproductive biology, and neuroscience of vertebrates. Like most other bony fish, zebrafish eventually differentiate into females or males, belonging to dioecious fish (Avise JC and Mank JE Evolutionary perspectives onhermaphroditism in fishes. Sex Dev, 2009, 3:152-163). To date, the sex chromosomes of zebrafish have not been discovered. Some studies suggest that zebrafish raised in domesticated environments have lost their sex-determining genes (Wilson CA, HighSK, McCluskey BM, et al. Wild sex in zebrafish: loss of the natural sexdeterminant in domesticated strains. Genetics, 2014, 198: 1291-1308). Their sex determination system is a complex polygenic system, where several non-linked loci may simultaneously influence sex determination to varying degrees (Liew WC and Orban L. Zebrafish sex: a complicated affair. Brief Funct Genomics, 2014, 13:172-187). Furthermore, sex differentiation in zebrafish is influenced by both genetic and environmental factors (Hosseini S, et al. Genetic mechanism underlying sexualplasticity and its association with colour patterning in zebrafish (Daniorerio). BMC Genomics, 2019, 20:341). Male-related factors such as dmrt1, amh, and gsdf, and female-related factors such as cyp19a1a and foxl2 play roles in the sex differentiation of zebrafish.Furthermore, the sex differentiation of zebrafish is also related to the number of early primordial germ cells (PGCs). Knocking down or removing the dead end (dnd) gene, which plays an important role in the migration and survival of PGCs, results in all zebrafish that develop into sterile males (Slanchev K, et al. Development without germ cells: the role of the germ line in zebrafish sex differentiation. Proceedings of the National Academy of Sciences of the United States of America, 2005, 102 (11): 4074-4079. Tzung KW, et al. Early Depletion of primordial germ cells in zebrafish promotes testis formation. Stem Cell Reports, 2015,4, 61–73). Among the environmental factors influencing fish sex differentiation, some reports suggest a link between energy levels and the sex fate of individuals (Li N, et al. The role of mitochondria in sex- and age-specific gene expression in aspecies without sex chromosomes. PNAS, 2024, 121: e2321267121). In zebrafish juveniles (raised to 81 dpf), a low-feeding treatment resulted in a significantly higher proportion of males compared to a high-feeding treatment group (Lawrence, et al. Rapid growth and out-crossing promote female development in zebrafish (Danio rerio). Environmental Biology of Fishes, 2007, 81 (2): 239-246), suggesting a relationship between fish sex differentiation and energy metabolism. However, research on the influence of energy factors on fish sex differentiation is limited.

[0006] Ptprf is a type of protein tyrosine phosphatases (PTPs). In mammals, Ptprf is also known as LAR (Leukocyte Common Antigen-Related). LAR is a core regulatory component of the INS / IGF signaling network and is believed to negatively regulate INS / IGF receptor signaling. The INS / IGF signaling network plays a synergistic role in energy metabolism response and growth and development regulation (Sevillano, et al. Role of receptor proteintyrosine phosphatases (RPTPs) in insulin signaling and secretion. International Journal of Molecular Sciences, 2021, 22 (11)).

[0007] The mammalian homolog of Ptprf in zebrafish, ptprfb, is 24,7834 bp in length (GenBank: BX248089.5), with a full-length mRNA of 7718 bp (NM_001083576.1), encoding 1909 amino acids (NP_001077045). It possesses an extracellular region resembling cell adhesion molecule and an intracellular domain characteristic of the tyrosine phosphatase family. Currently, the function of the ptprfb gene in sex determination and differentiation in fish has not been reported. Summary of the Invention

[0008] The purpose of this invention is to provide the application of the ptprfb gene in sex-controlled breeding of fish. The ptprfb gene encodes the protein shown in SEQ ID NO.2. By using this gene as the target gene and causing it to lose its original function, female fertile fish can be obtained quickly.

