Beta-glucosidase gene and application thereof

Abstract

The invention discloses a beta-glucosidase gene and an application thereof. Relates to the technical field of enzyme engineering. Comprising a gene of beta-glucosidase, an amino acid sequence and an application of the beta-glucosidase. The optimum temperature of the obtained recombinase B0-BG30 is 40 DEG C, the optimum pH value is 5.6, and the activity of the recombinase B0-BG30 is kept 100% after incubation at 35 DEG C for 2 hours; the activity still exceeds 80% after incubation for 24 h at the pH of 5.0-10.0; the enzyme activity is activated in a 0.5-3.5 M salt solution, and the activity is still kept at 45% or above when the salt concentration is 5 M. Enzyme resources are provided for the aspects of industry, medicine, environmental protection and the like, meanwhile, the research method is widened, and a new thought and a new technical means are provided for detection and application of glycoside compounds.

Description

A β-glucosidase gene and its application Technical Field

[0001] This invention relates to the field of enzyme engineering technology, and more specifically to a β-glucosidase gene and its applications. Background Technology

[0002] β-glucosidase (EC 3.2.1.21, BGL) is a class of hydrolases that can specifically hydrolyze β-glycosidic bonds and remove non-reducing terminal glycosyl residues from glycosidic molecules, generating the corresponding aglycone and glucose in the process (Cairns et al., 2010).

[0003] Soy isoflavones are important bioactive components of soybeans, existing primarily in 12 structural forms, including a small amount of free aglycones and a large amount of bound glycosides. The three main aglycones are daidzein, genistein, and glycitein, accounting for approximately 2%–3% of the total (Lee et al., 2007); their corresponding glycoside forms, daidzin, genistin, glycitin, and their derivatives, account for 97%–98% (Kudoua et al., 1991). Previous studies have shown that the various physiological activities of isoflavones are mainly contributed by aglycones, while glycosides have low absorption rates in the intestine (Izumi et al., 2000). Therefore, efficiently converting isoflavone glycosides into easily absorbed and more active aglycones is a key step in enhancing their nutritional and pharmacological effects.

[0004] Among various conversion technologies, enzymatic hydrolysis has attracted much attention due to its high specificity, mild conditions, high efficiency, and few byproducts. However, in practical applications, isoflavones (BGLs) are often affected by product glucose inhibition and external factors such as ions, chemical reagents, high salt, and high temperature, leading to decreased activity and stability, thus limiting their application in complex working conditions and industrial processes. Therefore, exploring new BGL resources with salt tolerance, temperature tolerance, and inhibition resistance is of great significance for improving the bioconversion efficiency of isoflavones and expanding their application scenarios.

[0005] Therefore, whether a β-glucosidase gene and its application can be provided to overcome the above-mentioned technical deficiencies is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0006] In view of this, the present invention provides a β-glucosidase gene and its application. Extreme saline environments contain a class of naturally adapted enzyme resources adapted to hypertonic and high ionic strength conditions. Based on this, the present invention uses metagenomic technology to screen β-glucosidase functional genes from saline-alkali soils in Karamay, Xinjiang, obtaining the β-glucosidase gene b0-bg30, and cloning and expressing its encoded recombinant enzyme B0-BG30 in Escherichia coli. Through systematic characterization of the enzyme's optimal reaction conditions, pH and thermal stability, salt tolerance, and substrate spectrum and kinetic parameters for soybean isoflavone glycosides, it was confirmed that it has good hydrolytic performance and significant salt tolerance for daidzein, genistein, and genistein. Simultaneously, using HPLC as a reference, the feasibility of indirectly monitoring the amount of glucose generated in the reaction system using the glucose oxidase method to assess the degree of conversion of soybean isoflavone glycosides was verified.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] A β-glucosidase gene, the nucleotide sequence of which is shown in SEQ ID No. 3.

[0009] The present invention also provides a β-glucosidase expressed by the above-mentioned β-glucosidase gene, the amino acid sequence of which is shown in SEQ ID No. 4.

[0010] The present invention also provides an expression cassette, or recombinant vector, or genetically engineered bacteria containing the above-mentioned coding gene.

[0011] The present invention also provides a method for constructing the above-mentioned recombinant vector, comprising the following steps: (1) designing cloning primers for β-glucosidase to clone the target gene; (2) ligating the cloning product with the pSHY211 vector to construct the expression plasmid pSHY211-b0-bg30, and transforming it into competent E. coliDH5α for cloning and expression.

[0012] Preferred: Cloning primers for β-glucosidase in step (1): b0-bg30-F, nucleotide sequence as shown in SEQ ID No.1; b0-bg30-R, nucleotide sequence as shown in SEQ ID No.2.

[0013] The present invention also provides the application of the above-mentioned encoding gene, or the above-mentioned enzyme, or the above-mentioned expression cassette, or the recombinant vector, or the genetically engineered bacteria in the degradation of soybean isoflavone glycosides.

[0014] Preferred: Soy isoflavone glycosides: daidzein, genistein and genistein.

[0015] This invention also provides the application of the above-mentioned enzyme in the detection of glycoside products using the glucose oxidase method.

