Biomarker for diagnosing respiratory syncytial virus and application thereof

Abstract

The invention discloses a biomarker for diagnosing respiratory syncytial virus and application of the biomarker, and belongs to the technical field of molecular biology and medical diagnosis. The biological marker lncRNA SRGAP2-AS1 is remarkably related to the RSV infection state, the lncRNA SRGAP2-AS1 shows stable differential expression characteristics under the RSV infection condition, the lncRNA SRGAP2-AS1 can interact with RNA binding protein PTBP1, specificity exists between the lncRNA SRGAP2-AS1 and expression changes of RSV infection related molecules and expression changes of epithelial-mesenchymal transition (EMT) related markers, and the lncRNA SRGAP2-AS1 can be used for detecting the RSV infection related markers. The lncRNA SRGAP2-AS1 can be used for carrying out accurate and specific detection and auxiliary diagnosis on RSV (Respiratory Syndrome Virus) infection.

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and medical diagnostics, specifically to a biomarker for diagnosing respiratory syncytial virus (RSV) and its application. More particularly, it relates to the application of a long noncoding RNA (lncRNA) in the early diagnosis of RSV infection. Background Technology

[0002] Long non-coding RNAs (lncRNAs) are RNA molecules longer than 200 nucleotides that have little or no protein-coding capabilities. Studies have shown that lncRNAs are significantly more numerous and diverse than protein-coding mRNAs in the genome, but the number of lncRNAs with clearly defined biological functions remains relatively limited. Both human gene-encoded lncRNAs and viral-encoded lncRNAs can regulate host gene expression, and these genes may be involved in important processes such as viral replication, latency, and signaling pathway activation. Currently, increasing evidence suggests that lncRNAs play crucial roles in a variety of biological processes.

[0003] Respiratory syncytial virus (RSV) is a major cause of respiratory infections in humans. It is a single-stranded, negative-sense RNA virus belonging to the orthopneumovirus genus and is one of the most common causes of severe respiratory infections worldwide, particularly in infants, the elderly, and immunocompromised individuals. Clinically, serological immunoassays are generally used for detection. RSV testing is used to diagnose recent RSV infection, while nucleic acid testing can be used for rapid confirmation of viral infection. Because early clinical symptoms of RSV infection lack specificity, current rapid nucleic acid testing methods have limited ability to identify RSV infection in its early stages. Therefore, achieving early identification and accurate diagnosis of RSV infection is crucial for preventing further deterioration and progression to severe lower respiratory tract infections. Summary of the Invention

[0004] To address the lack of stable, specific molecular biomarkers in existing technologies that can be used for early identification and auxiliary diagnosis of respiratory syncytial virus (RSV) infection, this invention proposes a biomarker for diagnosing RSV and its application, primarily to improve the detection accuracy and clinical application value of RSV infection.

[0005] To achieve the above objectives, the present invention is implemented through the following technical solution: The first objective of this invention is to provide a biomarker for diagnosing respiratory syncytial virus (RSV), wherein the biomarker is a lncRNA molecule. lncRNA refers to long non-coding RNA, that is, a class of RNA molecules that are longer than 200 nucleotides and have little or no protein-coding ability.

[0006] Furthermore, the lncRNA molecule is mainly SRGAP2-AS1. The SRGAP2-AS1 of this invention can interact with the RNA-binding protein PTBP1 and is correlated with changes in the expression of RSV infection-related molecules and changes in the expression of epithelial-mesenchymal transition (EMT)-related markers.

[0007] The second objective of this invention is to provide an application of the biomarker lncRNA SRGAP2-AS1 in the preparation of products for the detection or diagnosis of respiratory syncytial virus.

[0008] Furthermore, the product is a testing reagent or kit.

[0009] Furthermore, the detection reagent or kit detects the expression level of SRGAP2-AS1 in biological samples.

[0010] Furthermore, in biological samples, the expression level of lncRNA SRGAP2-AS1 was positively correlated with the degree of respiratory syncytial virus infection or its detection.

[0011] Furthermore, the biological samples are selected from oral secretions, serum, and bronchoalveolar lavage fluid, wherein oral secretions include sputum and pharyngeal swabs; and serum includes peripheral blood.

[0012] Furthermore, the product, namely the test reagent or kit, is used for the detection, auxiliary diagnosis, or assessment of respiratory syncytial virus infection.

[0013] The present invention relates to biomarkers for the diagnosis of respiratory syncytial virus and their applications, the beneficial effects of which are: (1) The biomarker lncRNA SRGAP2-AS1 of the present invention is significantly correlated with RSV infection status. lncRNA SRGAP2-AS1 exhibits stable differential expression characteristics under RSV infection conditions. Furthermore, lncRNA SRGAP2-AS1 can interact with RNA-binding protein PTBP1 and is specific to changes in the expression of RSV infection-related molecules and changes in the expression of epithelial-mesenchymal transition (EMT)-related markers. lncRNA SRGAP2-AS1 can accurately and specifically detect and assist in the diagnosis of RSV infection.

