Identification method and application of pichia kudriavzevii with high tolerance, malic acid reduction and ethanol production
By identifying and applying the highly resistant, malic acid-reducing, and ethanol-producing Pichia pastoris strain CGMCC No. 22929, the problem of high malic acid content in fruit wine was solved, resulting in improved taste and increased ethanol production, demonstrating significant economic benefits and environmental friendliness.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SHIJIAZHUANG UNIVERSITY
- Filing Date
- 2026-02-04
- Publication Date
- 2026-05-01
AI Technical Summary
Existing technologies for reducing malic acid content in fruit wines suffer from problems such as insignificant effects, high costs, potential impact on wine stability and sensory quality, and severe pollution from the high acidity of fruit wine production waste.
The highly tolerant, malic acid-reducing, and ethanol-producing Pichia pastoris strain CGMCC No. 22929 was used to determine its growth capacity under high acid, high ethanol, and high osmotic pressure conditions through morphological observation, molecular biological identification, tolerance testing, and malic acid degradation capacity determination. Its acid-reducing and ethanol-producing capabilities were determined by high performance liquid chromatography and potassium dichromate spectrophotometry.
It achieves effective degradation of malic acid under multiple pressures, improves the taste of fruit wine, and increases ethanol production, resulting in significant economic benefits and environmental friendliness.
Smart Images

Figure CN121950992A_ABST
Abstract
Description
A method for identifying and applying a highly resistant, malic acid-lowering, and ethanol-producing Pichia pastoris. Technical Field
[0001] This invention belongs to the field of Pichia azwieldii identification, specifically a method and application for identifying highly resistant, malic acid-lowering, and ethanol-producing Pichia azwieldii. Background Technology
[0002] L-Malic acid, also known as L-2-hydroxysuccinic acid, is mainly found in fruits such as apples, grapes, and unripe hawthorns, and is currently widely used in the food, cosmetics, and medical fields. However, fruit wines made from fruits with high acid content tend to have a sour and astringent taste and lower quality. The phenomenon of excessively high acidity in fruit wines is a significant factor restricting their development. Fruit wine is a fermented beverage made by fermenting fresh fruit or fruit juice, with an alcohol content between 8% vol and 12% vol. In recent years, low-alcohol fruit wines (alcohol content < 7% vol) have become increasingly popular among young consumers. These wines not only contain rich bioactive components but also reduce the harmful effects of alcohol. Malic acid can account for 70% to 90% of the total acidity in fruit wines. A high malic acid content is the main reason for the rough taste and strong bitterness of fruit wines. Reducing the malic acid content in fruit wines can improve their taste and help expand the market size. In addition, the waste emitted by L-malic acid production enterprises has too high an acidity, causing serious environmental pollution. It is necessary to reduce the acidity to meet the national emission standards. Therefore, the degradation of L-malic acid in actual production is of great significance.
[0003] Currently, common methods for reducing acidity in fruit wines include chemical, physical, and biological methods. Physical methods mainly include low-temperature freezing and dilution. Using low-temperature crystallization to selectively remove tartaric acid effectively preserves the original flavor of the wine without additive residue. However, this technology is not very effective at regulating malic acid, exhibiting a single target. Dilution methods are effective in reducing acidity, using purified water for dilution. They are convenient and cost-effective, but high-sugar systems can easily lead to increased turbidity and abnormal viscosity, severely affecting product clarity and fluidity. Chemical methods are based on acid-base neutralization, using carbonates (calcium carbonate, potassium bicarbonate) or tartrates for acidity adjustment. They offer rapid response and precise control, but have two significant drawbacks: ① The introduction of metal ions reduces the stability of the wine, potentially inducing turbidity and loss of luster; ② The reaction of chemical reagents with organic acids alters the wine's color and produces off-flavors, directly affecting sensory quality. Existing physical and chemical methods suffer from economic drawbacks such as high energy consumption and large consumption of auxiliary materials. Furthermore, they lack effective means of controlling key flavor organic acids such as malic acid, making it difficult to achieve precise optimization of the wine's flavor. Summary of the Invention
[0004] In order to overcome the shortcomings of the prior art, at least one technical problem raised in the background art is solved.
