Gene methylation primer probe composition for auxiliary identification of cervical lesions, kit, application and diagnostic model
By using a combination of six gene methylation primers and probes and a pure chemical lysis method to extract nucleic acids, combined with low-cost chemical reagents and diagnostic models, the problem of insufficient sensitivity and specificity in existing cervical cancer screening technologies has been solved. This enables accurate detection of HPV-negative and HPV-positive patients, reduces sample volume and cost, and is suitable for large-scale screening.
Patent Information
- Application Number
- CN202610462337.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-09
- Publication Date
- 2026-05-05
AI Technical Summary
Existing technologies for cervical cancer screening suffer from poor sensitivity and specificity, large sample volume, high cost, unsuitability for large-scale screening, and incompatibility with HPV-positive and HPV-negative patient testing.
A methylation primer-probe composition for six genes—PAX1, SOX1, EPB41L3, ST6GALNAC5, SOX14, and ZNF671—was used. Nucleic acids were extracted using a pure chemical lysis method. Low-cost chemical reagents were used for methylation pretreatment. The system was equipped with fully automated equipment adapted to different cell preservation solutions and was used in conjunction with diagnostic models for detection.
It enables accurate detection of HPV-negative and HPV-positive patients, reduces sample volume, improves detection sensitivity and specificity, is suitable for large-scale screening, reduces costs, is compatible with various cell preservation solutions, and reduces unnecessary colposcopy referrals.
Smart Images

Figure CN121975937A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biological detection technology, and in particular to a set of gene methylation primer-probe compositions, kits, applications and diagnostic models for assisting in the identification of cervical lesions. Background Technology
[0002] Approximately 95% of cervical cancers are caused by persistent infection with high-risk human papillomavirus (hrHPV). It is conservatively estimated that about 3%-8% of cervical cancers are unrelated to hrHPV infection. Among cervical cancers, squamous cell carcinoma is the most common histopathological type, with adenocarcinoma accounting for about 20%. About 15%-20% of adenocarcinomas are hrHPV negative.
[0003] Traditional methods for cervical cancer screening, triage, and referral include visual inspection, cytology, hrHPV testing, DNA methylation testing, colposcopy, and histopathological biopsy (the gold standard). Cytology is relatively inexpensive, but its specificity is poor. Currently, there is no computer-aided, reproducible method for interpreting cervical exfoliative cytology results, and the interpretation of cytology results is still influenced by the subjective judgment of the cytologist. hrHPV testing is currently the mainstream primary screening method for cervical cancer, offering higher sensitivity and longer screening intervals. However, due to its poor specificity, this increases the number of colposcopy referrals and causes excessive panic among women. It may also lead to missed diagnoses of approximately 5% of non-hrHPV-dependent cervical adenocarcinomas. Therefore, appropriate screening and triage methods are needed. DNA methylation testing is an objective and reproducible molecular detection technique with extremely high specificity and reasonable sensitivity, making it an effective means of reducing unnecessary colposcopy referrals and triage management.
[0004] Currently, various gene methylation detection technologies exist. BSP-TA cloning sequencing is the gold standard methodology for DNA methylation detection, but it suffers from drawbacks such as complex procedures, cumbersome operation, long processing time, low throughput, and high cloning sequencing costs. It is unsuitable for high-throughput screening of large sample sizes and is more suitable as a validation method for other DNA methylation detection methodologies. Pyrosequencing and WGBS sequencing technologies, while offering high throughput, are expensive, have broad coverage but poor sensitivity, and are time-consuming, making them unsuitable for rapid detection. Methylation-specific PCR (MSP) can detect regional methylation in DNA, but requires two pairs of primers for each detection site—methylated and unmethylated primers—making multi-target detection difficult to achieve with a single tube. Furthermore, analysis often requires electrophoresis, making the process cumbersome and preventing real-time detection. Quantitative Methylation-Specific PCR (qMSP) is an innovative, highly sensitive quantitative methylation detection technique based on MSP. It is used in conjunction with a fluorescence PCR instrument to achieve real-time detection. The TaqMan probe improves specificity and enables multiplex detection on a single tube. Only methylation primers and probes are needed for detection. This technique has relatively high throughput and good sensitivity, making it suitable for rapid screening.
[0005] Currently, there are several qMSP-based kits for cervical cancer screening, but they have certain limitations. For example, they only detect cervical cancer and cannot accurately detect high-grade cervical intraepithelial neoplasia; they use relatively expensive enzymatic methods for methylation pretreatment, resulting in high costs; their biomarker coverage is incomplete and lacks inclusiveness, making them unable to detect non-HPV-dependent cervical cancer, adenocarcinoma, and other types; they have poor compatibility and cannot be used with cervical exfoliated cells preserved in different types of commercially available cell preservation solutions; they require large sample volumes (1mL-2mL), making it impossible to perform multiple tests on a single sample, and their methylation detection sensitivity is poor.