[0009] To achieve the above objectives, the present invention has taken the following measures:

[0010] The application of the fish ptprfb gene in fish sex control breeding can be achieved by using conventional methods in the field to target the fish ptprfb gene, causing it to lose its original function, thereby obtaining fish that develop into fertile females.

[0011] In the above applications, the preferred fish species are zebrafish and eel;

[0012] In the above-described applications, preferably, the protein encoded by the zebrafish ptprfb gene is shown in SEQ ID NO.2.

[0013] In the above-described applications, preferred methods for rendering the ptprfb gene lose its original function include: homologous recombination, RNA interference, or gene editing;

[0014] In the above-described applications, preferably, when gene editing of the zebrafish ptprfb gene is performed using CRISPR / Cas9, the target site is: 5'-TCACAGTGCATGAGATCCCAG-3';

[0015] In the above-described applications, preferably, the zebrafish obtained after CRISPR / Cas9 editing contain a gene sequence encoding the protein shown in SEQ ID NO.4, SEQ ID NO.5, or SEQ ID NO.6.

[0016] The scope of protection of this invention also includes:

[0017] Application of the fish ptprfb gene in creating stably inherited female fish.

[0018] A method for creating stably heritable female fish includes testcrossing F0 parents with a non-original ptprfb gene with wild-type fish to produce F1 embryos, culturing positive juveniles, self-fertilizing F1 mutants to obtain F2, and self-fertilizing homozygous male and female fish in the selected F2 generation to obtain F3 homozygous mutant strains.

[0019] The method described above results in over 70% of homozygous mutant strains in the F3 generation developing into stably inherited female fish.

[0020] Compared with the prior art, the present invention has the following advantages:

[0021] The method of this invention can be used to establish sex-controlled breeding technology for fish and to precisely develop female fish strains. This method is easy to implement, simple to operate, hormone-free, and environmentally friendly. By using gene mutation to obtain female fish strains, it eliminates the need for extensive and tedious tissue section analysis to determine the time window for gonadal differentiation and development, avoiding the subsequent long-term feeding with hormone-rich feed. This solves the problems of traditional sex-controlled breeding, such as the environmental impact of hormone treatment for sex conversion and the impact of hormone treatment on seedling survival rates, and has significant application value. This method provides target genes with important breeding value and a precise and efficient new technology for sex-controlled breeding of farmed fish. Furthermore, the established fertile ptprfb mutation model can also be used to conduct basic research on the mechanisms by which energy factors influence fish sex determination and differentiation regulation. Attached Figure Description

[0022] Figure 1 is a schematic diagram of the sequence analysis of the target sites for mutation design of the zebrafish ptprfb gene;

[0023] Figure 2 shows the gonadal development characteristics of wild female zebrafish, wild male zebrafish, and ptprfb homozygous mutant zebrafish 60 days after fertilization.

[0024] Among them, A and B are wild male zebrafish; C is wild female zebrafish; D is a ptprfb homozygous mutant zebrafish; sg: spermatogonia; SC: spermatocytes; PG: primary growth phase oocytes; PV: pre-yolk ovum oocytes.

[0025] Figure 3. Comparison of sex ratio between wild zebrafish populations and ptprfb homozygous mutant zebrafish populations;

[0026] Among them, A is the number of male and female individuals in 3 wild zebrafish populations and 3 ptprfb homozygous mutant zebrafish populations; B is the comparison of the sex ratio between the wild zebrafish population and the ptprfb homozygous mutant zebrafish population. Detailed implementation methods

[0028] Unless otherwise specified, the technical solutions described in this invention are all conventional methods in the field; unless otherwise specified, the reagents or materials used are all from commercial sources.

[0029] This invention uses the ptprfb gene editing of zebrafish and eel as examples to conduct experiments on fish sex control and obtained the same results. It can be seen that other fish genes also have the same function and can be used for sex control.