[0005] The technical solution adopted by this invention to solve its technical problem is as follows: A method for identifying a highly resistant, malic acid-lowering, and ethanol-producing *Pichia pastoris*, comprising the following steps: S1, strain activation and morphological observation: The yeast strain to be tested is streaked onto malt extract agar medium, and after cultivation, the colony morphology is observed, and methylene blue staining is performed for cell morphology observation under an optical microscope; S2, molecular biological identification: Genomic DNA of the yeast strain to be tested is extracted, and ITS region amplification and sequencing are performed using primers ITS1 and ITS4. The sequencing results are compared with a database to determine the species; S3, tolerance... Identification: The strain's tolerance to temperature, ethanol, acid, and osmotic pressure was assessed by measuring its growth in YPD liquid medium at different temperatures, concentrations of ethanol, pH combinations with malic acid, and concentrations of sodium chloride. S4, Malic acid degradation capacity identification: The strain was inoculated into liquid medium containing malic acid and cultured under specified conditions. Samples were taken periodically to determine the malic acid content in the fermentation broth, and the acid reduction rate was calculated. S5, Ethanol production capacity identification: The strain was inoculated into liquid medium containing malic acid and cultured under specified conditions. Samples were taken periodically, and the ethanol content in the fermentation broth was determined using potassium dichromate spectrophotometry.
[0006] As a further technical solution of the present invention: the temperature tolerance identification described in S3 is specifically as follows: the strain is inoculated into YPD liquid culture medium at an inoculation amount of 2%, and after being statically cultured at 20℃, 25℃, 30℃, 35℃, 40℃, 45℃, 50℃ and 55℃ for 12 h respectively, the absorbance OD value at a wavelength of 560 nm is measured, and its maximum tolerance temperature is determined according to the growth trend.
[0007] As a further technical solution of the present invention: the ethanol tolerance identification described in S3 is specifically as follows: the strain is inoculated at a 2% inoculation amount into YPD liquid culture medium containing ethanol concentrations of 60 g / L, 70 g / L, 80 g / L, 90 g / L, 100 g / L, 110 g / L, 120 g / L, and 130 g / L, and cultured at 30°C for 12 h. The absorbance OD value at a wavelength of 560 nm is measured, and the highest ethanol tolerance concentration is determined according to the growth trend.
[0008] As a further technical solution of the present invention: the acid tolerance identification described in S3 is specifically as follows: the strain is inoculated at a 2% inoculum into YPD liquid medium containing a series of concentrations of malic acid and pH values of 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, and 7.0, and cultured at 30°C for 12 h. The absorbance OD value at a wavelength of 560 nm is measured, and the optimal growth pH and acid tolerance range are determined according to the growth trend.
[0009] As a further technical solution of the present invention: the osmotic pressure tolerance identification described in S3 is specifically as follows: the strain is inoculated at a 2% inoculation amount into YPD liquid culture medium containing sodium chloride concentrations of 8.5 g / L, 11.7 g / L, 23.4 g / L, 35.1 g / L, 46.8 g / L and 58.5 g / L, and cultured at 30°C for 12 h. The absorbance OD value at a wavelength of 560 nm is measured, and its maximum tolerant sodium chloride concentration is determined according to the growth trend.
[0010] As a further technical solution of the present invention: the identification of the malic acid degradation ability in S4 includes aerobic culture and anaerobic culture, the determination of the malic acid content is carried out by high performance liquid chromatography, and the acid reduction rate is calculated according to the formula (blank malic acid content - sample malic acid content) / blank malic acid content × 100%.
[0011] As a further technical solution of the present invention: the identification of the ethanol production capacity described in S5 is performed by the potassium dichromate oxidation colorimetric method, which includes plotting an ethanol concentration standard curve and substituting the absorbance measured by the sample into the standard curve to calculate the ethanol concentration.
[0012] As a further technical solution of the present invention: the strain of the highly resistant, malic acid-reducing and ethanol-producing Pichia kudrica is CGMCC No. 22929.
[0013] Application of a Kudria zwibbiasis strain CGMCC No. 22929 in the degradation of malic acid.
[0014] Application of a Kudria zwibbiasis strain CGMCC No. 22929 in ethanol production.