[0014] (2) This invention uses lncRNA SRGAP2-AS1 as a biomarker for RSV infection, which is different from the existing RSV diagnostic methods that mainly rely on viral nucleic acid or antigen detection. It detects and diagnoses through the expression characteristics of host molecules, which has the advantages of relatively simple sampling, good stability and suitability for auxiliary diagnosis. It can provide a new technical means for the early identification and clinical judgment of RSV infection.

[0015] (3) lncRNA SRGAP2-AS1 was highly expressed in bronchial epithelial cells and mouse lung tissue after RSV infection; in clinical samples, compared with uninfected individuals, the expression of SRGAP2-AS1 in the sputum of RSV-infected patients was significantly increased. This indicates that SRGAP2-AS1 can serve as a molecular marker reflecting RSV infection status, with advantages such as good reproducibility and promising application prospects.

[0016] (4) The biomarker lncRNA SRGAP2-AS1 of this invention can reflect the degree of viral infection to a certain extent. The expression of LncRNA SRGAP2-AS1 in airway epithelial cells BEAS-2B was significantly increased after RSV infection. The viral virulence of BEAS-2B cells was significantly reduced when the expression of LncRNA SRGAP2-AS1 was knocked down. LncRNA SRGAP2-AS1 increased the expression of RSV-infected mouse virus. The expression of LncRNA SRGAP2-AS1 in clinical specimens was higher than that in healthy individuals. The increased expression in RSV may be due to its binding to PTBP1, affecting RSV virulence, and regulating ZEB1, leading to changes in the expression of EMT-related markers after RSV infection. In vitro and in vivo experiments showed that knocking down lncRNA SRGAP2-AS1 can reduce RSV viral titer and viral mRNA expression, while regulating the expression of host inflammation-related genes, suggesting that it plays an important role in viral replication and infection. It has important clinical value and social significance for targeted intervention research on core hub targets and mechanisms in the evolution of RSV infection. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1This is a schematic diagram of RNA-seq results for RSV-infected BEAS-2B cells in an embodiment of the present invention; wherein (A) is a volcano plot analysis of RNA-seq results in BEAS-2B cells 24 h after infection with 400 TCID50 RSV, where Up indicates upregulation, Down indicates downregulation, and NoSig indicates no difference. (B) is a hotspot analysis diagram of differential expression in RNA-seq; where red indicates upregulation and blue indicates downregulation. Figure 2 This is a schematic diagram of the expression of lncRNA SRGAP2-AS1 after RSV infection of BEAS-2B cells by TCID50 assay in Example 2 of the present invention; wherein (A) the expression of lncRNA was detected by PCR method after BEAS-2B cells were infected with 400 TCID50 RSV for 24 h; and (B) the expression of lncRNAs was detected by RT-qPCR method after BEAS-2B cells were infected with 400 TCID50 RSV for 24 h. Figure 3 This is a schematic diagram of RSV viral virulence detection obtained by constructing a plasmid to knock down the expression of lncRNA SRGAP2-AS1 in Example 3 of the present invention and then detecting RSV viral virulence using the TCID50 method. Figure 4 This is a schematic diagram of the expression of RSV mRNA detected by RT-qPCR in Example 4 of the present invention after 24 hours of infection with 400 TCID50 RSV overexpressing stable transgenic strain; Figure 5 This is a schematic diagram illustrating the protein binding effect of lncRNA SRGAP2-AS1 in Example 5 of the present invention, wherein (A) downstream binding proteins of lncRNA SRGAP2-AS1 are predicted using bioinformatics analysis methods. (B) The binding of lncRNA SRGAP2-AS1 to PTBP1 protein is detected by RIP method. (C) The RSV mRNA level and lncRNA SRGAP2-AS1 expression are detected by RT-qPCR method after BEAS-2B infection with 400 TCID50 RSV and siRNA interference of the PTBP gene. Figure 6 This is a schematic diagram of detecting the gene expression of E-Cadherin, N-Cadherin and α-SAM in the BEAS-2B stable cell line with knockdown of lncRNA SRGAP2-AS1 in Example 6 of the present invention. Figure 7 This is a schematic diagram showing the results of detecting the expression level of lncRNA SRGAP2-AS1 mRNA in mouse lung tissue homogenate after RSV infection using RT-qPCR in Example 7 of the present invention. Figure 8 This is a schematic diagram illustrating the changes in lncRAN SRGAP2-AS1 expression in the homogenates of lung, heart, liver, spleen, and kidney tissues of mice in each group, as detected by RT-qPCR in Example 8 of this invention. Figure 9 This is a schematic diagram of the RT-qPCR method used in Example 9 of the present invention to detect the expression of RSV mRNA in lung tissue homogenate after knockdown of mouse lncRNA SRGAP2-AS1; Figure 10 This is a schematic diagram of staining of lung tissue infected with RSV after mouse lncRNA SRGAP2-AS1 knockdown was detected by HE method in Example 9 of the present invention; Figure 11 This is a schematic diagram of the results of RSV-infected lung tissue in mice in Example 10 of the present invention; wherein (A) the lung tissue infected with RSV after mouse lncRNA SRGAP2-AS1 knockdown was detected by IHC method; and (B) the protein expression in the lung tissue infected with RSV after mouse lncRNA SRGAP2-AS1 knockdown was detected by WB method. Figure 12 This is a schematic diagram illustrating the detection of lncRNA SRGAP2-AS1 expression in the sputum of RSV-infected and uninfected patients by RT-qPCR in Example 11 of the present invention. Detailed Implementation

[0019] The present invention will be further described in detail below with reference to specific embodiments and accompanying drawings.