[0016] As can be seen from the above technical solution, compared with the prior art, this invention discloses a β-glucosidase gene and its application. The technical effect achieved is that this invention utilizes metagenomic technology to excavate a β-glucosidase gene b0-bg30 belonging to the GH1 family from saline-alkali soil in Karamay, Xinjiang. This gene was cloned and heterologously expressed in *E. coli* DH5α, followed by enzymatic property analysis and studies on the degradation of soybean isoflavone glycosides. Simultaneously, high-performance liquid chromatography (HPLC) was used to verify the feasibility of determining soybean isoflavones using the glucose oxidase method. The results show that the optimal temperature for the recombinant enzyme B0-BG30 is 40℃, the optimal pH is 5.6, and its activity remains 100% after incubation at 35℃ for 2 hours; after incubation at pH 5.0-10.0 for 24 hours, the activity still exceeds 80%; that is, it has strong thermal stability and salt tolerance, and its enzyme activity is activated in 0.5-3.5 M salt solutions, maintaining an activity of over 45% even at a 5 M salt concentration. When daidzein, genistein, and genistein were used as substrates, their Km values ​​were 5.03, 2.21, and 3.92 mM, respectively, and their Vmax values ​​were 11.85, 3.34, and 6.85 μmol / min / mg, respectively. In summary, this invention obtained the recombinant enzyme B0-BG30 from a metagenomically derived β-glucosidase gene, which possesses excellent properties and can effectively degrade soybean isoflavone glycosides, particularly excelling in the hydrolysis of genistein and genistein. The feasibility of using the glucose oxidase method to detect glycoside products was preliminarily verified. Furthermore, the glucose yield of B0-BG30 was approximately 50% as determined by a glucose assay kit, while the conversion rate measured by HPLC was approximately 60%, showing only a slight difference. This provides enzyme resources for industry, medicine, and environmental protection, while also broadening research methods and offering new ideas and technical means for the detection and application of glycoside compounds. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0018] Figure 1 is a phylogenetic diagram showing the relationship between B0-BG30 and adjacent β-glucosidase protein sequences provided by the present invention.

[0019] Figure 2 shows a 12% SDS-PAGE gel image of β-glucosidase B0-BG30 provided by the present invention; Lane 1: Protein Marker; Lane 2: Total protein of E. coli DH5α / pSHY211-B0-BG30; Lane 3: Purified B0-BG30 protein.

[0020] Figure 3 shows the effect of temperature and pH on the activity of recombinant enzyme BO-BG30 when cellobiose and α-lactose provided by the present invention are used as substrates. In the figure, A: effect of pH on BO-BG30 activity; B: effect of temperature on BO-BG30 activity. The error bars represent the mean ± standard deviation (mean ± SD) of three biological replicates.

[0021] Figure 4 illustrates the effects of temperature and pH on the activity and stability of recombinant β-glucosidase B0-BG30 provided by this invention. A: Effect of pH on the activity of recombinant enzyme B0-BG30; B: Effect of temperature on B0-BG30 activity; C: Effect of different pH values ​​for incubation at 12 h and 24 h on the stability of recombinant enzyme B0-BG30; D: Effect of different temperatures (35, 40, 45℃) on the stability of recombinant enzyme B0-BG30 at different time periods (0, 20, 40, 60, 80, 100, 120 min). Values ​​represent the average of three biological replicates; error bars represent the mean ± standard deviation (mean ± SD) of the three biological replicates; p < 0.01 ( () indicates a highly significant difference, p < 0.05. () indicates a significant difference.

[0022] Figure 5 shows the effect of metal ions and chemical reagents provided by this invention on the activity of the BO-BG30 enzyme. In Figure 5, A represents the effect of metal ions on the activity of the recombinant enzyme BO-BG30; B represents the effect of chemical reagents on the activity of the recombinant enzyme BO-BG30; Control represents the control group, without the addition of any ions or chemical reagents; the values ​​represent the mean ± standard deviation (mean ± SD) of three biological replicates, p < 0.01. () indicates a highly significant difference, p < 0.05. () indicates a significant difference.

[0023] Figure 6 shows the effect of NaCl provided by this invention on the activity of recombinant β-glucosidase B0-BG30, where A: the effect of different NaCl concentrations on the activity of B0-BG30 enzyme; B: the effect of NaCl on the tolerance of recombinant enzyme B0-BG30, and the values ​​represent the mean ± standard deviation (mean ± SD) of three biological replicates; p < 0.01 ( () indicates a highly significant difference, p < 0.05. () indicates a significant difference.

[0024] Figure 7 shows the effect of glucose provided by the present invention on the activity of recombinant β-glucosidase B0-BG30, p < 0.01. () indicates a highly significant difference, p < 0.05. () indicates a significant difference.

[0025] Figure 8 is a Lineweaver-Burk double reciprocal plot of B0-BG30, which uses cellobiose as a substrate provided in this invention.

[0026] Figure 9 is a Lineweaver-Burk double reciprocal plot of B0-BG30 with α-lactose as the substrate provided by the present invention.

[0027] Figure 10 shows the HPLC chromatogram of the soybean isoflavone standard provided by the present invention, wherein 1: daidzein, 2: genistein, 3: genistein, 4: daidzein, 5: genistein, and 6: genistein.

[0028] Figure 11 shows the HPLC chromatograms of genistein before and after enzymatic hydrolysis provided by the present invention. A: HPLC chromatogram of genistein before enzymatic hydrolysis, B: HPLC chromatogram of genistein after enzymatic hydrolysis.

[0029] Figure 12 is a flowchart of the overall process provided by the present invention. Detailed Implementation

[0030] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0031] This invention discloses a β-glucosidase gene and its application (the process flow diagram is shown in Figure 12; for clearer illustration of the invention, a technical roadmap is used: samples were collected from saline-alkali land in Karamay, Xinjiang, enriched, and metagenomically extracted using a kit and sequenced. The β-glucosidase gene was obtained from the metagenomic library, cloned, heterologously expressed, and enzymatically characterized to obtain a high-quality β-glucosidase B0-BG30. B0-BG30 was applied to the hydrolysis of soybean isoflavone glycosides, and HPLC was used as a reference to assess the feasibility of using glucose oxidase to detect the hydrolysis of soybean isoflavone glycosides).