[0015] The beneficial effects of this invention are as follows: This invention uses a dominant yeast strain huJ03 isolated from the natural fermentation process of Asahi, identified as *Pichia kudriavzevii* (P. kudriavzevii), which was deposited on July 19, 2021, at the China General Microbiological Culture Collection Center (address: Beijing, China), with the deposit number CGMCC No. 22929, as the research object. The tolerance of *P. kudriavzevii* CGMCC 22929 to cell growth under anaerobic, high-temperature, high-acid, ethanol, and NaCl conditions was investigated. Its ability to reduce malic acid and produce ethanol was determined by measuring the pH, total acid content, and ethanol content after cultivation in yeast extract peptone dextrose medium (YPD) containing 10 g / L malic acid. The results showed that inoculating *P. kudriavzevii* at a 2% inoculum with 10 g / L malic acid, 90 g / L (11.4%) ethanol, and 46.8 g / L... NaCl In a highly tolerant fermentation liquid medium, after static culture at 40℃ for 10 days, the malic acid reduction rate was 1.28%–35.2%, the total reduction rate was 19.85%–59.55%, and the ethanol content increased by 4.42% vol. The *Pichia pastoris* CGMCC No. 22929 of this invention is a high-performance malic acid degrading strain that can also increase the yield of ethanol in the fermentation broth. It can be applied to food fermentation processes where the substrate malic acid is too high and fermentation is difficult to carry out normally, offering considerable economic benefits. In summary, *P. Kudriavzevii* CGMCC No. 22929 not only has good acid, ethanol, NaCl, and high-temperature resistance, but also has the ability to reduce L-malic acid in the fermentation system, regulate the acidity of the brewing microenvironment, and produce ethanol under multiple pressure stresses. Attached Figure Description
[0016] The invention will now be further described with reference to the accompanying drawings.
[0017] Figure 1 shows the colony morphology on malt extract agar medium; Figure 2 shows the microscopic examination after methylene blue staining; Figure 3 shows the ITS sequencing sequence of P. kudriavzevii CGMCC 22929; Figure 4 shows the homology comparison results of P. kudriavzevii CGMCC 22929; Figure 5 shows the temperature tolerance test of P. kudriavzevii CGMCC 22929; Figure 6 shows the ethanol tolerance test of P. kudriavzevii CGMCC 22929; Figure 7 shows the acid tolerance test of P. kudriavzevii CGMCC 22929; Figure 8 shows the NaCl tolerance test of P. kudriavzevii CGMCC 22929; Figure 9 is the standard curve of ethanol concentration determined by spectrophotometry. Detailed Implementation
[0018] To make the technical means, creative features, objectives and effects of this invention easier to understand, the invention will be further described below in conjunction with specific embodiments.
[0019] Example 1 An identification method for a highly resistant, malic acid-lowering, and ethanol-producing Pichia kudriavzevii according to this embodiment of the invention includes the following steps: S1 Morphological observation: A suspension of P. kudriavzevii CGMCC22929, activated and once inoculated in YPD liquid medium at 30°C for 12 h, is streaked onto malt extract agar medium and cultured at 30°C for 72 h. The colony morphology is observed, and methylene blue staining is performed. Cell morphology is observed under an optical microscope.
[0020] S2 Molecular identification: 2 mL of P. kudriavzevii CGMCC22929 bacterial suspension, activated and once transferred once in YPD liquid medium at 30℃ for 12 h, was sent to Shanghai Paisennong Biotechnology Co., Ltd. for ITS amplification and sequencing identification. The primer sequences were (ITS1: 5'TCCGTAGGTGAACCTGCGG'3, ITS4: 5'TCCTCCGCTTATTGATATGC'3).
[0021] Take 10 mL of the fermented culture medium, centrifuge at 11,000 rpm for 10 min, discard the supernatant, and collect the precipitate; resuspend it in 2 mL of sterile water, and extract DNA using a yeast genome extraction kit (DP307). Dissolve the DNA in 50 μL of LTE solution. Detect the double-stranded DNA concentration and dilute the DNA concentration to 40-100 ng / μL: the PCR reaction system (50 μL system) is shown in Table 1.
[0022] Table 1 PCR reaction system S3 Tolerance Experiment (1) Temperature Tolerance P. kudriavzevii CGMCC 22929 was inoculated into YPD liquid medium at a 2% inoculum, and then statically cultured for 12 h at temperatures of 20℃, 25℃, 30℃, 35℃, 40℃, 45℃, 50℃, and 55℃, respectively. The absorbance (OD) value at a wavelength of 560 nm was measured. The growth trend of P. kudriavzevii CGMCC 22929 was plotted with different temperatures on the x-axis and the measured OD value on the y-axis to determine the highest temperature that P. kudriavzevii CGMCC 22929 could tolerate.
[0023] (2) Tolerance to Ethanol: P. kudriavzevii CGMCC 22929 was inoculated at a rate of 2% into YPD liquid medium containing ethanol at concentrations of 60 g / L (7.6% vol), 70 g / L (8.7% vol), 80 g / L (10.1% vol), 90 g / L (11.4% vol), 100 g / L (12.7% vol), 110 g / L (13.94% vol), 120 g / L (15.2% vol), and 130 g / L (16.47% vol). The medium was incubated at 30°C for 12 h. The absorbance (OD) value at 560 nm was measured. A growth trend graph of P. kudriavzevii CGMCC 22929 was plotted with different ethanol concentrations as the x-axis and the OD value as the y-axis. Determine the maximum ethanol tolerance level of P. kudriavzevii CGMCC 22929.