[0020] The first embodiment of the present invention provides the application of the biomarker lncRNA SRGAP2-AS1 in the detection and diagnosis of respiratory syncytial virus.

[0021] A second embodiment of the present invention provides the use of the biomarker lncRNA SRGAP2-AS1 in the preparation of products for the detection or diagnosis of respiratory syncytial virus (RSV). These products include, but are not limited to, detection reagents or kits, diagnostic reagents or kits. The products may also include reagents or kits for assessing RSV infection status.

[0022] The biomarker lncRNA SRGAP2-AS1 of this invention is mainly determined by the expression level of SRGAP2-AS1 in oral secretions or peripheral blood. The expression level of lncRNA SRGAP2-AS1 is positively correlated with RSV infection; that is, the higher the expression level of lncRNA SRGAP2-AS1 in oral secretions or peripheral blood, the greater the likelihood of RSV infection.

[0023] Example 1

[0024] Screening of the biomarker lncRNA SRGAP2-AS1 Gene sequencing was used, and the cells used were BEAS-2B airway epithelial cells from human post-infection.

[0025] Sequencing of RSV-infected BEAS-2B cells revealed the most differentially expressed genes and the top-ranking lncRNAs. RNA sequencing was performed according to the sequencing sample standards of Shenzhen Egene Technology Co., Ltd., and the expression levels of lncRNAs in the infected and control groups were analyzed. LncRNAs showing differential expression between the two groups were screened. Further screening was conducted based on the degree of differential expression and statistical significance, combined with literature review, to obtain several candidate lncRNAs (such as...). Figure 1 (As shown), for use in subsequent research.

[0026] Specific methods: (1) Cell treatment: BEAS-2B cells were infected with RSV at concentrations of 20, 100, 200, and 400 TCID50 / mL for 12-72 h (the initial RSV viral titer was 104.2 TCID50 / mL). The RSV viral titer, BEAS-2B cell proliferation, and BEAS-2B cytopathic effect (CPE) were detected at different time points. It was found that with the increase of infection time and RSV viral titer, the titer of RSV infected at 400 TCID50 / mL for 24 h was higher than that of the control group (BEAS-2B epithelial cells without RSV) and the inhibition of cell proliferation was the most significant. Thus, an RSV-infected BEAS-2B cell model was constructed.

[0027] (2) Transcriptome sequencing: BEAS-2B cells infected with RSV were sequenced at 10 cm⁻¹. 2 Add 1 ml of TRIzol reagent to the culture area (equivalent to one well of a six-well plate or a 35 mm diameter culture dish); repeatedly pipette the solution to ensure that the TRIzol reagent contacts all the surface of the culture flask with cells and digests them thoroughly. Repeatedly agitate the cells until no clumps of cells are visible; transfer the solution to centrifuge tubes, flash freeze in liquid nitrogen, and store at -80°C.

[0028] from Figure 1 As can be seen, the expression of LncRNA SRGAP2-AS1 in BEAS-2B airway epithelial cells significantly increased after RSV infection. This indicates that LncRNA SRGAP2-AS1 can serve as a biomarker for the detection and diagnosis of respiratory syncytial virus.

[0029] Example 2

[0030] Validation of differentially expressed lncRNAs after respiratory syncytial virus (RSV) infection The specific steps for determining viral titer using TCID50 are as follows: (1) Hep-2 cells in good growth condition were divided into groups of 5×10⁻⁶ cells. 3 / 100ul was inoculated into 96-well plates and the plates were placed in an incubator for overnight incubation (37°C, 5% CO2). (2) Viral group (i.e.) Figure 2 The virus suspension (infected group) was diluted 10-fold with serum-free medium, and the concentrations were 10... -1 10 -2 10 -3 10 -4 10 -5 10 -6 10 -7 10 -8 Eight concentrations were prepared. When the cell density reached approximately 50-60%, the culture medium was aspirated, the cells were washed twice with PBS, and then inoculated with the diluted virus. Each dilution was inoculated into eight wells at a rate of 50 μL / well. A control group was set up (i.e.,...). Figure 2 The uninfected group consisted of normal cells without the virus, while the control group consisted of normal cells without the virus and 50 μL of cell maintenance medium were added. (3) Place the 96-well plate in a 37℃, 5% CO2 incubator for 90 min to adsorb the virus. Remove the cells every 15 min and gently shake them in a cross shape several times to ensure even virus adsorption. After 90 min, discard the virus solution, add 100 μL of maintenance medium to each well, and continue culturing in a 37℃, 5% CO2 incubator. Observe the CPE condition. The endpoint is when no new lesions appear at the highest dilution. The degree of cytopathic effect is indicated by "-" / "+", with "-" for no cytopathic effect and "++++" for 75% cytopathic effect. The virus TICD50 was calculated using the ReedMuench formula: a. Distance ratio = (Lesion rate higher than 50% - 50%) / (Lesion rate higher than 50% - Lesion rate lower than 50%) b. The difference between the distance ratio and the logarithm of dilution, plus the index of the dilution of the virus with a 50% virulence rate, is the TCID50.