[0032] Reagents and materials not mentioned in the examples are all commercially available; experimental methods not mentioned are all conventional methods; specifically: Sample collection and metagenomic DNA extraction and sequencing studies: Samples were collected from saline-alkali soil in Karamay, Xinjiang (85.20898°E, 45.56104°N), at a sampling temperature of 28°C, pH 8.0, and a salt concentration of 29.05%. The soil samples were stored in the laboratory using ice packs. 5 grams of soil sample were added to a 250 ml Erlenmeyer flask containing 100 ml of 5% NaCl solution. The Erlenmeyer flask was incubated on a shaker at 150 rpm and 28°C for 2 hours. Then, 1 ml of the above sample processing solution was added to 50 ml of cellulose basal medium for enrichment culture. The medium composition was: 1 sheet of 9 cm diameter filter paper per bottle, 0.5 g / L MgSO4, 200 g / L NaCl, 1 g / L KNO3, 0.5 g / L K2HPO4, 1 ml / L trace salt, pH 8.0. The enriched samples were placed in an incubator at 28℃ for incubation. After one month of enrichment culture, the enriched samples were collected by centrifugation at 4000 rpm. Finally, metagenomic DNA was extracted using the Power Soil Kit (MOBIO DNeasy PowerSoil Kit, USA). The metagenomic DNA was extracted according to the instructions. After extraction, the DNA was verified by agarose gel electrophoresis. After detecting the sample bands, the extracted metagenomic DNA was sequenced.

[0033] Novel GH1 (GH1) β-glucosidase functional genes were predicted from metagenomic data using sequence and bioinformatics analysis. BLASTx and BLASTp (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi) were used to analyze the homology of their nucleic acid and protein sequences; SignalP (http: / / www.cbs.dtu.dk / services / SignalP / ) was used to predict the signal peptide; and ExPASy (https: / / web.expasy.org / compute_pi / ) was used to predict the theoretical isoelectric point and relative molecular mass. A phylogenetic tree was constructed using MEGA7 software (Kumar et al., 2016) with maximum likelihood (NJ) and a Poisson correction model.

[0034] The activity of the recombinant enzyme (B0-BG30) was determined according to the method of Yin et al. (Yin, YR, Sang, P., Xian, WD, Li, X., Jiao, JY, Liu, L., ...&Li, WJ (2018). Expression and characteristics of two glucose-tolerant GH1 β-glucosidases from Actinomadura amylolytica YIM 77502T for promoting cellulose degradation. Frontiers in Microbiology, 9, 3149. DOI: 10.3389 / fmicb.2018.03149), using cellobiose as a substrate to determine β-glucosidase activity. 10 μL of purified enzyme solution was added to 90 μL of buffer containing 1% (w / v) cellobiose, and the reaction was carried out for 30 min at the optimal temperature and pH conditions for the enzyme; subsequently, it was placed in a suitable environment. The reaction was terminated by freezing at 20°C for 5 min. 10 μL of the reaction solution was transferred to a 96-well plate, and 200 μL of working solution from a glucose oxidase-peroxidase (GOD-POD) assay kit (Sinobiotech, Beijing, China) was added. The plate was incubated at 37°C for 5–10 min; the absorbance was read at 492 nm using a microplate reader. A standard curve was plotted using glucose standards to calculate the glucose concentration. A unit of β-glucosidase activity (U) was defined as the amount of enzyme required to hydrolyze cellobiose and release 2 μmol of glucose per minute under the stated conditions.

[0035] Unless otherwise specified, all experiments were performed in triplicate and analyzed using the mean. Results are expressed as mean ± standard deviation (mean ± SD). Statistical analysis was performed using SPSS 20.0 software, employing one-way ANOVA, with Tukey's test used for post-hoc comparisons. A p-value < 0.05 was considered statistically significant. To ensure reliability, normality and homogeneity of variance tests were performed as necessary.

[0036] The strain, vector, culture medium, and main reagents were: Escherichia coli DH5α (Shenzhen Kangti Life Science Technology Co., Ltd.) for cloning and expression of the β-glucosidase gene; and constitutive expression vector pSHY211 for construction of recombinant plasmids (Yin, YR, Li, XW, Long, CH, Li, L., Hang, YY, Rao, MD, ... & Yang, LQ (2023). Characterization of a GH10 extremely thermophilic xylanase from the theetagenome of hot spring for prebiotic production. Scientific Reports, 13(1), 16053). E. coli DH5α containing the recombinant plasmid was cultured in Luria-Bertani (LB) medium supplemented with kanamycin (50 μg / mL).

[0037] LB basal medium: yeast extract 5 g / L, tryptone 10 g / L, NaCl 10 g / L; 2% (w / v) agar added to solid medium; distilled water to a final volume of 1 L.

[0038] Aesculin inverted double-layer medium: 1% (w / v) agarose, 1‰ (w / v) aesculin, 1% (w / v) lysozyme, kanamycin 50 μg / mL. Used for screening positive clones with β-glucosidase activity using the inverted double-layer plate method.