[0024] (3) Acid tolerance: P. kudriavzevii CGMCC 22929 was inoculated at a rate of 2% into YPD liquid culture medium containing malic acid at concentrations of 14 g / L, 13 g / L, 12 g / L, 10 g / L, 8 g / L, 6 g / L, 5 g / L, 4 g / L, 3 g / L, 2 g / L, and 1 g / L, respectively. The pH was adjusted to 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, and 7.0, respectively. The medium was cultured at 30℃ for 12 h, and the absorbance (OD) value at a wavelength of 560 nm was measured. A growth trend graph of P. kudriavzevii CGMCC 22929 was plotted with different mass concentrations of malic acid as the x-axis and OD value as the y-axis to determine the maximum amount of malic acid that P. kudriavzevii CGMCC 22929 could tolerate.
[0025] (4) Tolerance to NaCl: P. kudriavzevii CGMCC 22929 was inoculated at a rate of 2% into YPD liquid medium containing NaCl concentrations of 0.85% (8.5 g / L), 1.17% (11.7 g / L), 2.34% (23.4 g / L), 3.51% (35.1 g / L), 4.68% (46.8 g / L), and 5.85% (58.5 g / L), respectively. The medium was incubated at 30°C for 12 h, and the absorbance (OD) value at 560 nm was measured. A growth trend graph of P. kudriavzevii CGMCC 22929 was plotted with different NaCl concentrations on the x-axis and OD values on the y-axis to determine the maximum NaCl tolerance of P. kudriavzevii CGMCC 22929.
[0026] Comparative analysis of S4's ability to degrade malic acid: P. kudriavzevii CGMCC 22929 was inoculated into YPD-malic acid liquid medium and cultured at 30 ℃ for 10 days. One group was cultured aerobically and the other two groups were cultured anaerobically. Each strain was performed in duplicate. Two mL of fermentation broth was collected from each of the following days: day 1 (0 h), day 2 (24 h), day 3 (48 h), day 4 (72 h), day 5 (96 h), day 6 (120 h), day 7 (144 h), day 8 (168 h), day 9 (192 h), day 10 (216 h), and day 11 (240 h). The samples were mixed thoroughly before sampling and filtered through a 0.22 μm microporous membrane. The filtrate was then used as a blank. The malic acid content in the fermentation broth was determined using high-performance liquid chromatography (HPLC). The malic acid reduction rate was calculated using the following formula: Malic acid reduction rate = In the formula: A0 is the malic acid content of the blank sample, g / L, and A1 is the malic acid content of the sample sample, g / L.
[0027] The total acid content was determined by titration with an acid-base indicator, and the total acid reduction rate was calculated using the following formula: Total acid reduction rate = In the formula: A0 is the total acid content of the blank, g / L, and A1 is the total acid content of the sample, g / L.
[0028] pH determination: The pH value of the supernatant was measured using a PHS-3C pH meter. For S5 ethanol production capacity, *P. kudriavzevii* CGMCC 22929 was inoculated into YPD-malic acid liquid medium and cultured at 30 ℃ for 10 days. One group underwent aerobic culture, and two groups underwent anaerobic culture, with two replicates for each strain. Two mL of fermentation broth was collected from each of the following days: day 1 (0 h), day 2 (24 h), day 3 (48 h), day 4 (72 h), day 5 (96 h), day 6 (120 h), day 7 (144 h), day 8 (168 h), day 9 (192 h), day 10 (216 h), and day 11 (240 h). The samples were mixed before sampling and filtered through a 0.22 μm microporous membrane. The filtrate was then used for ethanol content determination using potassium dichromate spectrophotometry.
[0029] (1) Potassium dichromate oxidation colorimetric method: Ethanol is oxidized to acetic acid by potassium dichromate of a certain concentration under acidic conditions. The alcohol content in the sample is determined by colorimetric determination based on the color intensity of the trivalent chromium generated in the reaction.
[0030] (2) Preparation of standard curve: 1) Diluting the standard solution: Take 2.5 mL of anhydrous ethanol and add it to a 50 mL volumetric flask. Make up to 5% ethanol standard solution. Take 0, 1, 2, 3, 4, 5, 6, and 7 mL of the above standard solution into 50 mL volumetric flasks respectively. Take 5 mL of the above standard solution and add it to an Erlenmeyer flask as the reaction solution.
[0031] 2) Determination of standard solution: Add 10 mL of 2.0% potassium dichromate solution and 5 mL of 98% concentrated sulfuric acid to the conical flask in sequence, and mix well.