[0031] (4) RNA extraction: BEAS-2B cells were extracted at a concentration of 2×10⁻⁶. 5The cells were seeded into 6-well plates and grown for 24 hours, then washed twice with PBS. BEAS-2B cells were infected with 400 TCID50 RSV according to the TCID50 values ​​calculated based on the experimental groups. The cells were incubated at 37°C in a 5% CO2 incubator for 1.5 hours, gently agitated every 15 minutes to ensure even adsorption. Virus maintenance medium was added to a final volume of 2.5 ml / well, and the cells were incubated at 37°C in a 5% CO2 incubator for 24 hours before RNA extraction. Discard the cell culture medium, wash the cells twice with PBS, aspirate the PBS, add 200 μL of cell lysis buffer, let stand for 1-2 min, gently pipette the cell lysis buffer until it is no longer viscous and the solution is clear, transfer to a sterile 1.5 mL EP tube (enzyme-free), then add an equal volume of isopropanol, gently invert and mix 5 times; transfer the mixture of lysis buffer and binding buffer to a purification column, centrifuge at 12000 rpm for 30 s, discard the liquid in the collection tube; add 600 μL of wash buffer I (75% ethanol) to the purification column, centrifuge at 12000 rpm for 30 s, discard the liquid in the collection tube; then add 600 μL of wash buffer II, centrifuge at 12000 rpm for 30 s, and repeat the washing step with wash buffer II (75% ethanol); after washing, centrifuge at 15000 rpm for 2 min to remove residual liquid in the adsorption column; Remove the adsorption column and place it into an RNA elution tube. Add 30-50 μL of elution buffer dropwise into the adsorption column, let it stand for 3 minutes, and centrifuge at 12000 rpm for 1 minute. The eluted liquid is the purified RNA. Use NanaDrop to determine the concentration and purity of the purified RNA. A 260 / 280 ratio between 1.8 and 2.0 indicates good RNA purity. (5) RT-qPCR quantitative detection: Take a portion of the high-purity RNA obtained in step (4) for reverse transcription, and store the remaining RNA in a -80℃ freezer. Follow the instructions of the RNA reverse transcription kit, add ≤1μg total RNA, 1ul StarScript III All-in-one RT Mix, 4ul 5×StarScript III All-in-one RT Buffer, and Nuclease-free Water (DEPC-treated) to a total of 20μL. Accurately add each sample to an eight-tube strip, for a total of 20μL. After mixing, centrifuge and place in a fluorescent PCR instrument. Perform reverse transcription for 40 cycles: pre-denaturation at 95℃ for 2min, denaturation at 95℃ for 15s, annealing at 60℃ for 15s, and extension at 72℃ for 30s.

[0032] The results obtained are as follows Figure 2 As shown, from Figure 2 As can be seen, the differential expression of lncRNA SRGAP2-AS1 is the most significant.

[0033] Example 3

[0034] The effect of lncRNA SRGAP2-AS1 deletion on RSV viral virulence is investigated through the following steps: (1) Construction of plasmid for knocking down lncRNA SRGAP2-AS1: The pSIH1-H1-Puro vector was selected for constructing the plasmid for knocking down lncRNA SRGAP2-AS1. Three sh-lncRNA sequence primers were designed for lncRNA SRGAP2-AS1 using the Thermofisher pre-designed shRNA website (Invitrogen Block-iTRNAi Designer (thermofisher.com)). BamHI and EcoRI restriction sites were selected and the primers were synthesized. The sequences of the three sh-lncRNA sequence primers are shown in Table 1.

[0035] Table 1. lncRNA SRGAP2-AS1 sh-lncRNA sequence

[0036] (2) Treatment of sh-lncRNA SRGAP2-AS1 primers: Take 10 μL (stock solution) of each of the three primers’ forward / reverse primers into a 200 μL PCR reaction tube, mix well, place in a PCR instrument, set the conditions to 98℃ for 10 min, and store at -20℃ after natural cooling.

[0037] (3) Enzyme digestion: Take 5 μL of 10×fast digest buffer, 43 μL of pSIH1-H1-Puro vector plasmid, and add 1 μL of LEcoRI and BamHI enzyme respectively. The total volume is 50 μL. Mix well, centrifuge, and place in a 37℃ water bath overnight.

[0038] (4) Gel recovery: Perform agarose gel electrophoresis on the vector digested in the previous step to determine whether the target vector size is accurate; under UV light, cut the target band and place it in a sterile EP tube. Follow the instructions of the Genestar gel recovery kit to recover the cut band; use NanaDrop to determine the concentration and purity of the recovered product, and perform agarose gel electrophoresis again to confirm whether the recovered product has been successfully recovered. Then store at -20℃.