[0006] CN112048561A discloses a composition and kit for the early detection of high-grade cervical lesions and cervical cancer, specifically: the core biomarkers are the combined detection of three genes, FAM19A4, JAM3, and PAX1, and its main technical problem to be solved is the non-specific amplification (false positive) caused by incomplete bisulfite conversion. The target sample type is cervical exfoliated cells, but the sample quantity and HPV infection status of these samples are not described. The disadvantages are: this method uses methylation primers and blocking primers, increasing the number of primer pairs and reagent costs; the combined ROC curve area of the three genes obtained using this kit is 0.9, and the detection rates for CIN2, CIN3, cervical squamous cell carcinoma, and cervical adenocarcinoma are 61.54%, 84.21%, 100%, and 88.89%, respectively, indicating poor sensitivity.
[0007] CN115927636A discloses a qPCR detection kit for cervical high-grade lesion-related gene methylation, along with its usage method and system. Specifically, it uses a six-gene combination marker (ZNF671, ASTN1, DLX1, ITGA4, RXFP3, and SOX17) and employs an enzymatic pre-methylation method to avoid the severe DNA damage and degradation caused by traditional bisulfite conversion methods. The interpretation of the results incorporates a weighted algorithm scoring system. The sample type tested is either cervical exfoliated cells or tissue. The disadvantages are: it requires 1 mL of cervical exfoliated cells and centrifugation, resulting in a large sample volume and cumbersome operation due to the added centrifugation step, which is not conducive to large-sample screening or fully automated operation.
[0008] CN118685524A discloses a PCR primer and probe combination, kit, and its application for detecting gene methylation in cervical cancer. Specifically, it combines EPHA7, PAX1, and DKK2 genes, and uses enzymatic pre-methylation treatment. Its technological innovation lies in its ability to distinguish between 5-methylcytosine and 5-hydroxymethylcytosine, avoiding interference from hydroxymethylation in the detection results. Furthermore, it allows for cervical cancer diagnosis by detecting these methylation levels and provides multiple interpretation strategies for single-gene, dual-gene, and single-gene combinations. The highest interpretation method achieves a sensitivity of 91.18% and a specificity of 97.06%. It also uses exfoliated cervical cells, but the sample volume is not described. The drawback is that although different interpretation methods are provided, the highest sensitivity is 91.18%, but the specificity is only 73.53% at this level; when the highest specificity is 97.06%, the sensitivity is only 75.49%.
[0009] CN118581218A discloses a nucleic acid product, reagent kit, and application for detecting HPV-negative cervical cancer, specifically using the single biomarker PCDHGB7. It addresses the technical challenge of specifically targeting HPV-negative cervical cancer and high-grade cervical lesions, filling the gap in existing methylation testing primarily targeting HPV-positive individuals. The implementation method is also enzymatic, using cervical secretions or tissue as the sample type; the sample dosage is not described. The drawbacks are: it only detects HPV-negative cervical squamous cell carcinoma and cannot detect HPV-negative cervical adenocarcinoma; and it does not specify whether it is compatible with the detection of HPV-positive cervical cancer patients.
[0010] CN118667953A discloses a primer pair, primer-probe combination, kit, and application for detecting cervical cancer, specifically as follows: Novel cervical cancer methylation markers, MMP23B and specific regions of HOXD8, are identified through bioinformatics screening. Using methylation-specific and non-methylation-specific primers, and qMSP detection, the sensitivity of dual-gene combined detection of cervical cancer can reach over 92%. The sample type used is exfoliated cervical cells, but the sample quantity is not described. The drawback is that while the sensitivity of dual-gene combined detection of cervical cancer can reach over 92%, its ability to accurately detect high-grade cervical intraepithelial neoplasia is not described, and the specificity detection is only for healthy individuals; the HPV infection status of the tested patients is not described.
[0011] CN118755838A describes a composition, kit, and application for detecting cervical cancer and high-grade cervical lesions, specifically: a combined biomarker of JAM3, PCDHGB7, and SORCS1 genes, achieving efficient screening with minimal biomarkers and significantly reducing the colposcopy referral rate in HPV-positive individuals. Enzymatic pre-methylation treatment is also used. Disadvantages include: a large reaction volume requiring a 40 μL reaction system; and the provision of two different algorithm models, one for CIN2+ and the other for CIN3+. The former has a sensitivity of 69.9% and a specificity of 88.8%, while the latter has a sensitivity of 85.0% and a specificity of 81.8%, both of which are relatively poor.
[0012] CN120519587A discloses a reagent composition, kit, and application for cervical cancer detection, specifically: LEPR, GABRA2, RNF219-AS1, ASCL1, and ZNF671 (five genes combined). The technical challenge / innovation lies in discovering a novel combination of cervical cancer methylation biomarkers, employing a mild enzymatic digestion method. The technical solution involves targeting specific CpG regions of the five newly screened genes (LEPR, etc.) using methylation-sensitive restriction endonucleases (HpaII, etc.), followed by fluorescent PCR. The sample type is cervical exfoliated cells. The drawback is that it provides two different algorithm models: a CIN2+ prediction model constructed using Logistic regression with sensitivity and specificity of 75.3% and 93.3% respectively, and a CIN3+ model with sensitivity and specificity of 94.3% and 88.5% respectively, both of which are relatively poor.