[0039] Main reagents: Glucose assay kit (Sino Biologics Inc.); p-nitrophenyl-β-D-glucopyranoside (pNPG, Shanghai Sangon Biotech); cellobiose (Shanghai Sangon Biotech); soybean isoflavone mixture (Xi'an Tianguangyuan Biotechnology Co., Ltd.); daidzin (Shanghai Aladdin Biochemical Technology Co., Ltd.); glycitin (Shanghai Aladdin Biochemical Technology Co., Ltd.); genistin (Shanghai Yuanye Biotechnology Co., Ltd.). These substrates were used to evaluate the degradation activity of recombinant enzyme BO-BG30 on soybean isoflavone glycosides.

[0040] Example 1: Amplification, Cloning, Expression, and Recombinant Screening of the b0-bg30 Gene; After enrichment culture, total DNA was extracted from saline-alkali soil using the Power Soil Kit (MOBIO DNeasy PowerSoil Kit, USA) and metagenomic sequencing was performed (Hangzhou Lianchuan Biotechnology Co., Ltd.). The β-glucosidase b0-bg30 gene sequence was obtained from the metagenomic database. Primers designed for this gene were: b0-bg30-F (sequence: CATCATCATCATCATCATGAA ATGATGGGTTTTCCAAATGAT, as shown in SEQ ID No. 1), b0-bg30-R (sequence is...) GTGCTCGAGTGCGGCCGCAAG AAGATTCTCTCCATTACTTTC (as shown in SEQ ID No. 2). PCR amplification was performed using the target DNA of metagenomic β-glucosidase as a template (amplification system: total system 40 μl, including 20 μl template (2x mix + total metagenomic DNA), 1 μl each of forward and reverse primers, and 18 μl sterile water to make up the system; program: 95℃ pre-denaturation for 3 min; 98℃ denaturation for 15 s, 60℃ annealing for 20 s, 72℃ extension for 30 s, for a total of 32 cycles; 72℃ extension for 5 min; storage at 12℃). The amplification products were identified and recovered by 1.0% agarose gel electrophoresis. The PCR products were ligated to the pSHY211 vector using the pEASY-Uni Seamless Cloning and Assembly Kit (Beijing TransGen Biotech Co., Ltd., catalog number CU101-01) to construct the expression plasmid pSHY211-b0-bg30, which was then transformed into competent E. coli DH5α cells for cloning and expression.

[0041] Transformants were plated on LB agar plates containing kanamycin (50 μg / mL) and incubated at 37°C. β-glucosidase activity was detected using the inverted double-layer plate method: the first layer of LB agar plates (containing kanamycin, 2% agar) was incubated at 37°C for 16 h; then, a second layer of medium containing 1% agarose, 1‰ aescin, 1% lysozyme, PBS buffer, and kanamycin (50 μg / mL) was added; after incubation at 37°C for 2 h, the color of the colonies was observed; a dark brown color was considered positive. Active positive clones were then sequenced for verification.

[0042]

[0043] Example 2 Expression, isolation, purification and identification of recombinant enzyme B0-BG30: E. coli DH5α / pSHY211-b0-bg30 was activated on LB solid plates containing kanamycin (50 μg / mL). Single clones were picked and inoculated into 100 mL of LB liquid medium containing kanamycin (50 μg / mL) and cultured at 37°C and 180 rpm for 8 h with shaking. Then the culture temperature was changed to 25°C and cultured at 180 rpm for another 12 h. After fermentation, the cells were collected by centrifugation at 12000 r / min for 20 min at 4℃. An appropriate amount of quartz sand was added, and the cells were ground and crushed with liquid nitrogen. The supernatant was collected and processed according to the method previously reported by Yin et al. (Yin, YR, Meng, ZH, Hu, QW, Jiang, Z., Xian, WD, Li, LH,...&Li, WJ (2017). The hybrid strategy of Thermoactinospora rubra YIM77501T for utilizing cellulose as a carbon source at different temperatures. Frontiers in Microbiology, 8, 942.DOI: 10.3389 / fmicb.2017.00942) Protein purification: The supernatant obtained above was purified by passing it through a Ni-NTA affinity chromatography column. The target protein with an N-terminal histidine tag (His-tag) can bind to Ni. Subsequently, the protein was washed with 15 mM and 30 mM imidazole buffer (pH 7.6), and then eluted with solutions of different concentration gradients (50, 100, 150, 200, 250, and 500 mM imidazole). Protein concentration was determined using the Bradford method (catalog number: C503031, Sangon Biotech Co., Ltd., Shanghai). The molecular weight and purity of recombinant enzyme B0-BG30 were identified by 12% SDS-PAGE.

[0044] Experimental results: The theoretical isoelectric point (pI) and molecular weight (Mw) predicted by the ExPASy website (https: / / web.expasy.org / compute_pi / ) are 4.81 and 52.25 kDa, respectively.

[0045] The β-glucosidase target gene (b0-bg30) obtained from metagenomics was ligated into the expression vector pSHY211 (ligation system: 2 μl target gene b0-bg30, 1.5 μl vector, and 1.5 μl recombinase, totaling 5 μl; PCR conditions: 50℃ for 30 min, 55℃ hot-cover temperature). The target gene and pSHY211 formed a recombinant vector, which was then transformed into E. coli DH5α (first incubated on ice for 2 min, heat-shocked at 42℃ for 30 s, then immediately incubated on ice for 2 min, followed by the addition of 450 μl of liquid LB, and incubated at 37℃ for 1 h). An appropriate amount of culture medium was plated onto solid LB containing kanamycin. The selected positive clones were sent for testing, and those with correct sequences were used for subsequent purification. The recombinant protein (B0-BG30) with a His-tagged N-terminus was purified using a Ni chelate affinity column (Yin, YR, Meng, ZH, Hu, QW, Jiang, Z., Xian, WD, Li, LH, ...&Li, WJ (2017). The hybrid strategy of Thermoactinospora rubra YIM 77501T for utilizing cellulose as a carbon source at different temperatures. Frontiers in Microbiology, 8,942. DOI: 10.3389 / fmicb.2017.00942). SDS-PAGE electrophoresis analysis showed that the molecular weight of the recombinant β-glucosidase B0-BG30 was consistent with the theoretical prediction, successfully obtaining a single target protein (Figure 2).