[0032] Seal with aluminum foil, react for 10 minutes, shake well, and cool to room temperature.
[0033] Using a blank standard solution as a reference, the absorbance of each concentration (%vol) was measured at a wavelength of 610 nm.
[0034] 3) Plot the standard curve: Plot the standard curve with absorbance as the ordinate and ethanol concentration (% vol) as the abscissa.
[0035] (3) Sample determination: 1) Sample dilution: Add 0.1 mL (filtered through a 0.22 μm microporous membrane) of fermentation broth to a 1 mL volumetric flask and make up to volume. Take 1 mL and add it to a test tube and wait for the reaction.
[0036] 2) Sample reaction: Add 2 mL of 2% potassium dichromate and 1 mL of 98% concentrated sulfuric acid to a test tube, mix well, seal with tin foil, react for 10 min, shake well and cool to room temperature.
[0037] 3) Sample determination: Using a blank standard solution as a reference, the absorbance was measured at a wavelength of 610 nm.
[0038] 4) Determination of sample alcohol concentration: Find the corresponding alcohol concentration based on the standard curve.
[0039] The actual alcohol concentration of the sample is calculated as the measured alcohol concentration of the sample multiplied by 40. This determines the ethanol production capacity of P. kudriavzeviiCGMCC 22929.
[0040] In this experiment, Origin 2019 software was used to analyze and process the experimental data and to create data charts, while SPSS software was used to perform statistical analysis on the significance of the data.
[0041] In terms of result representation, different lowercase letters were used to indicate groups with significant differences (p<0.05), while the same lowercase letters were used to indicate groups with no significant differences (p>0.05).
[0042] It should be noted that the following is the liquid culture medium for YPD or YEPD (Yeast Extract Peptone Dextrose Medium): 5.0 g / L yeast extract, 10.0 g / L peptone, 20.0 g / L glucose, 1 L distilled water added, pH adjusted to 6.0, and sterilized at 121℃ for 15 min.
[0043] YPD-malic acid liquid culture medium: yeast extract 5.0 g / L, peptone 10.0 g / L, glucose 20.0 g / L, malic acid 10.0 g / L, add 1 L distilled water, pH 3.5. Autoclave at 121℃ for 15 min, and set aside.
[0044] The seed culture medium consisted of: 5.0 g / L yeast extract, 10.0 g / L peptone, 20.0 g / L glucose, 10.0 g / L malic acid, 5.85 g / L sodium chloride, 10 g / L magnesium sulfate, 25 g / L ferric sulfate, 4 g / L manganese sulfate, pH 3.3, and was sterilized at 121℃ for 15 min.
[0045] Tolerance medium: YPD liquid medium containing ethanol at concentrations of 60 g / L (7.6% vol), 70 g / L (8.7% vol), 80 g / L (10.1% vol), 90 g / L (11.4% vol), 100 g / L (12.7% vol), and 110 g / L (13.9% vol).
[0046] YPD liquid culture medium containing malic acid at concentrations of 30 g / L, 20 g / L, 10 g / L, 6 g / L, 5 g / L, 4 g / L, 3 g / L, 2 g / L, and 1 g / L, and with pH values adjusted to 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, and 7.0, respectively.
[0047] YPD liquid culture medium containing NaCl at concentrations of 8.5 g / L, 11.7 g / L, 23.4 g / L, 35.1 g / L, 46.8 g / L and 58.5 g / L respectively.
[0048] Malt Extract Agar (MEA) (g / L): 130.0g malt extract, 0.1g chloramphenicol, 15.0g agar, pH 5.6±0.2, 25℃.
[0049] Example 2, based on Example 1 above, further includes the following steps for identifying a highly resistant, malic acid-reducing, and ethanol-producing Pichia pastoris: Morphological observation: Single colonies are picked and streaked onto malt extract agar medium and cultured at 30°C for 48 h for purification. As shown in Figure 1, the colonies are observed to be elliptical, approximately 0.3-2.0 mm in diameter × 0.2-5.0 mm, milky white in color, viscous and moist in texture, with a smooth, round, and opaque surface and rough edges. A strong alcoholic aroma is detected upon opening the petri dish.
[0050] P. kudriavzevii CGMCC 22929 was cultured at 30℃ for 72 h. As shown in Figure 1, the colonies were observed to be oval, approximately 0.3-2.0 mm in diameter × 0.2-5.0 mm, milky white in color, viscous and moist in texture, with a smooth, round, and opaque surface and rough edges. A strong aroma of alcohol was detected upon opening the petri dish.