[0013] CN115927636A, CN118685524A, CN118581218A, CN118755838A and CN120519587A all use enzymatic pre-methylation treatment, which involves many reagent components and is costly.
[0014] None of the aforementioned existing technologies explicitly describe the ability to comprehensively test HPV-negative cervical cancer patients while simultaneously testing HPV-positive cervical cancer patients. Furthermore, the sensitivity and specificity of techniques for detecting different cervical lesions are relatively poor. There is also no description of whether they are compatible with the detection of cervical exfoliated cells preserved in various commercially available cell preservation solutions.
[0015] Existing technologies do not accurately describe pretreatment protocols, and inappropriate nucleic acid extraction methods or methylation pretreatment protocols may lead to false negative or false positive test results. Summary of the Invention
[0016] To address the shortcomings of existing technologies, this invention provides a set of gene methylation primer-probe compositions, kits, applications, and diagnostic models for assisting in the identification of cervical lesions. These methods improve the sensitivity and specificity of detection, reduce the amount of sample required, and enable multiple tests on a single sample in cervical cancer screening. Furthermore, this invention can detect different histopathological types of cervical cancer.
[0017] In order to achieve the objective of this invention, the following solution is proposed: In a first aspect, the present invention provides a set of gene methylation primer-probe compositions for assisting in the identification of cervical lesions, which are associated with six genes: PAX1, SOX1, EPB41L3, ST6GALNAC5, SOX14, and ZNF671. The primer-probe composition comprises: PAX1-qF:TTTGGAGCGGGCG(SEQ ID NO:1); PAX1-qR:GCCCGAAAACCGAA(SEQ ID NO:2); PAX1-Probe:GACCCAACCGCGAACTAAAAACG(SEQ ID NO:3); SOX1-qF:GAGCGGGTATTGGC(SEQ ID NO:4); SOX1-qR: AAAAATCAAACGACTCA(SEQ ID NO:5); SOX1-Probe:TTAGTGTACGTCGCGGTCGAGA(SEQ ID NO:6); EPB41L3-qF:TTTTACGAGGTGCG(SEQ ID NO:7); EPB41L3-qR:AACCGCGCGACGCCG(SEQ ID NO:8); EPB41L3-Probe:CGAGGTTTGGGGCGAGGC(SEQ ID NO:9); ST6GALNAC5-qF:CGTTGAGAGATTACGAGGGTTC(SEQ ID NO:10); ST6GALNAC5-qR:CGACCGCGACAAATCG(SEQ ID NO:11); ST6GALNAC5-Probe:GCGAAACCCGAAAAACCGG(SEQ ID NO:12); SOX14-qF:CGTGGGGGTTTTCGAC(SEQ ID NO:13); SOX14-qR:TAAACTACGCGAAATC(SEQ ID NO:14); SOX14-Probe:CGCGTTCGAGAAAGTTCG(SEQ ID NO:15); ZNF671-qF:CGGAAGTGTTTTGCGTTTTC(SEQ ID NO:16); ZNF671-qR:ACACCCACCCGCGCGA(SEQ ID NO:17); ZNF671-Probe:CGTTTGTCGTTTTCGGTAGTTGTTC(SEQ ID NO:18); Internal reference gene-qF: GGAATTTTGTAGGTTTTATTTG (SEQ ID NO:19); Internal reference gene-qR: CCTACACCCACAACACTATCT (SEQ ID NO:20); Internal reference gene - qProbe: TAAACACCTAATCAAAAAAACAAACACCA (SEQ ID NO:21).
[0018] Furthermore, the probe sequence is labeled with a fluorescent group and a quencher group. The fluorescent group is one of FAM, HEX, VIC, ROX, JOE, or CY5, and is labeled at the 5' end of the probe sequence or at a position 1-5 bp from the 5' end. The quencher group is one of BHQ1, BHQ2, or BHQ3, and is labeled at the 3' end of the probe sequence or at a position 1-5 bp from the 3' end.
[0019] Secondly, the present invention provides a kit for assisting in the identification of cervical lesions, comprising nucleic acid extraction or purification reagents, methylation detection sample pretreatment reagents, PCR reaction mixture, primer-probe mixture 1, primer-probe mixture 2, and positive and negative control reagents.