[0046] Example 3 Enzymatic Characteristics of Purified Recombinant Enzyme B0-BG30: Determination of Optimal Reaction pH and pH Stability: Under constant temperature conditions (the same temperature as conventional activity determination), purified B0-BG30 was added to buffer solutions of different pH values ​​for reaction, and the relative enzyme activity was measured. The buffer solutions used were: citrate-disodium hydrogen phosphate buffer (pH 3.0, 3.6, 4.0, 4.6, 5.0, 5.6, 6.0, 6.6, 7.0, 7.6, 8.0) and glycine-sodium hydroxide buffer (pH 8.0, 8.6, 9.0, 9.6, 10.0). The activity was measured according to standard methods at each pH condition, and the pH corresponding to the maximum activity was taken as the optimal pH. The activity at each pH was expressed as relative activity (%) (with the maximum value as 100%).

[0047] pH stability: The enzyme solution was mixed with buffers of different pH values ​​(3.0–10.0) at a volume ratio of 1:2 and incubated at 4°C for 12 h and 24 h, respectively. For the positive control, PBS buffer (pH 7.6) was used instead of the different pH buffers, while all other conditions remained the same. After incubation, the residual activity was measured under standard assay conditions (fixed temperature and optimal pH, substrate: cellobiose). The results are expressed as relative residual activity (%) (with 0 h control as 100%).

[0048] Determination of optimal reaction temperature and thermal stability: Under optimal pH conditions, 10 μL of pure enzyme solution was added to 90 μL of buffer solution containing 1% (w / v) cellobiose, and the mixture was reacted at different temperatures (10–80℃, in 5℃ increments) for 30 min; after the reaction... The reaction was terminated by freezing at 20℃ for 5 min, and the activity was determined according to the standard method. The maximum activity measured was taken as 100%, and the relative activity (%) at each temperature was calculated to determine the optimal reaction temperature.

[0049] Thermal stability: The pure enzyme solution was incubated at 35℃, 40℃ and 45℃ for a total of 120 min. Samples were taken every 20 min, and the remaining activity was immediately measured under standard test conditions. The relative remaining activity was calculated with the initial activity (0 min) as 100%.

[0050] Effects of different metal ions and inhibitors on recombinase B0-BG30 Metal ions: K+ was added to the reaction system respectively + Mg 2+ Fe 3+ Ca 2+ Zn 2+ Co 2+ Cu 2+ Ag + Mn 2+ Pb 2+ and Ni 2+ The final concentrations were 1 mM and 10 mM, respectively, and activity was measured under optimal conditions. Chemical reagents and surfactants / organic solvents: The effects of the following additives on enzyme activity were tested: EDTA-Na2, SDS, PMSF, DTT, CTAB: final concentrations of 0.1% and 1.0% (w / v or v / v according to reagent properties). Methanol (MeOH), Tween-80, isopropanol (IPA), ethanol (EtOH), β-mercaptoethanol (β-ME): final concentrations of 1% and 10% (v / v). Reactions were carried out at optimal temperature and pH, and enzyme activity was recorded under each condition. Results are expressed as relative activity (%) (the no-additive control was set as 100%). An enzyme-free blank was set up if necessary to correct for background absorbance.

[0051] The effect of salt concentration on recombinant enzyme B0-BG30 activity was investigated under optimal conditions (40℃, pH 5.6). Different concentrations of NaCl solutions (0, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000 mM) were prepared and added to an optimal pH buffer containing 1% (w / v) cellobiose as the substrate solution (90 μL). 10 μL of enzyme solution was added, and the reaction was carried out at the optimal temperature for 30 min. The reaction was terminated by placing the solution on ice for 5 min. The relative activity (%) at each salt concentration was calculated using 0 mM NaCl as a control (100%).

[0052] The effect of glucose concentration on enzyme activity was assessed by evaluating the inhibition of glucose products using p-nitrophenyl-β-D-glucopyranoside (pNPG) as a substrate. The reaction system consisted of 125 μL of glucose solutions at different concentrations (0, 250, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000 mM) + 15 μL of 10 mM pNPG + 10 μL of purified enzyme solution (total reaction volume 150 μL). After incubation at 40 °C for 10 min, the reaction was terminated by adding 450 μL of 1 M Na₂CO₃, and the absorbance was measured at 405 nm. Using an enzyme-free system as a background correction, the relative residual activity was calculated with the activity under 0 mM glucose conditions as 100% to evaluate the inhibitory effect of glucose on the recombinant enzyme B0-BG30.

