Application of OsDUF3778-1 gene in promoting crop growth

Abstract

The invention belongs to the technical field of gene engineering, and discloses an application of an OsDUF3778-1 gene in promoting crop growth. The OsDUF3778-1 gene regulates the ROS dynamic level in the rice body by directly or indirectly activating RBOH and antioxidant enzyme activity, and further participates in rice growth and development regulation. Researches find that agronomic trait indexes such as fresh weight of rice seedlings, yield of rice plants, grain density, pollen viability and the like are in a trend of increasing and then decreasing along with the increase of the relative expression level of the OsDUF3778-1 gene and the ROS accumulation level, the OsDUF3778-1 is slightly higher than the basic expression level to promote the growth and development of rice, and an inhibition effect is generated if the expression level is too high. The relative expression quantity of the OsDUF3778-1 gene is up-regulated by 50-80 times, so that the growth of crops can be obviously promoted.

Description

Application of OsDUF3778-1 gene in promoting crop growth Technical Field

[0001] This invention belongs to the field of genetic engineering technology and relates to the application of the OsDUF3778-1 gene in promoting crop growth. Background Technology

[0002] Rice (Oryza sativa L.) is an annual herbaceous plant belonging to the genus Oryza in the family Poaceae. Its growth and development are divided into two stages: vegetative growth (germination, emergence, tillering, and jointing) and reproductive growth (booting, heading, flowering, grain filling, and maturity). This crop is highly sensitive to environmental factors such as light, temperature, water, and soil nutrients. As one of the world's major food crops, rice yield is crucial to food security. Promoting rice growth and development can effectively increase key yield components such as tiller number, effective panicle number, number of grains per panicle, and thousand-grain weight, thereby optimizing rice yield and playing a vital role in ensuring food security.

[0003] Currently, there are three main approaches to promoting rice growth and development: agronomic regulation, chemical regulation, and molecular breeding regulation. Agronomic regulation involves the rational application of nitrogen, phosphorus, and potassium compound fertilizers and organic fertilizers, combined with shallow irrigation and alternating wet and dry irrigation, to meet the water requirements of rice at different growth stages. However, this approach suffers from the difficulty in controlling the precision of water and fertilizer management, easily leading to resource waste or insufficient supply, and failing to consistently guarantee growth-promoting effects. Chemical regulation involves the application of plant growth regulators, foliar fertilizers, and biostimulants to supplement micronutrients and activate metabolic pathways. However, the effectiveness of plant growth regulators is significantly affected by application concentration and timing, and their effects are unstable under different environmental conditions; some regulators may also pose a risk of residue. Molecular breeding regulation, by cultivating rice varieties with superior growth and development characteristics, optimizes crop growth from the root, and is an effective means to overcome the shortcomings of the above traditional approaches and achieve precise regulation of rice growth and development. Therefore, developing a rice growth and development promotion program based on molecular breeding has significant practical implications.

[0004] The Domain of Unknown Function (DUF) protein family is a family of proteins encoding proteins containing one or more conserved domains whose functions are not clearly annotated. These domains typically consist of 20–200 amino acids, are highly conserved evolutionarily, and are widely distributed in the genomes of prokaryotes and eukaryotes. DUF genes encoding these proteins are widespread, conserved, and functionally diverse, making them an important area for gene discovery related to plant growth and development regulation. Previous studies on the rice DUF3778-1 gene showed no significant difference in growth status between transgenic lines and wild-type (WT) lines, and the thousand-grain weight of overexpressing lines was significantly lower than that of the wild type. Based on this, existing research generally concludes that this gene does not have the function of promoting rice growth or increasing yield. However, this invention, through in-depth research, has found that the regulatory effect of the rice DUF3778-1 gene on crop growth differs from the conclusions of the previous studies; its actual function is not simply to inhibit thousand-grain weight or not to affect growth. Based on the cognitive biases in the existing research and the unknown function of the DUF3778-1 gene, this invention conducts further research to clarify the true regulatory role of this gene in rice growth and development, and then proposes the technical solution of this invention. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides the application of the OsDUF3778-1 gene in promoting crop growth. The OsDUF3778-1 gene regulates the dynamic level of ROS in rice by directly or indirectly activating RBOH and antioxidant enzyme activity, thereby participating in the regulation of rice growth and development. Research in this invention has found that agronomical traits of rice, such as seedling fresh weight, rice yield, grain density, and pollen viability, show a trend of first increasing and then decreasing with increasing relative expression levels of the OsDUF3778-1 gene and ROS accumulation levels. Slightly higher than basal expression levels of OsDUF3778-1 promote rice growth and development, while excessively high expression levels produce an inhibitory effect. Upregulating the relative expression level of the OsDUF3778-1 gene by 50-80 times can significantly promote crop growth.