[0030] Example 1:

[0031] Application of the ptprfb gene in zebrafish sex control:

[0032] This invention obtains a sex-biased female fertile zebrafish population by knocking out the ptprfb gene in zebrafish. The ORF frame of the ptprfb gene in zebrafish is shown in SEQ ID NO.1, and the encoded protein is shown in SEQ ID NO.2.

[0033] 1.1 Experimental Materials

[0034] The zebrafish used in this invention are of strain AB, cultured in a constant-temperature circulating water system at 28 °C at the Institute of Hydrobiology, Chinese Academy of Sciences, under a 14-hour light / 10-hour dark cycle daily. The embryos used for microinjection were obtained through artificial insemination of zebrafish spawn.

[0035] 1.2 Experimental Methods

[0036] The CRISPR / Cas9 target site for the zebrafish ptprfb gene was determined to be TCACGTGCATGAGATCCCAG.

[0037] 1.2.1 Target Site Design

[0038] The full sequence information of the target gene ptprfb (GenBank: BX248089.5) was obtained through the NCBI website (https: / / www.ncbi.nlm.nih.gov). The Cas9 editing target site TCACGTGCATGAGATCCCAG was designed online using the CRISPR / Cas9 design website (http: / / chopchop.cbu.uib.no / ).

[0039] 1.2.2 gRNA template synthesis

[0040] Primers were designed based on the pT7-gRNA template backbone and target sequence used for gRNA transcription as follows:

[0041] Forward primer: T7 promoter sequence + target site sequence + gRNA backbone sequence

[0042] TAATACGACTCACTATAGG TCACGTGCATGAGATCCCAG GTTTTAGAGCTAGAAATAG

[0043] Reverse primer: gRNA backbone sequence AAAAGCACCGACTCGGTGCC.

[0044] Using pT7-gRNA plasmid as a template, an in vitro transcription template for gRNA was synthesized by PCR. The PCR reaction system was as follows: 25 µL of 2×Es Taq Master Mix, 23 µL of dd H2O, 1 µL each of forward and reverse primers, and 0.1 µL of plasmid. The amplification conditions were: 95 ℃ for 3 min; (95 ℃, 30 s; 55 ℃, 20 s; 72 ℃, 20 s) × 32 Cycles; 72 ℃ for 5 min, then 12 ℃. The obtained PCR product was purified and recovered.

[0045] 1.2.3 In vitro transcription and purification of gRNA

[0046] The PCR-purified and recovered product was used for in vitro transcription using the MEGA shortscript™ T7 High Yield Transcription Kit (Invitrogen, AM1354). The reaction mixture consisted of 1 µL of 10×Reaction Buffer, 1 µL of ATP solution, 1 µL of CTP solution, 1 µL of UTP solution, 1 µL of GTP solution, 1 µL of T7 enzyme mix, and 4 µL of template. The mixture was incubated at 37 °C for 3 h. After the reaction, 1 µL of DNase was added, and the mixture was incubated at 37 °C for 15 min. The transcription product gRNA was purified and recovered using the miVana™ miRNA Isolation Kit (Invitrogen, AM1560) as follows: 1) Add 1.25 volumes of anhydrous ethanol; 2) Add the above buffer to the column and centrifuge at 10,000 rpm for 15 s; 3) Discard the filtrate, add 700 µL miRNA Wash Solution I, and centrifuge at 10,000 rpm for 15 s; 4) Discard the filtrate, add 500 µL miRNA Wash Solution II, and centrifuge at 10,000 rpm for 5-10 s; 5) Repeat the above step once; 6) Discard the filtrate and centrifuge for 1 min; 7) Replace with a new collection tube, centrifuge at room temperature for 1-2 min, add 30-50 µL of preheated nuclease-free water, and centrifuge at maximum speed for 30 s; 8) After determining the RNA concentration, aliquot and store for later use.