[0053] Substrate specificity and kinetic parameters were determined. Substrate specificity: Under optimal conditions, equal volumes of enzyme solution were reacted with different substrates for 15 min, and the amount of hydrolysis products generated was measured. Substrates included: cellobiose, p-nitrophenyl-β-D-glucopyranoside (pNPG), α-lactose monohydrate, gentiobiose, maltose, trehalose, melibiose, raffinose, sucrose, sodium carboxymethyl cellulose, microcrystalline cellulose, beech xylan, etc. For substrates releasing glucose, the glucose oxidase-peroxidase method (492 nm) was used for determination; for chromogenic substrates such as pNPG, the pNPG release was determined at 405 nm. Results are expressed as relative activity (%) (with the substrate showing the highest activity as 100%).

[0054] Kinetic parameters: Different concentrations of cellobiose and α-lactose monohydrate (0.2–2% w / v) and pNPG (0.2–2 mM) were used as substrates, and the reactions were carried out for 10 min under optimal conditions to ensure that the samples were taken in the initial rate-dependent phase. The initial reaction rate was calculated, a Lineweaver–Burk double reciprocal plot was plotted, and Km and Vmax were determined according to the Michaelis–Menten equation. Parallel replicates were set up for each concentration to reduce experimental error.

[0055] Experimental Results: Optimal pH and pH Stability: The optimal pH for B0-BG30 using cellobiose and α-lactose-hydrate as substrates was acidic, specifically 5.6 and 6 (Figure 3A). The enzyme activity of B0-BG30 was within the pH range of 3.0-6.0, reaching its optimal activity level only after that point. The activity gradually decreased with increasing pH, and β-glucosidase B0-BG30 was almost inactivated in extremely acidic environments (pH 3.0-4.0) and in extremely alkaline environments (pH 9.6) (Figure 4A). At 4°C, after incubation in different pH buffers for 12 h and 24 h, the enzyme activity of β-glucosidase B0-BG30 was inhibited by the different pH buffers. Particularly after 24 h of treatment, the enzyme activity decreased to below 80% (Figure 4C).

[0056] Optimal Temperature and Temperature Tolerance: At the optimal pH, the optimal temperature for β-glucosidase B0-BG30 is 40°C. Within the temperature range of 35-45°C, the enzyme retains more than 70% of its activity. When the temperature is below or above this range, its activity decreases significantly (Figure 4B). The optimal temperatures for cellobiose and α-lactose-hydrate as substrates are 40°C and 50°C, respectively. The enzyme activity decreases rapidly when reaching their respective optimal temperatures. The enzyme activity for α-lactose-hydrate and cellobiose as substrates almost becomes inactive at 80°C (Figure 3B). The effect of temperature on the activity of β-glucosidase B0-BG30 was investigated at 35°C, 40°C, and 45°C for up to two hours. It was found that the temperature had little effect on the enzyme activity at 35°C and 40°C, and the activity remained above 60% after 2 hours of treatment. However, the activity dropped below 50% after 20 minutes of treatment at 45°C, and the enzyme was almost inactivated after 60 minutes of treatment (Figure 4D).

[0057] The effects of metal ions and inhibitors on the activity of recombinase B0-BG30: At a concentration of 1 mM, the metal ion K + Co 2+ Cu 2+ Pb 2+ Ni 2+ The activity of B0-BG30 was minimally affected, remaining above 80%. However, when the tested metal ion concentration reached 10 mM, the enzyme activity dropped below 80%. Among these, Mg... 2+ At concentrations of 1 mM and 10 mM, the activity decreased to below 20%; when Ag +At a concentration of 1 mM, 39% residual activity was retained, but the enzyme was completely inactivated at a concentration of 10 mM. High concentrations of chemical reagents had a significant inhibitory effect on enzyme activity, especially in the presence of 1% and 10% SDS and β-mercaptoethanol, where activity decreased to below 10% or even almost became inactivated. The presence of low concentrations of other chemical reagents led to a decrease in enzyme activity with increasing solvent concentration (Figure 5). Overall, BO-BG30 is stable in most low concentrations of ions and chemical reagents.

[0058] The effects of NaCl and glucose on the activity of recombinant enzyme BO-BG30: The activity of BO-BG30 showed a trend of first increasing and then decreasing with the NaCl concentration. As the NaCl concentration increased from 0 M to 2.0 M, its relative activity gradually increased, reaching a maximum of approximately 165%, indicating that salt had an activating effect on the enzyme. However, when the NaCl concentration exceeded 2.0 M, the enzyme activity decreased sharply, with the relative activity dropping to approximately 50% at 5.0 M. This indicates that high salt concentrations inhibit the activity of BO-BG30, showing a significant inhibitory effect at high NaCl concentrations. Furthermore, the inhibitory effect became more pronounced with increasing salt concentration. Therefore, overall, BO-BG30 is quite sensitive to salt concentration, and its activity is easily inhibited by high NaCl concentrations (Figure 6A). In addition, after incubating BO-BG30 at different NaCl concentrations for 12 h and 24 h, the residual activity of BO-BG30 under 0-5 M salt concentrations remained above 100% within 24 h (Figure 6B).

[0059] The activity of recombinase B0-BG30 decreased continuously with increasing glucose concentration. At 500 mM, the relative activity dropped to approximately 55%, and it was almost inactive at 4000 mM, indicating that recombinase B0-BG30 is highly sensitive to glucose concentration; high glucose concentrations significantly inhibit its activity. The Ki value of β-glucosidase B0-BG30 was 365 mM (Figure 7). Overall, glucose concentration is highly sensitive to recombinase B0-BG30.