[0039] (5) Continue to construct stable cell lines: 293T cells were cultured in 10 mm culture dishes. When the cells grew to a density of about 80%, the lentiviral expression vector and packaging vector were co-transfected into the cells. (6) Transfection: Follow the instructions for the DNA / RNA Transfection Reagent. Use 60 μL of 100 mL transfection reagent, 60 μg of plasmid DNA, and 15 mL of culture medium. The specific transfection method is as follows: ① Complex preparation: Add 30 μg of plasmid DNA, 15 μg each of packaging vectors (psPAX2 and pMD2.G), and 60 μL of transfection reagent to a sterile 1.5 mL EP tube. Mix gently by pipetting and let stand at room temperature for 15 min. ② Add the above complex to the 293T cell culture medium, and gently shake the culture flask to mix the complex evenly with the culture medium; ③ 24 hours after transfection, aspirate the supernatant into a 15 mL sterile centrifuge tube and store at 4°C for later use. Then add 10 mL of fresh complete culture medium and continue culturing for 48 hours and 72 hours. Again, aspirate the supernatant into a 15 mL sterile centrifuge tube. ④ 48 hours after transfection, cell fluorescence can be observed using a fluorescence microscope to assess transfection efficiency; ⑤ Centrifuge the supernatant recovered in step ③ at 4000 rpm for 15 min at 4℃, filter the supernatant using a 0.45 μm filter head to obtain the crude lentivirus extract, then aliquot and store at -80℃ for subsequent experiments.

[0040] (7) Further lentiviral infection: BEAS-2B cells were infected with crude lentiviral extract carrying lncRNA SRGAP2-AS1. BEAS-2B cells were cultured in 25 cm² culture flasks. When the cell density reached approximately 60%, the culture medium was aspirated, and the cells were washed once with PBS. The PBS was then aspirated. A knockdown vector carrying lncRNA SRGAP2-AS1 was added to the culture flask. Figure 3 3 mL of lentiviral solution from the shRNASRGAP2-AS1 group and 3 mL of lentiviral solution from the empty vector (i.e., the stable transfectant carrying the non-knockdown sequence) were used as the control group. Figure 3 (sh-NC group), gently shake the culture flask to ensure full contact between the virus solution and the cells; replace with 3 mL of fresh lentivirus solution 24 h and 48 h after infection, respectively. After 72 h of continuous infection, the cell fluorescence can be observed under a fluorescence microscope. If the cells show red fluorescence, it indicates that the lentivirus solution has been transfected into the cells. The lncRNA SRGAP2-AS1 knockdown vector needs to carry the puromycin resistance gene. Screening should be performed using complete culture medium containing puromycin. After the cells are infected with lentiviral solution for 72 hours, the medium should be replaced with complete culture medium containing 10 μg / mL puromycin. If the cells are not successfully infected by the virus, they will die. The cell growth status should be observed daily, and the concentration of puromycin can be gradually reduced until the cells no longer die. Finally, the surviving cells obtained from the screening are cultured with a low concentration of puromycin, and the fluorescence of the cells can be observed using a fluorescence microscope.

[0041] (8) The screened cells obtained in step (7) were seeded into 6-well plates, and the cell RNA and protein were extracted respectively. The mRNA and protein levels of the target molecules were detected to determine the knockdown or overexpression efficiency. If the construction was successful, the cell culture was expanded and some cells were frozen and stored in a freezer at -80°C or in liquid nitrogen. RNA extraction and RT-qPCR quantitative detection were the same as in Example 2.

[0042] The results obtained are as follows Figure 3 As shown, from Figure 3 Furthermore, the results showed that the viral titer in the supernatant of the BEAS-2B stable transgenic strain infected with lncRNA SRGAP2-AS1 at different time points was detected using the TCID50 method at 400 TCID50. sh-NC represents stable transgenic strains carrying the non-knockdown sequence. Compared with the sh-NC group, the viral titer in the lncRNA SRGAP2-AS1 knockdown group was significantly decreased. Simultaneously, RT-qPCR was used to detect RSV mRNA expression, and compared with the sh-NC group, the RSV mRNA level in the lncRNA SRGAP2-AS1 knockdown group was significantly lower.

[0043] Example 4 The effect of lncRNA SRGAP2-AS1 overexpression on RSV virulence was verified using the following methods: (1) Vector selection: The plasmid for lncRNA SRGAP2-AS1 overexpression was constructed using the pIRES2-EGFP vector; (2) Primer design: The gene sequence of lncRNA SRGAP2-AS1 (NR_104189.1) was found in the NCBI database. Primers were designed (primer sequences are shown in Table 2) and inserted into two restriction sites, NheI and SalI. The whole gene sequence of lncRNA SRGAP2-AS1 was amplified by overlapping PCR. Each sample was accurately added to a 200 μL PCR reaction tube according to the following system: ddH2O 19 μL, 2×PhantaFlash Master Mix (DyePlus) 25 μL, F-primer (10 μM) 2 μL, R-primer (10 μM) 2 μL, and cDNA template 2 μL. The total system was 50 μL. After mixing, the sample was centrifuged and placed in a PCR instrument to amplify the three fragments of lncRNA SRGAP2-AS1. Then, the three fragments were ligated in pairs until they were the size of the target gene fragment, and the PCR product was obtained. Table 2 Primer sequences for lncRNA SRGAP2-AS1 name Primer sequence F GGAGGTGAAGTGAGGCAACATGAC R AACGATAGGCTGGCAGGAGGAG (3) Gel recovery: Perform agarose gel electrophoresis on the PCR products from the previous step to determine if the product size is accurate; under UV light, cut the target band and place it in a sterile EP tube. Follow the instructions of the Genestar gel recovery kit to recover the cut band; use NanaDrop to determine the concentration and purity of the recovered product, and perform agarose gel electrophoresis again to confirm whether the recovered product has been successfully recovered. Then store at -20℃.