[0006] On the one hand, the present invention provides the application of the OsDUF3778-1 gene in promoting crop growth, wherein the nucleotide sequence of the OsDUF3778-1 gene is shown in SEQ. ID. NO:1; the relative expression level of the OsDUF3778-1 gene is upregulated by 50 to 80 times to promote crop growth; preferably, the relative expression level of the OsDUF3778-1 gene is upregulated by 70 times to promote crop growth.

[0007] The crop in question is rice.

[0008] Furthermore, the promotion of crop growth includes at least one of increasing the fresh weight of crop seedlings, increasing the yield per crop plant, increasing the thousand-grain weight, and increasing the grain density.

[0009] Specifically, this invention uses rice OsDUF3778-1 overexpression lines as experimental materials. Agronomical trait observations revealed that the seedling fresh weight of the OsDUF3778-1 overexpression transgenic line OE9 was significantly higher than that of the control wild-type rice (P < 0.01). The seedling fresh weight of the OsDUF3778-1 overexpression transgenic lines OE1 and OE4 did not show a significant difference from the control wild-type rice. The OsDUF3778-1 gene expression levels in the OE1, OE4, and OE9 overexpression transgenic lines were upregulated by approximately 170-fold, 160-fold, and 70-fold, respectively. This indicates that an upregulation of OsDUF3778-1 gene expression by 50-80 times significantly promotes rice growth and development; however, excessively high expression levels do not promote plant growth and development.

[0010] Specifically, this invention uses OsDUF3778-1 overexpression transgenic rice lines as experimental materials. Agronomical trait observations revealed that the yield per plant of the OsDUF3778-1 overexpression transgenic line OE9 was significantly higher than that of wild-type rice (P < 0.05), and the thousand-grain weight was significantly increased (P < 0.01). Although the thousand-grain weight of the OsDUF3778-1 overexpression transgenic lines OE1 and OE4 was also increased, the increase was less significant than that of OE9. The grain density of the OsDUF3778-1 overexpression transgenic line OE9 was significantly higher than that of wild-type rice (P < 0.01), while the grain density of the OsDUF3778-1 overexpression transgenic line OE1 was significantly lower (P < 0.01). The number of grains and the number of full grains per plant were increased in the OsDUF3778-1 overexpression transgenic line OE9, while the number of grains and the number of full grains per plant were significantly lower in the OsDUF3778-1 overexpression transgenic line OE1 than in wild-type rice (P < 0.01).

[0011] Furthermore, upregulating the relative expression level of the OsDUF3778-1 gene by 50 to 80 times can enhance crop pollen viability and promote crop growth.

[0012] Furthermore, the OsDUF3778-1 gene regulates the dynamic level of ROS in crops, thereby promoting crop growth.

[0013] Furthermore, the OsDUF3778-1 gene activates RBOH and antioxidant enzyme activity, regulating the dynamic level of ROS in crops. The OsDUF3778-1 gene promotes the upregulation of LOC_Os01g02800 and LOC_Os01g02810 genes, regulating the production and accumulation of ROS. The OsDUF3778-1 gene promotes the upregulation of LOC_Os07g02620 and LOC_Os10g04570 genes, leading to increased ROS levels. The OsDUF3778-1 gene promotes the upregulation of LOC_Os11g45180 and LOC_Os11g44960 genes, promoting the accumulation of ROS, primarily H2O2. The OsDUF3778-1 gene promotes the downregulation of LOC_Os10g38600, LOC_Os05g34150 and LOC_Os01g72140 genes, thereby mediating ROS clearance.