[0060] The substrate specificity and kinetic constants of recombinant enzyme B0-BG30: Recombinant enzyme B0-BG30 has the highest specific activity for pNPGlc, indicating that the enzyme has a high affinity for pNPGlc. It also has some activity for α-lactose-hydrate and cellobiose, indicating that this recombinant enzyme can hydrolyze not only the natural substrate cellobiose, but also artificially synthesized substrates, making it a multifunctional enzyme. However, its catalytic efficiency is relatively low. It has no catalytic activity for other substrates such as maltose and trehalose (Table 1). Under optimal reaction conditions with cellobiose as the substrate, the Km of B0-BG30 was calculated to be 27.03 mg / mL and the Vmax to be 7.35 μmol / min / mg using a Lineweaver-Burk plot (Figure 8). When α-lactose monohydrate was used as the substrate, the Km value was 6.59 mM and the Vmax was 3.28 μmol / min / mg (Figure 9), which means that it has a high affinity for cellobiose and α-lactose, which may be due to the specificity of the enzyme.

[0061]

[0062] Note: Special activity (U / mg) values ​​are expressed as mean ± standard deviation. Example 4 Feasibility analysis of glucose kit for determining the degradation of soybean isoflavone glycosides by B0-BG30 1 Determination of glucose generated from the degradation of soybean isoflavone glycosides by recombinant enzyme B0-BG30 Substrate preparation: Using daidzin, glycitin, and genistin as substrates, prepare solutions to 2 mg / mL with the optimal pH buffer containing 5% (v / v) DMSO.

[0063] Reaction system: Mix 20 μL of purified B0-BG30 enzyme solution with 80 μL of substrate and incubate at the optimal reaction temperature and pH for 15 min.

[0064] Reaction termination and assay: The reaction solution was placed in boiling water for 5 min to terminate the reaction; 10 μL of the reaction solution was added to a 96-well plate, followed by 200 μL of the glucose assay kit working solution (GOD-POD system). After incubation at 37°C for 10 min, the absorbance was measured at 492 nm. The concentration of glucose produced was calculated using a glucose standard curve to evaluate the hydrolytic ability of B0-BG30 for different isoflavone glycosides. If necessary, an enzyme-free control and a "substrate + DMSO" control were set up to correct for background.

[0065] 2. Substrate Specificity and Kinetic Parameter Determination of Soy Isoflavones Substrate Specificity: Using recombinant enzyme BO-BG30 as a biocatalyst, the substrate specificity of daidzin, glycitin, genistin, and a mixture of soybean isoflavones was analyzed. The reaction was carried out at optimal temperature and pH for a fixed time, and glucose production was determined using a glucose assay kit according to the method described in section 1. The relative activities of different substrates were compared.

[0066] Kinetic parameters: Different concentrations of daidzein, genistein, and genistein (0.2–3.0 mg / mL) were prepared and reacted for 10 min at the optimal temperature and pH to ensure the initial reaction rate. Using the glucose production rate as the reaction rate, the Km and Vmax of recombinant enzyme B0-BG30 for each daidzein glycoside were calculated according to the Michaelis–Menten equation and by plotting a Lineweaver–Burk double reciprocal plot. Each concentration was tested in triplicate to minimize error.

[0067] 3. High-performance liquid chromatography (HPLC) detection of enzymatic hydrolysis product sample preparation: Genistin was used as the substrate, with a final concentration of 2 mg / mL (prepared using optimal pH buffer). 20 μL of pure BO-BG30 enzyme solution and 80 μL of substrate were mixed and reacted at the optimal temperature and pH for 15 min; the reaction was then terminated by boiling in water for 5 min. An appropriate amount of methanol was added to the sample, mixed well, and then filtered through a 0.45 μm microporous membrane before injection.

[0068] HPLC conditions: C18 column (4.6 mm × 250 mm, 5 μm); mobile phase A: 0.1% (v / v) phosphoric acid aqueous solution; mobile phase B: acetonitrile; flow rate 1.0 mL / min; column temperature 25℃; detection wavelength 260 nm; injection volume 10 μL. Gradient elution program: 20% isocratic gradient in phase B for 5 min; 20%→60% linear gradient for 25 min; 60%→95% linear gradient for 10 min. The conversion rate was calculated based on the peak area of ​​genistein before and after enzymatic hydrolysis (and the genistein aglycone peak was monitored simultaneously if necessary), and compared with the glucose production obtained by the glucose assay method to verify the feasibility of the glucose method for evaluating the hydrolysis of soybean isoflavone glycosides.

[0069] Experimental Results: Substrate Specificity and Kinetic Analysis of Soy Isoflavone Degradation by Recombinant Enzyme B0-BG30. When genistin was used as the substrate, B0-BG30 exhibited high catalytic efficiency. This indicates that the enzyme's hydrolysis effect on genistin was better than the other three substrates. Secondly, when daidzin was used as the substrate, its specific activity was second only to genistin. Specific activities of soy isoflavones: genistin > daidzin > daidzin > daidzin glycosides (Table 2). This suggests that the recombinant enzyme B0-BG30 had a poor hydrolysis effect on soy isoflavones, possibly because soy isoflavones are a mixture with a complex structure, leading to reduced catalytic efficiency. These results provide important theoretical basis for further research on the biotransformation of soy isoflavones and the development of functional foods.

[0070]

[0071] Note: Special activity (U / mg) values ​​are expressed as enzyme activity ± standard deviation. Using daidzein, genistein, and genistein as substrates, and under optimal reaction conditions, the Km and Vmax values ​​of B0-BG30 were calculated using a Lineweaver-Burk double reciprocal plot (Table 3). B0-BG30 exhibited high catalytic efficiency (Vmax) on all substrates, especially in the hydrolysis of genistein and genistein.