[0044] (4) PCR product, vector plasmid digestion and purification: ① Take 5 μL of 10×fast digest buffer, 43 μL of pIRES-2 vector plasmid / oe-FTO PCR gel recovery product, and then add 1 μL of NheI and SalI enzymes respectively, with a total volume of 50 μL. Mix well, centrifuge, and place in a 37℃ water bath overnight; ② Perform gel recovery, purification and gel electrophoresis verification on the enzyme digestion product from step ①.

[0045] (5) Lentiviral packaging: 293T cells were cultured in 10 mm culture dishes. When the cells reached a density of approximately 80%, the lentiviral expression vector and packaging vector were co-transfected into the cells. Transfection: The procedure was performed according to the DNA / RNA TransfectionReagent instructions. The transfection reagent volume was 60 μL for 100 mm, the plasmid DNA transfection volume was 60 μg, and the culture medium volume was 15 mL. The specific transfection method was as follows: ① Complex preparation: Add 30 μg of plasmid DNA, 15 μg each of packaging vectors (psPAX2 and pMD2.G), and 60 μL of transfection reagent to a sterile 1.5 mL EP tube, mix gently by pipetting, and let stand at room temperature for 15 min; ② Add the above complex to the 293T cell culture medium, and gently shake the culture flask to mix the complex evenly with the culture medium; ③ 24 hours after transfection, aspirate the supernatant into a 15 mL sterile centrifuge tube and store at 4°C for later use. Then add 10 mL of fresh complete culture medium and continue culturing for 48 hours and 72 hours. Again, aspirate the supernatant into a 15 mL sterile centrifuge tube. ④ 48 hours after transfection, cell fluorescence can be observed using a fluorescence microscope to assess transfection efficiency; ⑤ Centrifuge the supernatant recovered in step ③ at 4000 rpm for 15 min at 4℃, and filter the supernatant using a 0.45 μm filter head to obtain the crude lentivirus extract. Then aliquot the extract and store it at -80℃ for subsequent experiments.

[0046] (6) Lentiviral infection: The specific steps are as follows: 1) Infect BEAS-2B cells with crude lentivirus extract carrying lncRNA SRGAP2-AS1 overexpression vector. Culture BEAS-2B cells in a 25cm2 culture flask. When the cell density reaches about 60%, discard the culture medium; 2) Add 3mL of crude lentivirus extract carrying lncRNA SRGAP2-AS1 overexpression vector and 3mL of crude lentivirus extract with empty vector (as control group) to the culture flask. Gently shake the culture flask to ensure that the virus solution is in full contact with the cells; 3) Replace with 3mL of fresh crude lentivirus extract 24h and 48h after infection. After continuous infection for 72h, the cell fluorescence can be observed by fluorescence microscopy. If the cells show red fluorescence, it indicates that the lentivirus solution has been transfected into the cells. The lncRNA SRGAP2-AS1 overexpression vector carries a puromycin resistance gene and requires screening using a complete culture medium containing puromycin. After infecting cells with lentiviral solution for 72 hours, the medium is replaced with a complete culture medium containing 10 μg / mL puromycin. If the cells are not successfully infected by the virus, they will die. The cell growth status is observed daily, and the concentration of puromycin can be gradually reduced until cell death no longer occurs. Finally, the surviving cells obtained from the screening are cultured with a low concentration of puromycin, and the fluorescence of the cells can be observed using a fluorescence microscope.

[0047] (7) The screened cells obtained in step (6) were seeded into 6-well plates, and the cellular RNA and protein were extracted. The mRNA and protein levels of the target molecules were detected to determine the knockdown or overexpression efficiency. If the construction was successful, the cell culture was expanded, and some cells were frozen and stored in a freezer at -80°C or in liquid nitrogen. RNA extraction and RT-qPCR quantitative detection were the same as in Example 2.

[0048] The results are as follows Figure 4 As shown: RT-qPCR was used to detect stable transgenic strains overexpressing lncRNA SRGAP2-AS1 infected with 400 TCID50 RSV. Compared with the overexpression empty vector sequence group (oe-NC), the RSV mRNA level in the lncRNA SRGAP2-AS1 overexpression group (oeRNA-SRGAP2-AS1 group) was significantly upregulated.