[0051] Cell observation was performed after methylene blue staining, as shown in Figure 2. Under a 40× optical microscope, yeast cells were observed to be colorless (living cells) and dark (dead cells), arranged in an irregular, elongated oval shape. Reproduction was observed to be budding.
[0052] Molecular identification was performed using PCR reaction conditions: pre-denaturation: 95°C, 5 min; denaturation: 95°C, 30 s; annealing: 58°C, 30 s; extension: 72°C, 30 s; cycle number: 30 cycles; final extension: 72°C, 10 min. PCR was then performed. The amplified products were sent to Shanghai Paisenuo Biotechnology Co., Ltd. for ITS sequencing. The amplified sequence, shown in Figure 3, was 470 bp in length. The sequence was compared with the Genbank nucleic acid database (http: / / www.ncbi.nlm.nih.gov / blast) using BLAST analysis. The highest homology reached 99.79%, and the homology of the top 100 sequences identified as *Pichia kudriezvichi* was above 99.36%. As shown in Figure 4, the identified strain was *Pichia kudriezvichi* CGMCC No. 22929, confirmed and deposited at the China General Microbiological Culture Collection Center (Figure 3).
[0053] Shanghai Pasenuo Biotechnology Co., Ltd. performed ITS amplification and sequencing. The amplified sequence is shown in Figure 3, with a length of 470 bp.
[0054] The P. kudriavzevii CGMCC 22929 ITS sequencing sequence was compared with NCBI, as shown in Figure 4. The highest homology with Pichia kudriavzevii was 99.79%, and the homology of the top 100 sequences identified as Pichia kudriavzevii was all above 99.36%.
[0055] Tolerance Results: *P. kudriavzevii* CGMCC 22929 was inoculated at a 2% inoculum in YPD liquid medium. Then, it was incubated at different temperatures (20℃, 25℃, 30℃, 35℃, 40℃, 45℃, 50℃, 55℃, 60℃, and 65℃) for 12 h (Figure 5). The OD value showed an increasing trend from 30℃ to 50℃, indicating an increasing bacterial growth rate. The OD value was highest at 50℃, showing significant bacterial growth. Therefore, the highest tolerable temperature for *P. kudriavzevii* CGMCC 22929 was determined to be 50℃.
[0056] Tolerance to ethanol was assessed by adding 2% inoculum of *P. kudriavzevii* CGMCC 22929 to YPD liquid medium containing ethanol at concentrations of 60 g / L (7.6% vol), 70 g / L (8.7% vol), 80 g / L (10.1% vol), 90 g / L (11.4% vol), 100 g / L (12.7% vol), 110 g / L (13.94% vol), 120 g / L (15.2% vol), and 130 g / L (16.47% vol). After incubation at 30°C for 12 h, as shown in Figure 6, the OD value of the bacterial culture at 120 g / L (15.2% vol) was not significantly different from that at 60 g / L (7.6% vol), thus determining that the highest ethanol concentration tolerated by *P. kudriavzevii* CGMCC 22929 was 120 g / L (15.2% vol).
[0057] Tolerance to acid was assessed by inoculating *P. kudriavzevii* CGMCC 22929 at a 2% inoculum into YPD liquid medium containing malic acid at pH values of 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, and 7.0. The cultures were incubated at 30°C for 12 hours. As shown in Figure 7, the bacterial OD value was highest at pH 3.5, indicating significant bacterial growth. Therefore, the highest tolerance pH for *P. kudriavzevii* CGMCC 22929 was determined to be 3.5.
[0058] Tolerance to NaCl was assessed by inoculating *P. kudriavzevii* CGMCC 22929 at a 2% inoculum into YPD liquid medium containing NaCl concentrations of 0.85% (8.5 g / L), 1.17% (11.7 g / L), 2.34% (23.4 g / L), 3.51% (35.1 g / L), 4.68% (46.8 g / L), and 5.85% (58.5 g / L), respectively. The cultures were incubated at 30°C for 12 h. As shown in Figure 8, the OD values of the bacterial cultures at a NaCl concentration of 35.1 g / L were not significantly different from those at 8.5 g / L. Therefore, the maximum NaCl tolerance of *P. kudriavzevii* CGMCC 22929 was determined to be 46.8 g / L.
[0059] The pH value of the supernatant was measured using a PHS-3C pH meter to determine the acid reduction results.
[0060] The malic acid content of the fermentation broth was determined using high-performance liquid chromatography (HPLC). The changes in total acid content and pH value are shown in Table 2. The pH value in the supernatant increased from 3.2 to 3.64, and the acid reduction rate was calculated. Using uninoculated YPD-malic acid liquid medium as a blank, the malic acid reduction rate after 10 days ranged from 1.28% to 35.2%, and the total acid reduction rate ranged from 19.85% to 59.55%. Therefore, the degradation ability of *Pichia pastoris* CGMCC No. 22929 for malic acid is demonstrated.