[0014] On the other hand, the present invention claims protection for a method for cultivating high-growth-performance rice, which involves overexpressing the OsDUF3778-1 gene in rice, screening overexpressing plants with a relative upregulation of the OsDUF3778-1 gene by 50 to 80 times, and obtaining the high-growth-performance rice.

[0015] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages: (1) The present invention has found through research that the agronomic traits of rice, such as seedling fresh weight, rice yield, grain density, and pollen viability, show a trend of first increasing and then decreasing with the increase of the relative expression level of the OsDUF3778-1 gene and the ROS accumulation level. OsDUF3778-1 slightly higher than the basal expression level promotes rice growth and development, while excessively high expression levels produce an inhibitory effect. Upregulating the relative expression level of the OsDUF3778-1 gene by 50 to 80 times can significantly promote crop growth.

[0016] (2) The OsDUF3778-1 gene of this invention regulates the dynamic level of ROS in rice by directly or indirectly activating RBOH and antioxidant enzyme activity, thereby participating in the regulation of rice growth and development. The OsDUF3778-1 gene promotes the upregulation of LOC_Os01g02800 and LOC_Os01g02810 genes, regulating the production and accumulation of ROS. The OsDUF3778-1 gene promotes the upregulation of LOC_Os07g02620 and LOC_Os10g04570 genes, leading to an increase in ROS levels. The OsDUF3778-1 gene promotes the upregulation of LOC_Os11g45180 and LOC_Os11g44960 genes, promoting the accumulation of ROS, mainly H2O2. The OsDUF3778-1 gene promotes the downregulation of LOC_Os10g38600, LOC_Os05g34150 and LOC_Os01g72140 genes, thereby mediating ROS clearance. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 shows the structure of the OsDUF3778-1 gene.

[0019] Figure 2 shows the structure of the protein encoded by the OsDUF3778-1 gene.

[0020] Figure 3 shows the enzyme digestion verification results of the expression vector pUN-1301-OsDUF3778-1-3×Flag. pUbi represents the ubiquitin promoter type, Promoter represents the specific promoter region, Flag represents the Flag tag, and Nos represents the carmine synthase terminator.

[0021] Figure 4 shows the phenotypic diagram of the growth status of rice seedlings overexpressing OsDUF3778-1 and wild-type rice, and the statistical diagram of the fresh weight of rice seedlings. In Figure 4, A is the phenotypic diagram of the growth status of rice seedlings overexpressing OsDUF3778-1 and wild-type rice; in Figure 4, B is the statistical diagram of the fresh weight of rice seedlings overexpressing OsDUF3778-1 and wild-type rice.

[0022] Figure 5 shows the relative expression levels of the OsDUF3778-1 gene in OsDUF3778-1 overexpressing transgenic lines and wild-type rice.

[0023] Figure 6 shows the statistical results of single-plant yield and panicle length of OsDUF3778-1 overexpressing transgenic lines and wild-type rice. In Figure 6, A shows the statistical results of single-plant yield of OsDUF3778-1 overexpressing transgenic lines and wild-type rice; in Figure 6, B shows the statistical results of panicle length of OsDUF3778-1 overexpressing transgenic lines and wild-type rice.

[0024] Figure 7 shows the statistical results of the thousand-grain weight of OsDUF3778-1 overexpressing transgenic lines and wild-type rice.

[0025] Figure 8 shows the statistical results of grain density in OsDUF3778-1 overexpressing transgenic lines and wild-type rice.

[0026] Figure 9 shows the statistical results of the number of grains per plant and the number of full grains per plant in OsDUF3778-1 overexpression transgenic lines and wild-type rice. In Figure 9, A shows the statistical results of the number of grains per plant in OsDUF3778-1 overexpression transgenic lines and wild-type rice; B shows the statistical results of the number of full grains per plant in OsDUF3778-1 overexpression transgenic lines and wild-type rice.

[0027] Figure 10 shows the statistical results of pollen viability rates in OsDUF3778-1 overexpressing transgenic lines and wild-type rice.