[0020] (1) Nucleic acid extraction or purification reagents include lysis binding buffer, washing buffer 1, washing buffer 2, extraction magnetic beads, and elution buffer. Using a pure chemical lysis method, proteinase K is not required, enabling direct extraction of cervical exfoliated cell samples preserved in various commercially available cell preservation solutions. Among them: a) The lysis binding solution contains 1M-5M guanidine hydrochloride, 0.05%-10% sodium dodecyl sulfate, 20%-45% isopropanol, 0.05%-10% Tween-20, 5mM-100mM disodium ethylenediaminetetraacetate, and 5mM-100mM tris(hydroxymethyl)aminomethane, with a pH range of 6.8-8.5.
[0021] b) Washing solution 1 contains 0.5M-2.5M guanidine hydrochloride, 0.05%-10% Triton X-100, 20%-45% isopropanol, and 5mM-100mM tris(hydroxymethyl)aminomethane, with a pH range of 5.4-7.5.
[0022] c) Washing solution 2 contains 70%-85% anhydrous ethanol, 5mM-100mM tris(hydroxymethyl)aminomethane and disodium ethylenediaminetetraacetate.
[0023] d) The extracted magnetic beads consist of multiple magnetic microspheres ranging from 100 nm to 500 nm, with magnetic iron(II) oxide and / or ferric oxide at the center of the microspheres and modified with silanol groups and / or silanol groups on the surface.
[0024] e) The eluent contains 1 mM-50 mM of tris(hydroxymethyl)aminomethane and / or disodium ethylenediaminetetraacetate, with a pH range of 6.8-8.3.
[0025] (2) Sample pretreatment reagents for methylation detection include CT conversion agent, binding solution, desulfurizing agent, washing solution, purification magnetic beads, and elution solution. Among them: a) The CT conversion agent contains 35%-45% sodium metabisulfite, sodium bisulfite, ammonium bisulfite, 10mM-100mM TCEP hydrochloride, hydroquinone, DTT, tetrahydrofurfuryl alcohol, 1%-10% dimethyl sulfoxide, and dimethylformamide, with a pH range of 5.0-5.5.
[0026] b) The binding solution contains 25%-45% guanidine hydrochloride, isopropanol, 10mM-100mM disodium ethylenediaminetetraacetate and / or sodium chloride, and 10mM-100mM tris(hydroxymethyl)aminomethane, with a pH range of 5.2-6.8.
[0027] c) The desulfurizing agent contains 1M-5M guanidine hydrochloride, 100mM-400mM sodium hydroxide, and 25%-45% anhydrous ethanol, with a pH range of 10-14.
[0028] d) The cleaning solution contains 70%-85% anhydrous ethanol, 1mM-50mM tris(hydroxymethyl)aminomethane and disodium ethylenediaminetetraacetate.
[0029] e) The purified magnetic beads contain multiple 0.4μm-1μm magnetic microspheres, with magnetic iron(II) oxide and / or ferric oxide at the center of the microspheres and modified with silanol groups and / or silanol groups on the surface.
[0030] f) The eluent contains 5 mM-20 mM tris(hydroxymethyl)aminomethane and / or disodium ethylenediaminetetraacetate and / or sodium chloride, with a pH range of 6.8-8.3.
[0031] (3) The PCR reaction mixture contains 0.05 U-1 U hot-start Taq enzyme, 0.2 mM-1.5 mM dNTPs, 8 mM-12 mM tris(hydroxymethyl)aminomethane, 240 mM-270 mM potassium chloride, 0.8 mM-1.2 mM anhydrous magnesium chloride, 5%-20% glycerol, 0.01%-0.05% Triton X-100 and / or Tween-20, and 0.05%-1.5% bovine serum albumin.
[0032] (4) Primer-probe mixture 1 contains the above primer-probe composition.
[0033] (5) Primer-probe mixture 2 contains the above-mentioned primer-probe composition.
[0034] (6) Positive and negative quality control includes positive quality control and negative quality control. Among them: a) Positive control contains 0.1 ng / μL to 1 ng / μL of one or more of the following: Caski cell line genomic DNA, SiHa cell line genomic DNA, HeLa cell line genomic DNA, and C33A cell line genomic DNA.
[0035] b) One or more of the following: HS578T cell line genomic DNA, SKBR3 cell line genomic DNA, K562 cell line genomic DNA, and 293T cell line genomic DNA, with negative control at 0.1 ng / μL-1 ng / μL.
[0036] Thirdly, the present invention provides the application of the primer-probe composition in the preparation of a kit for diagnosing HPV-negative or HPV-positive high-grade cervical intraepithelial neoplasia, cervical squamous cell carcinoma, and cervical adenocarcinoma.
[0037] Fourthly, the present invention provides a diagnostic model associated with six genes: PAX1, SOX1, EPB41L3, ST6GALNAC5, SOX14, and ZNF671. After gene methylation detection using the above-mentioned kit, the diagnostic model provides the interpretation of the results. The diagnostic model is built into a storable medium and is executed using computer language instructions.