[0061] Table 2. Degradation capacity of malic acid by P. kudriavzeviiCGMCC 22929 at different culture times. 2.6 Ethanol Production Capacity P. kudriavzevii CGMCC 22929 was inoculated into fermentation medium 2 and cultured at 30 ℃ for 11 days. Two replicates were performed for each strain. 2 mL of fermentation broth was collected from each of the following days: day 1 (0 h), day 2 (24 h), day 3 (48 h), day 4 (72 h), day 5 (96 h), day 6 (120 h), day 7 (144 h), day 8 (168 h), day 9 (192 h), day 10 (216 h), and day 11 (240 h). The samples were mixed before sampling and filtered through a 0.22 μm microporous membrane. The filtrate was then used for ethanol content determination using the potassium dichromate spectrophotometric method.
[0062] The potassium dichromate oxidation colorimetric method is used: ethanol is oxidized to acetic acid by potassium dichromate of a certain concentration under acidic conditions. The alcohol content in the sample is determined by colorimetric analysis based on the color intensity of the trivalent chromium produced in the reaction.
[0063] 1) Diluting the standard solution: Take 2.5 mL of anhydrous ethanol and add it to a 50 mL volumetric flask, then dilute to the mark to prepare a 5% ethanol standard solution. Take 0, 1, 2, 3, 4, 5, 6, and 7 mL of the above standard solution and add them to 50 mL volumetric flasks respectively. Take 5 mL of the above standard solution and add it to an Erlenmeyer flask as the reaction solution.
[0064] 2) Determination of standard solution: Add 10 mL of 2.0% potassium dichromate solution and 5 mL of 98% concentrated sulfuric acid to an Erlenmeyer flask and mix well. Seal with aluminum foil, react for 10 min, shake well, and cool to room temperature. Using a blank standard solution as a reference, measure the absorbance of each concentration (%vol) at a wavelength of 610 nm.
[0065] 3) Plot the standard curve: Plot the standard curve with absorbance as the ordinate and ethanol concentration (% vol) as the abscissa. The standard curve is shown in Figure 5.
[0066] 4) Sample determination: A. Sample dilution: Add 0.1 mL (filtered through a 0.22 μm microporous membrane) of fermentation broth to a 1 mL volumetric flask and make up to volume. Take 1 mL and add it to a test tube and wait for the reaction.
[0067] B. Sample reaction: Add 2 mL of 2% potassium dichromate and 1 mL of 98% concentrated sulfuric acid to a test tube, mix well, seal with tin foil, react for 10 min, shake well and cool to room temperature.
[0068] C. Using a blank standard solution as a reference, measure its absorbance at a wavelength of 610 nm.
[0069] 5) Determination of sample alcohol concentration: Find the corresponding alcohol concentration based on the standard curve.
[0070] The actual alcohol concentration of the sample is calculated as the measured alcohol concentration of the sample multiplied by 40. This determines the ethanol production capacity of *Pichia pastoris* CGMCC 22929.
[0071] 6) Construction of the glucose standard curve: The standard curve is constructed by plotting glucose concentration on the x-axis and absorbance (A) on the y-axis. The construction method is shown in Table 3: Table 3 Steps for constructing the glucose standard curve The standard curve is shown in Figure 9, and its equation is y = 0.1871x + 0.0013, R0. 2 =0.9982, indicating a good linear relationship. The results of the determination of the ethanol volume fraction (% vol) of the sample are shown in Table 2.
[0072] 6) Sample determination: Add 0.8 mL of sample to a test tube, then add 0.6 mL of DNS reagent, mix well, heat in a boiling water bath for 5 min, cool to room temperature, and dilute to 4 mL with distilled water. Mix well.
[0073] Sample determination: Using a blank standard solution as a reference, the absorbance was measured at a wavelength of 540 nm.
[0074] By substituting the measured absorbance values of glucose at different fermentation stages into the glucose standard curve equation, the glucose content of the new fermentation broth at each fermentation stage can be obtained.
[0075] 7) The glucose and ethanol contents in the fermentation broth were measured. The glucose and ethanol contents in the fermentation broth after 10 days of culture are shown in Table 4. The glucose content gradually decreased, while the ethanol production remained at 4.42% vol.
[0076] Table 4. Glucose and ethanol content in fermentation broth The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of the present invention is defined by the appended claims and their equivalents.