[0028] Figure 11 shows the ROS content analysis results in the OsDUF3778-1 overexpression transgenic line. In Figure 11, A represents the relative expression level of the OsNOX2 gene in the OsDUF3778-1 overexpression transgenic line; B represents the NBT staining results of the OsDUF3778-1 overexpression transgenic line; and C represents the DAB staining results of the OsDUF3778-1 overexpression transgenic line.

[0029] Figure 12 shows the transcriptome sequencing results of OsDUF3778-1 overexpressing transgenic plants and wild-type rice. In Figure 12, A is a bubble chart of KEGG enrichment analysis of OsDUF3778-1 overexpressing transgenic plants and wild-type rice; B is a bar chart of GO enrichment analysis of OsDUF3778-1 overexpressing transgenic plants and wild-type rice.

[0030] Figure 13 shows the results of differential gene expression analysis between OsDUF3778-1 overexpressing transgenic plants and wild-type rice. In Figure 13, A represents the relative expression levels of differential genes between OsDUF3778-1 overexpressing transgenic plants and wild-type rice; B in Figure 13 describes the differential genes. Detailed Implementation

[0031] The technical solution of the present invention will be described below with reference to embodiments. However, the present invention is not limited to the following embodiments. Unless otherwise specified, the experimental methods and detection methods described in each embodiment are conventional methods; unless otherwise specified, the reagents and materials can be purchased commercially. Unless otherwise specified, the percentages in the following embodiments refer to mass percentages.

[0032] Example 1 This example provides the creation of overexpression transgenic materials.

[0033] 1. Cloning of the rice DUF3778-1 gene: Using the rice variety Nipponbare (Oryza sativa L. spp. japonica) as background material, RNA was extracted from leaf tissues of Nipponbare rice at the heading stage using the Trizol method. RNA was then processed using a kit (EasyScript). ® First-Strand cDNA Synthesis SuperMix was used to reverse transcribe RNA into cDNA. Based on the cDNA sequence of the OsDUF3778-1 gene, specific primers OsDUF3778-1-F(ATGCCGCGCAAAAGAACGAC) / R(TGCAAGAAATGATAACAACAA) were designed. PCR amplification was performed using the cDNA as a template to obtain the target gene OsDUF3778-1 (as shown in SEQ. ID. NO:1).

[0034] Bioinformatics methods were used to analyze the structure of the OsDUF3778-1 gene and its encoded protein, as shown in Figures 1 and 2. The OsDUF3778-1 gene structure contains one UTR region and three exon regions. The full length of the gene is 2348 bp, of which the CDS coding region is 1224 bp in length. The encoded product of the OsDUF3778-1 gene is a protein containing 407 amino acid residues. SMART online analysis showed that the protein contains a typical conserved DUF3778 domain.

[0035] 2. Creation of Overexpression Transgenic Material: Combining the pUN-1301 expression vector and the CDS information of the OsDUF3778-1 gene, upstream primers pUN-1301-OsDUF3778-1-3×Flag-F(CGGGATCCATGCCGCGCAAAAGAAC) / R(GGGGTACCTCATTTGTCGTCATCGTCTTTGTAGTCCATCCTTGCAAGAAATTGATAAC) (containing BamHI and KpnI restriction sites, respectively) were designed. The pMD-19T vector containing the target gene was used as a template to amplify the fragment, constructing the vector pUN-1301-OsDUF3778-1-3×Flag. The expression vector pUN-1301-OsDUF3778-1-3×Flag was transformed into Agrobacterium tumefaciens EHA105 via electroporation, followed by colony PCR verification. Plasmids were extracted from positive transformed E. coli samples for restriction enzyme digestion verification (Figure 3). Subsequently, rice callus was transformed using the EHA105-mediated genetic transformation method. After induction culture, transgenic lines overexpressing pUN-1301-OsDUF3778-1-3×Flag were obtained, including transgenic lines OE1, OE4, and OE9.

[0036] Example 2 This example analyzes the OsDUF3778-1 overexpression transgenic material.

[0037] 1. Growth and development of overexpression transgenic materials: Phenotypic observation was conducted on the seedlings of OsDUF3778-1 overexpression transgenic plants, and their fresh weight was counted. The results are shown in Figure 4. Real-time fluorescence quantitative PCR was performed on the OsDUF3778-1 overexpression transgenic plants, and the results are shown in Figure 5.