[0072]

[0073] A glucose assay kit was used to detect the hydrolytic capacity of soy isoflavones, employing daidzein, genistein, and soy isoflavone glycosides as substrates to test the glucose concentration produced by the recombinant enzyme BO-BG30 through hydrolysis. Based on these results, the feasibility of using genistein as a substrate for the glucose assay kit was analyzed. After the hydrolysis reaction, the products of β-glucosidase BO-BG30 hydrolyzing soy isoflavone glycosides were detected using the glucose assay kit. The glucose concentration of the product was then calculated using a glucose standard curve. The hydrolysis product yield was used to measure the hydrolytic effect of β-glucosidase on soy isoflavone glycoside degradation. Therefore, the calculated glucose yield of the hydrolysis product after β-glucosidase BO-BG30 hydrolyzing genistein, as detected by the glucose assay kit, was approximately 50%.

[0074] Feasibility Analysis of a Glucose Assay Kit – HPLC Chromatogram of Soy Isoflavone Standards: In this example, HPLC was used to analyze a mixture of soybean isoflavone glycosides and aglycones as standards to accurately identify the substance corresponding to each peak. Six main peaks appeared in the chromatogram, corresponding to the six substances in the standards, each with a specific elution time, providing a reliable basis for qualitative analysis. Specifically, peak 1 (daidzein) appeared at 5.129 min, with a peak area of ​​1389.672 mAU·min and a peak height of 134.533 mAU; peak 2 (daidzein) appeared at 5.413 min, with a peak area of ​​2392.84 mAU·min and a peak height of 175.161 mAU; peak 3 (genistein) appeared at 10.009 min, with a peak area of ​​3015.749 mAU·min and a peak height of 185.473 mAU; peak 4 (daidzein) appeared at 16.351 min, with a peak area of ​​1861.733 mAU·min and a peak height of 140.936 mAU; peak 5 (daidzein) appeared at 16.866 min, with a peak area of ​​855.950 mAU·min and a peak height of 61.16 mAU; and peak 6 (genistein) appeared at 20.953 min. The peak area was 1773.183 mAU·min, and the peak height was 120.347 mAU (Figure 10). The separation effect of the entire chromatogram was good, and all six peaks were effectively separated without obvious peak overlap.

[0075] HPLC chromatograms of genistein before and after enzymatic hydrolysis with B0-BG30: In HPLC analysis, the peak positions of the hydrolysis products of genistein were determined by comparing the elution times with those of standard genistein. Before hydrolysis, the elution time of genistein was 10.579 min, the peak area was 5748.396 mAU·min, and the peak height was 340.672 mAU. After hydrolysis, the elution time of genistein was 10.613 min, the peak area decreased to 2233.688 mAU·min, and the peak height was 131.836 mAU; simultaneously, the elution time of the hydrolysis product genistein was 21.623 min, the peak area was 2957.51 mAU·min, and the peak height was 193.938 mAU (Figure 11). These changes indicate that after hydrolysis catalyzed by β-glucosidase B0-BG30, the content of genistein was significantly reduced, while the content of its aglycone, genistein, was significantly increased. Based on these results, the conversion rate of genistein was calculated to be approximately 60%.

[0076] Therefore, in the study of B0-BG30 hydrolysis of soy isoflavones and its feasibility analysis, a glucose assay kit was first used to determine the glucose concentration of the product after β-glucosidase hydrolysis of soy isoflavone glycosides. Subsequently, high-performance liquid chromatography (HPLC) was used to simultaneously detect the same batch of samples. The purpose of this dual detection method was to evaluate the feasibility and accuracy of the glucose oxidase method in the preliminary identification of the ability of β-glucosidase to hydrolyze soy isoflavone glycosides. The results showed that the glucose yield determined by the glucose assay kit was approximately 50%, while the conversion rate determined by HPLC was approximately 60%, with a slight difference between the two. The results indicate that using the glucose assay kit for coarse screening of glucose concentration after soy isoflavone hydrolysis has a certain theoretical basis and is suitable for high-throughput screening in resource-limited laboratories or industrial applications. Further, more precise HPLC results can be combined as needed.

[0077] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0078] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A β-glucosidase gene, characterized in that, The nucleotide sequence is shown in SEQ ID No.

3.

2. The β-glucosidase expressed by the β-glucosidase gene according to claim 1, characterized in that, The amino acid sequence is shown in SEQ ID No.

4.

3. An expression cassette containing the encoding gene of claim 1, or a recombinant vector, or a genetically engineered bacterium.

4. The method for constructing the recombinant vector according to claim 3, characterized in that, Includes the following steps: (1) Design cloning primers for β-glucosidase to clone the target gene; (2) Connect the cloned product to the pSHY211 vector to construct the expression plasmid pSHY211-b0-bg30, and transform it into competent E. coliDH5α for cloning and expression.

5. The construction method as described in claim 4, characterized in that, The cloning primers for the β-glucosidase described in step (1) are: b0-bg30-F, with nucleotide sequences as shown in SEQ ID No. 1; and b0-bg30-R, with nucleotide sequences as shown in SEQ ID No.

2.

6. The use of the encoding gene of claim 1, or the enzyme of claim 2, or the expression cassette of claim 3, or the recombinant vector, or the genetically engineered bacteria in the degradation of soybean isoflavone glycosides.

7. The application as described in claim 6, characterized in that, The soybean isoflavone glycosides are: daidzein, genistein, and genistein.

8. The application of the enzyme according to claim 2 in the detection of glycoside products by glucose oxidase method.

Images