[0038] The formula for the diagnostic model is: P=(e^Z) / (1-e^Z); Z=12.130-0.040*△Ct(PAX1)-0.125*△Ct(SOX1)-0.220*△Ct(EPB41L3 )-0.052*△Ct(ST6GALNAC5)-0.371*△Ct(SOX14)-0.336*△Ct(ZNF671); △Ct (gene) = gene Ct value - internal reference gene Ct value.
[0039] When the P value is ≥0.46, it indicates that the cervix may have high-grade intraepithelial neoplasia, cervical squamous cell carcinoma, or cervical adenocarcinoma; when the P value is <0.46, it indicates that the risk of high-grade intraepithelial neoplasia, cervical squamous cell carcinoma, or cervical adenocarcinoma is low.
[0040] The beneficial effects of this invention are as follows: 1. This invention provides a novel set of primers and probes with good detection sensitivity. Sufficient DNA can be obtained from only 200μL-400μL of raw cervical exfoliated cell sample, and the raw sample can be directly extracted without centrifugation. Compared with existing technologies, this invention improves detection sensitivity, reduces the initial sample input, and achieves the goal of multiple tests from a single sample in cervical cancer screening, eliminating the need for repeated sampling.
[0041] 2. Compared with existing similar technologies, the cervical lesion severity detection kit provided by this invention can not only accurately detect different histopathological types of cervical cancer, but also differentiate the severity of high-grade cervical intraepithelial neoplasia (HSIL), providing triage guidance for hrHPV-positive patients, avoiding unnecessary colposcopy referrals, and reducing the waste of medical resources. The kit is compatible with cervical exfoliated cell samples preserved in various commercially available cell preservation solutions. The positive and negative quality controls provided by the kit enable end-to-end quality control from sample nucleic acid extraction, methylation pretreatment, and gene methylation detection, ensuring the accuracy of the test results.
[0042] 3. The present invention also provides a diagnostic model that, through the accumulation of clinical sample data, combined with binary logistic regression modeling and ROC curve analysis, can detect at least 0.2 ng of absolute methylation, thereby achieving accurate differentiation between the actual methylation level of the sample and the degree of cervical lesions. Attached Figure Description
[0043] Figure 1 Amplification curves for detecting 0.2 ng absolute methylation of different genes; Figure 2Amplification curves for detecting 0.2 ng absolute methylation of different genes (II); Figure 3 ROC curves for detecting high-grade intraepithelial neoplasia, squamous cell carcinoma, and adenocarcinoma of the cervix in HPV-positive or HPV-negative individuals. Figure 4 A comparison chart of ΔCt values for different genes. Detailed Implementation
[0044] Example 1 The primer-probe composition includes: PAX1-qF: TTTGGAGCGGGCG; PAX1-qR: GCCCGAAAACCGAA; PAX1-Probe: GACCCAACCGCGAACTAAAAACG; SOX1-qF:GAGCGGGTATTGGC; SOX1-qR:AAAAATCAAACGACTCA; SOX1-Probe:TTAGTGTACGTCGCGGTCGAGA; EPB41L3-qF:TTTTACGAGGTGCG; EPB41L3-qR: AACCGCGCGACGCCG; EPB41L3-Probe:CGAGGTTTGGGGCGAGGC; ST6GALNAC5-qF:CGTTGAGAGATTACGAGGGTTC; ST6GALNAC5-qR:CGACCGCGACAAATCG; ST6GALNAC5-Probe: GCGAAACCCGAAAAACCGG; SOX14-qF:CGTGGGGGTTTTCGAC; SOX14-qR:TAAACTACGCGAAATC; SOX14-Probe:CGCGTTCGAGAAAGTTCG; ZNF671-qF:CGGAAGTGTTTTGCGTTTTC; ZNF671-qR: ACCCCACCCGCGCGA; ZNF671-Probe:CGTTTGTCGTTTTCGGTAGTTGTTC; Internal reference gene-qF: GGAATTTTGTAGGTTTTATTTG; Internal reference gene-qR: CCTACACCCACAACACTATCT; Internal reference gene - qProbe: TAAACACCTAATCAAAAAAACAAACACCA.
[0045] The probe sequence is labeled with a fluorescent group and a quencher group. The fluorescent group is one of FAM, HEX, VIC, ROX, JOE, or CY5, and is labeled at the 5' end of the probe sequence or at a position 1-5 bp from the 5' end. The quencher group is one of BHQ1, BHQ2, or BHQ3, and is labeled at the 3' end of the probe sequence or at a position 1-5 bp from the 3' end.
[0046] The kit includes nucleic acid extraction or purification reagents, methylation detection sample pretreatment reagents, PCR reaction mixture, primer-probe mixture 1, primer-probe mixture 2, and positive and negative control reagents.