[0038] As shown in Figure 4, the fresh weight of seedlings of the OsDUF3778-1 overexpressing transgenic line OE9 was significantly higher than that of the control wild-type rice (P < 0.01), while the fresh weight of seedlings of the OsDUF3778-1 overexpressing transgenic lines OE1 and OE4 did not differ significantly from that of the control wild-type rice. Figure 5 shows that the expression levels of the OsDUF3778-1 gene in the OsDUF3778-1 overexpressing transgenic lines OE1, OE4, and OE9 were upregulated by approximately 170-fold, 160-fold, and 70-fold, respectively. This indicates that an upregulation of the OsDUF3778-1 gene expression level of approximately 70-fold significantly promotes rice growth and development; however, excessively high expression levels do not promote plant growth and development.

[0039] 2. Agronomic traits of the overexpressing transgenic materials were statistically analyzed for single-plant yield, panicle length, thousand-grain weight, grain density, number of grains per plant, and number of full grains per plant after grain filling. The results are shown in Figures 6-8. Figures 6 and 7 show that the single-plant yield of the OsDUF3778-1 overexpressing transgenic line OE9 was significantly higher than that of wild-type rice (P < 0.05), and the thousand-grain weight was significantly increased (P < 0.01). Although the thousand-grain weight of the OsDUF3778-1 overexpressing transgenic lines OE1 and OE4 was also increased, the increase was less significant than that of OE9. Figure 8 shows that the grain density of the OsDUF3778-1 overexpressing transgenic line OE9 was significantly higher than that of wild-type rice (P < 0.01), while the grain density of the OsDUF3778-1 overexpressing transgenic line OE1 was significantly lower (P < 0.01). As shown in Figure 9, the number of grains and the number of full grains per plant were increased in the OsDUF3778-1 overexpression transgenic line OE9, while the number of grains and the number of full grains per plant were significantly lower in the OsDUF3778-1 overexpression transgenic line OE1 than in wild-type rice (P < 0.01). This indicates that the upregulation of OsDUF3778-1 gene expression exhibits a promoting effect at low concentrations (slightly higher than the basal expression level) and an inhibiting effect at high concentrations (significantly higher than the basal expression level). Excessively high upregulation levels can also negatively impact the agronomic traits of the plant.

[0040] 3. Pollen viability of overexpressing transgenic materials: First, gently pick up rice anthers with tweezers and place them on a clean glass slide. Then, gently press the anthers with a dissecting needle to release pollen grains. Next, add 1 drop of I2-KI solution to cover the pollen and let it stand at room temperature for 2-3 minutes. After that, cover with a coverslip and observe under a 10×40x optical microscope. Viable pollen grains are round, plump, and dark in color (sufficient starch), low-viability pollen grains are light brown or partially stained (partial starch degradation), and non-viable pollen grains are colorless and wrinkled (no starch accumulation). Then, randomly select 5 fields of view and count the number of stained positive (viable) and negative (non-viable) pollen grains respectively. Finally, calculate the pollen viability rate according to the formula: viability rate (%) = (number of dark pollen grains / total number of pollen grains) × 100%. The statistical results of pollen viability rate are shown in Figure 10.

[0041] The stable formation of yield-related traits in rice plants depends on efficient pollination and fertilization during the reproductive development stage. Pollen, as a key carrier of male reproduction, directly determines pollination success rate and subsequent normal grain development. As shown in Figure 10, compared with WT, the pollen viability of OsDUF3778-1 overexpressing transgenic lines OE1 and OE4 was significantly reduced, reaching a highly significant difference (P < 0.01). Although there was no significant difference between OE9 and WT, the overall pollen survival rate was higher than that of WT. It is speculated that the OsDUF3778-1 gene may affect agronomic traits by regulating rice pollen viability.

[0042] Example 3: This example analyzes the ROS content of the OsDUF3778-1 overexpression transgenic line.