[0049] Example 5 Mechanism of viral replication inhibition by knockdown of lncRNA SRGAP2-AS1 First, the potential binding protein PTBP1 of lncRNA SRGAP2-AS1 was predicted online using the catRAPID software. Then, the binding degree of RBP lncRNA SRGAP2-AS1 was further verified using the RIP method. The specific operation method is as follows: (1) Cell lysis (Time 30 min): Collect 2×10 7 Cell samples were washed with 4 mL of PBS, centrifuged at 1000 rpm for 5 min at room temperature, and the supernatant was discarded to collect the cell pellet. 1.7 mL of polysome lysis buffer, 17 μL of protease inhibitor, and 7.5 μL of RNase inhibitor were added to the cell pellet and vortexed. The mixture was placed on ice for 10 min, vortexed again, and then frozen at 80 °C for 5 min. After thawing at room temperature, the mixture was placed on ice for 5 min to obtain the cell lysis buffer. (2) DNA removal: Add 8.5 μL of DNase salt stock and 20 μL of DNase (20 U) to the cell lysate obtained in step (1), and incubate at 37°C for 10 min; 2) Transfer the sample to an ice bath, quickly add 9 μL of 0.5 M EDTA, 3.6 μL of 0.5 M EGTA, and 17 μL of DTT and mix thoroughly; then centrifuge at 16100 g for 10 min at 4°C and transfer the supernatant to a new RNase-free centrifuge tube; (3) Equilibrate protein A / G beads: Prepare 40 μL of protein A / G beads for both RIP samples. Add 0.5 mL of polysome lysis buffer to the beads, invert and mix 10 times, wash, collect the beads with a magnetic rack and discard the supernatant; add 0.5 mL of polysome lysis buffer to the beads again, invert and mix 10 times, wash, collect the beads with a magnetic rack and discard the supernatant; add 40 μL of polysome lysis buffer to the beads to restore the initial volume. This is the equilibrated bead. (4) Immunoprecipitation, the specific method is as follows: ① Divide the cell lysis buffer from step (1) into three portions: 0.8 mL (IP), 0.8 mL (IgG), and 0.1 mL (Input). Store the Input sample at -80℃ for later use. Add the experimental antibody to the IP and IgG samples respectively, and incubate them vertically at 4℃ for 16 h using a mixer (10 rpm). ② Add 40 μL of equilibrated protein A / G beads in half to the IP and IgG samples, incubate vertically at 4°C for 1 hour, collect the beads using a magnetic rack and discard the supernatant; ③ IP and IgG samples were washed three times with 0.5 mL of polysome washing buffer and 5 μL DTT, respectively, with shaking incubation at 4°C for 5 minutes each time. The magnetic beads were then collected using a magnetic rack and the supernatant was discarded. ④ IP and IgG samples were washed twice with 0.5 mL of polysome washing buffer and 5 μL of LTT, respectively, with shaking incubation at 4°C for 5 minutes each time. The magnetic beads were then collected using a magnetic rack and the supernatant was discarded. ⑤ For IP and IgG samples, add 200 μL of polysome elution buffer, 2 μL of DTT, and 2 μL of proteinase K to resuspend the beads, respectively. For input samples, add 100 μL of polysome elution buffer, 2 μL of DTT, and 2 μL of proteinase K. ⑥ Incubate at 55℃ for 1 h to elute RNA. Collect the supernatant using a magnetic rack and transfer it to a new RNase-free centrifuge tube. (5) RNA extraction, the specific steps are as follows: ① Add an equal elution volume (200 μL) of phenol-chloroform-isoamyl alcohol mixture to the IP, IgG, and Input samples, and mix by inverting for 15 seconds; ② Centrifuge at 13000g, 4℃ for 10 minutes, collect the upper aqueous phase, and transfer it to a new RNase-free centrifuge tube; ③ Add 1 μL of lycogen, 10 μL of sodium acetate, and 500 μL of 100% ethanol, and mix thoroughly by inverting. ④ Incubate at –80℃ for 3 hours to precipitate the RNA sample overnight; centrifuge at 16100 g for 30 minutes at 4℃, discard the supernatant; ⑤ Add 1 mL of pre-cooled 80% ethanol, centrifuge at 16100 g for 10 minutes at 4°C, discard the supernatant, and air dry at room temperature for 10 minutes; add 30 μL of RNase-free water to dissolve the RNA, and store at -80°C for later use; RT-qPCR quantitative detection is the same as in Example 2.

[0050] The results are as follows Figure 5 As shown, from Figure 5 As can be seen from the results, online prediction of the potential binding protein PTBP1 for lncRNA SRGAP2-AS1 using the catRAPID software revealed that PTBP1 has over 800 binding domains, and its binding prediction score is significantly higher than other proteins. Further verification of the binding degree between RBP1 and lncRNA SRGAP2-AS1 using the RIP method showed that lncRNA SRGAP2-AS1 expression was significantly increased in the IP group compared to the InPut group. Infection of the PTBP1 knockdown cell model with 400 TCID50 RSV and detection of RSV viral replication revealed a decrease in RSV mRNA levels, along with suppression of lncRNA SRGAP2-AS1 expression.