[0047] Using methylation and nonmethylation standards purchased from ZYMO REASEARCH, 0.2 ng of absolutely methylated nucleic acid samples were prepared. The primer-probe composition and kit of this invention were then used for detection. The reaction system was prepared as follows: Table 1. Amounts of the three solutions used in the reaction system On a fluorescence PCR instrument, set the following program to perform the reaction: Table 2. Program Record Sheet for Fluorescent PCR Instrument Table 3. Record of Ct values, mean values, and coefficients of variation for different genes. After the reaction, as shown in Table 3, the Ct values, mean values, and coefficients of variation (CV) of different genes for 0.2 ng absolute methylation were obtained, and the amplification curves are shown in Table 3. Figure 1 , Figure 2 As shown, this indicates excellent detection sensitivity and good repeatability.
[0048] Example 2 Cervical exfoliated cell samples preserved in different cell preservation solutions were tested. All clinical samples were approved by the ethics committee, and patients signed informed consent forms. The specific implementation method is as follows: 200 μL of cervical exfoliated cell samples preserved in different cell preservation solutions were directly extracted without centrifugation. These cell preservation solutions included single-use, dual-use, and triple-use solutions from Cortia Biotechnology Co., Ltd., as well as ThinPrep solution from Hologic.
[0049] Extract using the nucleic acid extraction or purification reagents in the kit of this invention on a fully automated nucleic acid extractor. The reagent aliquot locations are as follows: Table 4. Reagent Dispensing Location Record Sheet The extraction steps of the fully automated nucleic acid extractor are as follows: Table 5. Record of Extraction Parameters for the Fully Automated Nucleic Acid Extractor After extraction, columns 6 / 12 of the deep-well plate contain the nucleic acid solution for the corresponding sample. Take 40 μL of the nucleic acid solution and add it to 110 μL of CT conversion reagent. Set the following program on the PCR instrument to perform the C / T conversion process: Table 6 Temperature and Time Records for the C / T Conversion Process After conversion, all solution was transferred to column 1 / 7 of a deep-well plate for subsequent purification using fully automated equipment. The reagents in the deep-well plate were dispensed as follows: Table 7. Reagent Dispensing Record for Deep Well Plates Then set the following procedure on the fully automated equipment: Table 8 Program Parameter Recording Table for Fully Automatic Equipment Table 9. Record of Sensitivity and Specificity After the procedure, columns 6 / 12 of the deep-well plate contain the BISDNA solution to be tested. The reaction system and procedure from Example 1 are used for detection, and a diagnostic model is used to interpret the results. The sensitivity and specificity for HPV-negative and HPV-positive high-grade cervical intraepithelial neoplasia, cervical squamous cell carcinoma, and cervical adenocarcinoma are shown in the ROC curves. Figure 3 As shown, the comparison method is the gold standard histopathology. (From Table 9...) Figure 3 It can be seen that the sensitivity is 90.24% and the specificity is 96.30%.
[0050] Example 3 The kit of this invention was used to test samples with different degrees of cervical lesions. 400 μL of cervical exfoliated cell samples preserved in different cell preservation solutions were directly extracted, and nucleic acid extraction or purification reagents from the kit were used. The operation steps are as follows: (1) Preheat the metal bath to 65°C. Take a 1.5 mL centrifuge tube and add 500 μL of lysis binding buffer and 20 μL of magnetic beads to the centrifuge tube (if there are many samples, premix according to the total sample volume and dispense 520 μL into each tube, mix fresh). Then add 400 μL of cervical exfoliated cell sample to the centrifuge tube.
[0051] (2) Cover the tube, vortex to mix, and place the centrifuge tube on a 65°C metal bath for 10 minutes.
[0052] (3) Take out the centrifuge tube, invert it 1-3 times to mix, centrifuge briefly, and collect the liquid on the cap and tube wall into the centrifuge tube.
[0053] (4) Place the centrifuge tube on the magnetic rack for about 30 seconds. After the solution becomes clear, discard the supernatant.
[0054] (5) Hold the centrifuge tube on the magnetic rack, add 500 μL of washing solution 1, cover the tube, vortex to mix until the magnetic beads are completely resuspended in washing solution 1, centrifuge briefly, and collect the liquid into the centrifuge tube.
[0055] (6) Place the centrifuge tube on the magnetic rack for about 30 seconds. After the solution becomes clear, discard the supernatant.
[0056] (7) Hold the centrifuge tube on the magnetic rack, add 500 μL of washing solution 2, cover the tube, vortex to mix until the magnetic beads are completely resuspended in the washing solution 2, centrifuge briefly, and collect the liquid into the centrifuge tube.
[0057] (8) Place the centrifuge tube on the magnetic rack for about 30 seconds. After the solution becomes clear, discard the supernatant.
[0058] (9) Cover the tube and centrifuge briefly to collect the residual liquid on the tube wall to the bottom of the centrifuge tube.
[0059] (10) Place the centrifuge tube on the magnetic rack. After about 30 seconds, when the solution is clear, use a small-range pipette to discard the liquid. Be careful not to touch the magnetic beads on the centrifuge tube wall.
[0060] (11) Keep the centrifuge tubes on the magnetic rack and keep the caps open, and let them air dry at room temperature for 1-3 minutes.