[0043] 1. Regulatory Relationship between OsDUF3778-1 and Rice OsNOX2: The expression level of the OsDUF3778-1 gene in the Osnox2 mutant line was examined. It was found that the expression level of OsDUF3778-1 in the Osnox2 mutant was significantly upregulated, with an increase of more than 50-fold. The relative expression level of the OsNOX2 gene in the OsDUF3778-1 overexpression transgenic plants was detected, and the results are shown in Figure 11. As shown in Figure 11A, the expression level of the OsNOX2 gene in the OsDUF3778-1 overexpression transgenic plants did not change significantly. This indicates that there may be an upstream and downstream regulatory relationship between OsNOX2 and OsDUF3778-1. Given that OsNOX2 is an isoform of NOX (NADPH oxidase), its main function is to produce and regulate ROS in various biological processes. Based on this, it is further speculated that OsDUF3778-1 may be located downstream of OsNOX2 and participate in ROS-mediated signal transduction or physiological function regulation.

[0044] 2. DAB and NBT Staining: DAB reacts with H2O2 under the catalysis of peroxidases (such as HRP) to form a brown precipitate; H2O2, as a key member of ROS, is directly related to cellular oxidative stress. NBT, on the other hand, can be reduced to a blue-purple formazan precipitate under the catalysis of alkaline phosphatase (AP). AP activity is often associated with cell differentiation and signaling pathways, while ROS can regulate these pathways through redox signaling.

[0045] Prepare DAB staining solution (dissolve DAB in deionized water under dark conditions, adjust pH to 3.8, and then bring to volume) and NBT staining solution (dissolve NBT in phosphate buffer under dark conditions, and then bring to volume). Cut off the second flag leaf of OsDUF377-1 transgenic lines (OE1, OE4, OE9) and wild-type rice (leaf sheaths were retained during sampling) that have been growing for about 1 month, and place them into test tubes containing 10 mL of DAB / NBT staining solution, ensuring that the leaf sheaths are immersed in the staining solution. Stain in the dark at room temperature for more than 12 hours, and then expose to strong light for 6-10 hours until brown / blue spots appear. Decolorize with anhydrous ethanol and photograph (Figure 11).

[0046] As shown in Figure 11B and Figure 11C, the DAB and NBT staining in the OsDUF3778-1 transgenic lines OE1, OE4 and OE9 were all deepened, indicating that OsDUF3778-1 overexpression can promote the accumulation of ROS in plants, and the amount of accumulation is positively correlated with the gene expression level.

[0047] Example 4: Transcriptome sequencing analysis was performed on the OsDUF3778-1 overexpression transgenic line OE1 and wild-type rice.

[0048] The KEGG and GO enrichment analysis results are shown in Figure 12. Figure 12 shows that the expression levels of 10 genes were significantly upregulated and the expression levels of 3 genes were decreased in the overexpression lines. Further analysis of the expression levels of these 13 genes in rice tissues was conducted, and the results are shown in Figure 13.

[0049] As shown in Figure 13, the 10 upregulated genes are LOC_Os04g24510, LOC_Os04g30160, LOC_Os01g02800, LOC_Os01g02810, LOC_Os07g02620, LOC_Os10g04570, LOC_Os04g25490, LOC_Os10g09990, LOC_Os11g45180, and LOC_Os11g44960. The 3 downregulated genes are LOC_Os10g38600, LOC_Os05g34150, and LOC_Os01g72140.

[0050] Among the upregulated genes, LOC_Os04g24510 and LOC_Os04g30160 belong to the OsWAK gene family. In rice, WAK members dynamically regulate plant cell growth through changes in their phosphorylation state and maintain ROS metabolic balance by regulating the activity of antioxidant enzymes in cells, thereby controlling seed vigor and anti-aging ability. Specifically, WAK1 can interact with BAK1, leading to a downstream MAPK cascade reaction or interacting with the cytoplasmic receptor kinase BLK1, thereby activating the activity of NADPH oxidase RBOH and promoting ROS bursts. Excessive ROS accumulation leads to decreased pollen viability, while appropriate amounts of ROS can promote pollen viability, thus affecting rice growth and development.

[0051] Genes LOC_Os01g02800 and LOC_Os01g02810 are receptor-like kinases (RLKs), with DUF26 as their structural core. RLKs act as signaling hubs, activating downstream pathways or directly acting on RBOHD through kinase activity, while simultaneously inhibiting the activity of enzymes related to ROS clearance, such as peroxidase (POX) and ascorbate peroxidase (APX), thereby regulating the production and accumulation of ROS.