[0047] 1.2.4 Microinjection

[0048] Injection system: gRNA and Cas9 protein (Invitrogen, AM36497) were diluted to final concentrations of 50 ng / μL and 100 ng / μL, respectively, with RNase-free water. After artificial insemination of zebrafish, embryos were collected and microinjected into 1-cell stage embryos using a PLI-100A quantitative microinjection system (Warner). Approximately 2 nL was injected into each embryo. Injected embryos were placed on a 28 ℃ incubator, and dead eggs were promptly removed.

[0049] 1.2.5 Screening for ptprfb homozygous mutants

[0050] Genotyping was performed on embryos at 48 hpf post-microinjection. Approximately 10-15 embryos were randomly sampled, and genomic DNA was extracted using alkaline lysis. PCR was then used to detect mutations at target sites. Using the genomic DNA as a template, PCR amplification was performed. The forward primer was SEQ ID NO.7 F: 5'-AGGTTTCGGGCAGGGAC-3', and the reverse primer was SEQ ID NO.8 R: 5'-CGATGTTGGAGCGCATG-3'. The PCR system consisted of: 10 µL of 2×Mater mix, 0.5 µL each of forward and reverse primers, 2 µL of genomic DNA template, and 7 µL of sterile water. The reaction conditions were: 94℃ pre-denaturation for 3 min, 30 cycles (94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 20 s), and a final extension at 72℃ for 5 min. After direct sequencing of the PCR products, embryos showing peaks near the target sites were cultured to sexual maturity and designated as generation P0.

[0051] In the P0 generation population, zebrafish were testcrossed with WT to obtain the F1 generation. After the F1 generation reached sexual maturity, the tail fin genome was extracted and screened for positive mutants using the same method. In this example, three positive mutants (-10, -7, -2) bp heterozygous mutants were identified. The F1 generation was obtained by self-crossing the heterozygous F1 with the same genotype. PCR sequencing of individual F2 embryos revealed three genotypes: WT, heterozygous, and homozygous mutant. Self-crossing of homozygous males and females in the F2 generation yielded the F3 homozygous mutant strain (the proteins encoded by the mutated ptprfb gene are shown in SEQ ID NO.4, NO.5, and NO.6, respectively). The specific mutation details are shown in Figure 1.

[0052] The results showed that the homozygous mutant population was biased towards female development. Figure 2 shows the gonadal development characteristics of wild female zebrafish, wild male zebrafish, and ptprfb homozygous mutant zebrafish. Figure 3 shows the sex ratio of wild zebrafish population and ptprfb homozygous mutant zebrafish population.

[0053] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. The application of the fish ptprfb gene in fish sex control breeding involves deactivating the original function of the fish ptprfb gene.

2. The application according to claim 1, wherein the fish is zebrafish or eel.

3. The application according to claim 2, wherein the protein encoded by the zebrafish ptprfb gene is shown in SEQ ID NO. 2, and the protein encoded by the ptprfb gene of the yellow eel is shown in SEQ ID NO.

10.

4. The method for causing the ptprfb gene to lose its original function according to claim 1 includes: Homologous recombination, RNA interference, or gene editing.

5. According to claim 4, when gene editing of the zebrafish ptprfb gene is performed using CRISPR / Cas9, the target site is: 5'-TCACAGTGCATGAGATCCCAG-3'.

6. The application according to claim 5, wherein the zebrafish obtained after CRISPR / Cas9 editing contains a gene sequence encoding the protein shown in SEQ ID NO. 4, SEQ ID NO. 5, or SEQ ID NO.

6.

7. Application of the fish ptprfb gene in the creation of stably inherited female fish.

8. A method for creating a stably inherited female fish, comprising testcrossing a parent F0 with a non-original ptprfb gene to a wild-type fish to produce F1 embryos, further culturing positive juveniles, self-fertilizing the F1 mutants to obtain F2, and self-fertilizing homozygous male and female fish in the selected F2 generation to obtain an F3 homozygous mutant strain.