[0061] (12) Add 80 μL of elution buffer to the centrifuge tube, cap the tube, vortex and mix until the magnetic beads are completely resuspended in the elution buffer, and place the centrifuge tube on a 65°C metal bath for 5 min.
[0062] (13) Remove the centrifuge tube, vortex to mix, centrifuge briefly, and collect the liquid on the cap and wall of the centrifuge tube to the bottom of the tube.
[0063] (14) Place the centrifuge tube on the magnetic rack. After about 30 seconds, when the solution becomes clear, the supernatant is the obtained nucleic acid solution.
[0064] The nucleic acid solution obtained above was then pretreated with the methylation detection sample pretreatment reagent in the kit. 20 μL of the resulting nucleic acid solution was added to 130 μL of CT conversion agent, and the C / T conversion process was completed on a PCR instrument according to the procedure in Example 2. Purification was then performed as follows: (1) Binding: Take a 1.5 mL centrifuge tube, add 600 μL of binding solution and 10 μL of magnetic beads, then add 150 μL of the above conversion product, vortex to mix for 5 s-10 s, and incubate at room temperature for 5 min. Centrifuge briefly, place the centrifuge tube on a magnetic rack for 30 s-60 s, and remove and discard the supernatant after the solution becomes clear.
[0065] (2) Cleaning 1: Hold the centrifuge tube on the magnetic rack, add 400 μL of cleaning solution, cap the tube, remove the centrifuge tube, vortex to mix for 5-10 seconds, and then centrifuge briefly to collect the liquid in the centrifuge tube. Place the centrifuge tube on the magnetic rack for 30-60 seconds, and after the solution becomes clear, remove and discard the supernatant.
[0066] (3) Desulfurization: Keep the centrifuge tube on the magnetic rack, add 200 μL of desulfurizing agent, cover the tube, remove the centrifuge tube, vortex to mix for 5-10 seconds, and let stand at room temperature for 15-20 minutes. Collect the liquid in the centrifuge tube by instantaneous centrifugation, place the centrifuge tube on the magnetic rack for 30-60 seconds, and after the solution is clear, remove and discard the supernatant.
[0067] (4) Cleaning 2: Hold the centrifuge tube on the magnetic rack, add 400 μL of cleaning solution, cap the tube, remove the centrifuge tube, and vortex to mix for 5-10 seconds. Collect the liquid in the centrifuge tube by instant centrifugation, place the centrifuge tube on the magnetic rack for 30-60 seconds, and remove and discard the supernatant after the solution has clarified.
[0068] (5) Cleaning 3: Repeat step (4), and then try to remove as much residual liquid as possible from the tube to help the magnetic beads dry.
[0069] (6) Transfer the centrifuge tube to a metal bath at 55°C and place it for 15 minutes to remove the residual cleaning solution until the surface of the magnetic beads becomes completely matte.
[0070] (7) Add 30 μL of elution buffer to the centrifuge tube, vortex for 5-10 seconds, incubate at 55°C for 4 minutes, centrifuge briefly, place on a magnetic rack, and wait for the solution to become clear. The supernatant is the BISDNA solution to be tested.
[0071] Subsequently, the fluorescence PCR reaction system and procedure described in Example 1 were used for detection. After calculating the ΔCt value, different degrees of methylation were obtained, such as... Figure 4 As shown in Table 10, the scoring ranges for different lesion degrees can then be obtained.
[0072] Table 10 Scoring Intervals for Different Lesion Severities In summary, the present invention has the following advantages: (1) Simple operation. When testing cervical exfoliated cell samples, the solution can be extracted directly without centrifugation or other operations, which is suitable for large sample screening.
[0073] (2) Small sample volume. Only 200μL-400μL of sample is needed to complete the test, realizing multiple tests in one tube for cervical cancer screening and treatment, without the need for repeated sampling of patients.
[0074] (3) Excellent inclusiveness. It can accurately detect high-grade cervical intraepithelial neoplasia, squamous cell carcinoma, and adenocarcinoma of the cervix in both HPV-negative and HPV-positive cases, with higher sensitivity and better specificity.
[0075] (4) Low reagent cost. Sufficient nucleic acid can be obtained by pure chemical lysis during nucleic acid extraction, without the need for expensive proteinase K to assist in lysis. The same low-cost chemical reagents can be used in the methylation pretreatment, without the need for expensive enzymatic methods.
[0076] (5) It is compatible with a wide range of sample types, including single-use, dual-use, and triple-use cell preservation solutions from Cortia Biotechnology, and ThinPrep solution from Hologic.
[0077] (6) The technical solution is adaptable to multiple application scenarios. The two sample pretreatment modules included in the kit can be completed by manual operation or fully automated equipment, which can flexibly adapt to different application scenarios.
[0078] The above embodiments are only used to illustrate the technical ideas and features of the present invention, and are not intended to be unique or to limit the present invention. Those skilled in the art should understand that various changes or equivalent substitutions made to the present invention without departing from its scope are all within the scope of protection of the present invention.