Claims
1. A method for identifying highly resistant, malic acid-lowering, and ethanol-producing Pichia pastoris, characterized in that: Includes the following steps: S1. Activation and morphological observation of the strain: The yeast strain to be tested was streaked onto malt extract agar medium, and after cultivation, the colony morphology was observed. Methylene blue staining was performed and cell morphology was observed under an optical microscope. S2. Molecular biological identification: Genomic DNA was extracted from the yeast strain to be tested, and ITS regions were amplified and sequenced using primers ITS1 and ITS4. The sequencing results were compared with the database to determine the species. S3. Tolerance identification: The strain's tolerance to temperature, ethanol, acid, and osmotic pressure was assessed by measuring its growth in YPD liquid medium with different temperatures, concentrations of ethanol, pH and malic acid combinations, and different concentrations of sodium chloride. S4. Malic acid degradation capacity identification: The strain was inoculated into liquid medium containing malic acid and cultured under specified conditions. The malic acid content in the fermentation broth was measured periodically, and the acid reduction rate was calculated. S5. Ethanol production capacity identification: The strain was inoculated into liquid medium containing malic acid and cultured under specified conditions. The ethanol content in the fermentation broth was measured periodically using potassium dichromate spectrophotometry.
2. The method for identifying highly resistant, malic acid-lowering, and ethanol-producing Pichia pastoris according to claim 1, characterized in that: The temperature tolerance identification described in S3 is as follows: the strain is inoculated into YPD liquid medium at an inoculum of 2%, and then statically cultured at 20℃, 25℃, 30℃, 35℃, 40℃, 45℃, 50℃, and 55℃ for 12 h respectively. The absorbance OD value at a wavelength of 560 nm is then measured, and its maximum tolerance temperature is determined based on the growth trend.
3. The method for identifying highly resistant, malic acid-lowering, and ethanol-producing Pichia pastoris according to claim 2, characterized in that: The ethanol tolerance identification described in S3 is as follows: the strain is inoculated at a 2% inoculation rate into YPD liquid medium containing ethanol at concentrations of 60 g / L, 70 g / L, 80 g / L, 90 g / L, 100 g / L, 110 g / L, 120 g / L, and 130 g / L. After incubation at 30°C for 12 h, the absorbance OD value at a wavelength of 560 nm is measured, and the highest ethanol tolerance concentration is determined based on the growth trend.
4. The method for identifying highly resistant, malic acid-lowering, and ethanol-producing Pichia pastoris according to claim 3, characterized in that: The acid tolerance identification described in S3 is as follows: The strain is inoculated at a 2% inoculum into YPD liquid medium containing a series of malic acid concentrations and pH values of 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, and 7.0, respectively. After being cultured at 30°C for 12 h, the absorbance OD value at a wavelength of 560 nm is measured, and the optimal growth pH and acid tolerance range are determined based on the growth trend.
5. The method for identifying highly resistant, malic acid-lowering, and ethanol-producing Pichia pastoris according to claim 4, characterized in that: The osmotic tolerance identification described in S3 is as follows: the strain is inoculated at a 2% inoculation rate into YPD liquid medium containing sodium chloride at concentrations of 8.5 g / L, 11.7 g / L, 23.4 g / L, 35.1 g / L, 46.8 g / L, and 58.5 g / L. After incubation at 30°C for 12 h, the absorbance OD value at a wavelength of 560 nm is measured, and the maximum tolerant sodium chloride concentration is determined based on the growth trend.
6. The method for identifying highly resistant, malic acid-lowering, and ethanol-producing Pichia pastoris according to claim 5, characterized in that: The identification of malic acid degradation capacity described in S4 includes aerobic and anaerobic culture conditions. The determination of malic acid content is performed using high performance liquid chromatography. The acid reduction rate is calculated according to the formula (blank malic acid content - sample malic acid content) / blank malic acid content × 100%.
7. The method for identifying highly resistant, malic acid-lowering, and ethanol-producing Pichia pastoris according to claim 6, characterized in that: The identification of ethanol production capacity described in S5 involves determining the ethanol content using the potassium dichromate oxidation colorimetric method, which includes plotting an ethanol concentration standard curve and substituting the absorbance measured from the sample into the standard curve to calculate the ethanol concentration.
8. The method for identifying highly resistant, malic acid-lowering, and ethanol-producing Pichia pastoris according to claim 7, characterized in that: The strain of Pichia kudrica, which is highly resistant to malic acid and produces ethanol, is CGMCC No. 22929.
9. The use of the Pichia pastoris strain CGMCC No. 22929 of claim 1 in the degradation of malic acid.
10. The use of the Pichia kudriezwiyne strain CGMCC No. 22929 of claim 1 in the production of ethanol.