[0052] Genes LOC_Os07g02620 and LOC_Os10g04570 encode an NLR (Nucleotide-Binding Leucine-Rich Repeat) protein with an NB-ARC (NB-ARC domain-containing protein) domain, which induces significant and sustained cytoplasmic Ca²⁺. + Influx, leading to increased ROS levels and decreased cytoplasmic Ca²⁺ levels. + Increased concentration is itself a prerequisite for activating RBOH to produce ROS.

[0053] Genes LOC_Os11g45180 and LOC_Os11g44960 encode NBS-LRR-like proteins (NBS-LRR disease resistance proteins). Related literature reports that in rice, the NBS-LRR proteins OsBRW1 and OsSRFP1 directly interact, promoting the accumulation of ROS, primarily H2O2, and participating in plant resistance to external pathogenic stress.

[0054] The three downregulated genes, LOC_Os10g38600, LOC_Os05g34150, and LOC_Os01g72140, all belong to the GST (glutathione S-transferase) gene family. Members of this gene family possess glutathione peroxidase activity, which mediates ROS scavenging and regulates ROS homeostasis.

[0055] In summary, the OsDUF3778-1 gene mainly regulates the dynamic level of ROS in rice by directly or indirectly activating RBOH and antioxidant enzyme activity, thereby participating in the regulation of rice growth and development. Slightly higher than basal expression levels of OsDUF3778-1 promote rice growth and development, increase pollen viability and yield, while excessively high expression levels produce an inhibitory effect.

[0056] As described above, the basic principles, main features, and advantages of the present invention have been well described. The above embodiments and specifications are merely descriptions of preferred embodiments of the present invention, and the present invention is not limited to the above embodiments. Various changes and improvements made to the technical solutions of the present invention by those skilled in the art without departing from the spirit and scope of the present invention should fall within the protection scope defined by the present invention.

Claims

1. The application of the OsDUF3778-1 gene in promoting crop growth, characterized by, The nucleotide sequence of the OsDUF3778-1 gene is shown in SEQ. ID. NO:1; the relative expression level of the OsDUF3778-1 gene is upregulated by 50 to 80 times to promote crop growth; the crop is rice.

2. The application according to claim 1, characterized in that, The promotion of crop growth includes at least one of increasing the fresh weight of crop seedlings, increasing the yield per crop plant, increasing the thousand-grain weight, and increasing the grain density.

3. The application according to claim 1, characterized in that, Upregulation of the relative expression level of the OsDUF3778-1 gene by 50-80 times can improve crop pollen viability and promote crop growth.

4. The application according to claim 1, characterized in that, The OsDUF3778-1 gene regulates the dynamic level of ROS in crops, thereby promoting crop growth.

5. The application according to claim 4, characterized in that, The OsDUF3778-1 gene activates RBOH and antioxidant enzyme activity, thereby regulating the dynamic level of ROS in crops.

6. The application according to claim 4, characterized in that, The OsDUF3778-1 gene promotes the upregulation of LOC_Os01g02800 and LOC_Os01g02810 genes, thereby regulating the production and accumulation of ROS.

7. The application according to claim 4, characterized in that, The OsDUF3778-1 gene promotes the upregulation of LOC_Os07g02620 and LOC_Os10g04570 genes, leading to an increase in ROS levels.

8. The application according to claim 4, characterized in that, The OsDUF3778-1 gene promotes the upregulation of LOC_Os11g45180 and LOC_Os11g44960 genes, thereby promoting the accumulation of ROS, mainly H2O2.

9. The application according to claim 4, characterized in that, The OsDUF3778-1 gene promotes the downregulation of LOC_Os10g38600, LOC_Os05g34150 and LOC_Os01g72140 genes, thereby mediating ROS clearance.

10. A method for cultivating high-growth-performance rice, characterized in that, The OsDUF3778-1 gene was overexpressed in rice, and overexpressing plants with a relative upregulation of OsDUF3778-1 gene expression level of 50-80 times were screened to obtain the high-growth-performance rice.

Images