Claims
1. A set of gene methylation primer-probe compositions for assisting in the identification of cervical lesions, characterized in that, The primer and probe composition is associated with six genes: PAX1, SOX1, EPB41L3, ST6GALNAC5, SOX14, and ZNF671. PAX1-qF: TTTGGAGCGGGCG; PAX1-qR: GCCCGAAAACCGAA; PAX1-Probe: GACCCAACCGCGAACTAAAAACG; SOX1-qF:GAGCGGGTATTGGC; SOX1-qR:AAAAATCAAACGACTCA; SOX1-Probe:TTAGTGTACGTCGCGGTCGAGA; EPB41L3-qF:TTTTACGAGGTGCG; EPB41L3-qR: AACCGCGCGACGCCG; EPB41L3-Probe:CGAGGTTTGGGGCGAGGC; ST6GALNAC5-qF:CGTTGAGAGATTACGAGGGTTC; ST6GALNAC5-qR:CGACCGCGACAAATCG; ST6GALNAC5-Probe: GCGAAACCCGAAAAACCGG; SOX14-qF:CGTGGGGGTTTTCGAC; SOX14-qR:TAAACTACGCGAAATC; SOX14-Probe:CGCGTTCGAGAAAGTTCG; ZNF671-qF:CGGAAGTGTTTTGCGTTTTC; ZNF671-qR: ACCCCACCCGCGCGA; ZNF671-Probe:CGTTTGTCGTTTTCGGTAGTTGTTC; Internal reference gene-qF: GGAATTTTGTAGGTTTTATTTG; Internal reference gene-qR: CCTACACCCACAACACTATCT; Internal reference gene - qProbe: TAAACACCTAATCAAAAAAACAAACACCA.
2. The gene methylation primer-probe composition for assisting in the identification of cervical lesions according to claim 1, characterized in that, The probe sequence is labeled with fluorescent and quenching groups.
3. The gene methylation primer-probe composition for assisting in the identification of cervical lesions according to claim 2, characterized in that, The fluorescent group is one of FAM, HEX, VIC, ROX, JOE, or CY5, and the fluorescent group is labeled at the 5' end or 1-5 bp bases from the 5' end of the probe sequence.
4. The gene methylation primer-probe composition for assisting in the identification of cervical lesions according to claim 2, characterized in that, The quenching group is one of BHQ1, BHQ2, and BHQ3, and the quenching group is labeled at the 3' end of the probe sequence, or at a position of 1-5 bp from the 3' end.
5. A kit for assisting in the identification of cervical lesions, characterized in that, The mixture includes nucleic acid extraction or purification reagents, methylation detection sample pretreatment reagents, PCR reaction mixtures, primer-probe mixture 1, primer-probe mixture 2, and positive and negative control compounds. Primer-probe mixture 1 and primer-probe mixture 2 each contain the primer-probe composition described in any one of claims 1-4.
6. The use of the primer-probe composition according to any one of claims 1-4, characterized in that, Use in the preparation of kits for diagnosing HPV-negative or HPV-positive high-grade cervical intraepithelial neoplasia, cervical squamous cell carcinoma, and cervical adenocarcinoma.
7. A diagnostic model, characterized in that, Related to six genes: PAX1, SOX1, EPB41L3, ST6GALNAC5, SOX14, and ZNF671, gene methylation detection was performed using the kit described in claim 5, and the results were interpreted by a diagnostic model. The formula for the diagnostic model is as follows: P=(e^Z) / (1-e^Z); Z=12.130-0.040*△Ct(PAX1)-0.125*△Ct(SOX1)-0.220*△Ct(EPB41L3 )-0.052*△Ct(ST6GALNAC5)-0.371*△Ct(SOX14)-0.336*△Ct(ZNF671); △Ct(gene) = gene Ct value - internal reference gene Ct value.
8. The diagnostic model according to claim 7, characterized in that, in, When the P value is ≥0.46, it indicates that the cervix may have high-grade intraepithelial neoplasia, cervical squamous cell carcinoma, or cervical adenocarcinoma; when the P value is <0.46, it indicates that the risk of high-grade intraepithelial neoplasia, cervical squamous cell carcinoma, or cervical adenocarcinoma is low.
Citation Information
Patent Citations
Composition and kit for early detection of cervical high-grade lesions and cervical cancer
CN112048561A
Cervical high-level lesion related gene methylation qPCR (quantitative polymerase chain reaction) detection kit as well as use method and system
CN115927636A
Nucleic acid product for detecting HPV negative cervical cancer, kit and application
CN118581218A
PCR (Polymerase Chain Reaction) primer probe combination and kit for detecting methylation of cervical cancer gene and application of PCR primer probe combination and kit
CN118685524A
Composition and kit for detecting cervical cancer and high-grade cervical lesions and application
CN118755838A