[0051] Example 6 The molecular mechanism by which lncRNAs regulate EMT markers after RSV infection was verified using the following method: (1) Culture BEAS-2B cells to 25 cm 2 In the culture flask, when the cells grow to a density of about 60%, the culture medium is discarded, the cells are washed once with PBS, and the PBS is then removed. (2) Add 3 mL of lentiviral solution carrying the lncRNA SRGAP2-AS1 knockdown vector and 3 mL of lentiviral solution with empty vector (as control group) to the culture flask, and gently shake the culture flask to ensure that the virus solution is in full contact with the cells; (3) Replace with 3 mL of fresh lentivirus solution 24 h and 48 h after infection. After 72 h of continuous infection, the cell fluorescence can be observed by fluorescence microscope. If the cells show red fluorescence, it means that the lentivirus solution has been transfected into the cells.

[0052] The lncRNA SRGAP2-AS1 knockdown vector carries the puromycin resistance gene and requires screening using complete culture medium containing puromycin. After infecting cells with lentiviral solution for 72 hours, the medium is replaced with complete culture medium containing 10 μg / mL puromycin. If the cells are not successfully infected by the virus, they will die. The cell growth status is observed daily, and the concentration of puromycin can be gradually reduced until cell death no longer occurs. The surviving cells selected are then cultured with a low concentration of puromycin, and the fluorescence of the cells can be observed using a fluorescence microscope.

[0053] (4) The selected cells were seeded in 6-well plates, and the RNA of the cells was extracted and the gene expression of E-Cadherin, N-Cadherin and α-SAM was quantitatively detected by RT-qPCR. The RNA of the cells was extracted and quantitatively detected by RT-qPCR as in Example 2.

[0054] The results are as follows Figure 6 As shown, the gene expression of E-Cadherin, N-Cadherin and α-SAM was detected in the BEAS-2B stable cell line with knockdown of lncRNA SRGAP2-AS1. It was found that after knockdown of lncRNA SRGAP2-AS1, the expression of E-Cadherin gene increased, while the expression of N-Cadherin and α-SAM gene decreased.

[0055] Example 7 In vivo validation of differential expression of lncRNA SRGAP2-AS1 (I) Establishment of a mouse model of RSV infection: Mice were anesthetized with ether and nasal instillation was initiated: Each mouse in the infection group was instilled with RSV (10... 5 50 μL of TCID50 was administered to mice in the uninfected group, and an equal volume of physiological saline was instilled into the nasal cavity for 3 consecutive days. The mice were then treated on the 7th day. The weight of the mice was recorded at the same time every day, and their mental state, eating, drinking and activity status (such as ruffled fur, arched back, runny nose, cough, etc.) were closely observed.

[0056] (ii) Take the constructed empty lentivirus group (N=8) and lentivirus knockdown group (N=6); on day 5 of the experiment, inject 50µl of lentivirus and lentivirus knockdown into the mice of the respective groups via intratracheal injection. On day 12, inject 50µl of lentivirus into the mice of the respective groups via intratracheal injection again. Then, the mice in the uninfected RSV group (N=6) were sacrificed on day 21 of the experiment. In the RSV-infected group (N=6), on day 21 of the experiment, mice were infected with 50µl of RSV virus solution via nasal drop. The mice were sacrificed on day 28 of the experiment.

[0057] The results are as follows Figure 7As shown, lncRNA SRGAP2-AS1 was expressed at elevated levels in mice with significant differences.

[0058] Example 8 Evaluation of the lncRNA SRGAP2-AS1 knockdown model constructed by intratracheal injection of lentivirus in mice.

[0059] 1. Model Establishment: Mice were administered the anesthetic via intraperitoneal injection at a rate of 400 μL per 20 g of mouse body weight. After anesthesia, the mice were fixed supine on a restraint board with their heads tilted back to expose the neck. If necessary, ether was inhaled to maintain the depth of anesthesia. The neck and chest area were disinfected with alcohol. The skin was incised along the midline of the neck, and the subcutaneous tissue was lightly dissected to expose the trachea; muscle dissection was not required. Under direct vision, the injection needle was inserted into the trachea at approximately a 30° angle, and 50 μL of the anesthetic solution was slowly injected. After administration, the restraints were released, and the mice were gently shaken to promote even distribution of the anesthetic solution in the lungs. Once respiration stabilized, the skin was sutured, and the mice were placed in a lateral recumbent position and kept warm for observation.

[0060] 2. Take the constructed empty lentivirus group (N=8) and lentivirus knockdown group (N=6); on day 5 of the experiment, inject 50µl of lentivirus and lentivirus knockdown into the mice of the respective groups via intratracheal injection. On day 12, inject 50µl of lentivirus into the mice of the respective groups via intratracheal injection again. Then, the mice in the uninfected RSV group (N=6) were sacrificed on day 21 of the experiment. In the RSV-infected group (N=6), on day 21 of the experiment, mice were infected with 50µl of RSV virus solution via nasal drop. The mice were sacrificed on day 28 of the experiment.

[0061] The expression of lncRNA SRGAP2-AS1 was detected by RT-qPCR after homogenization of tissues from organs such as the heart, liver, spleen, and kidneys. The results are as follows: Figure 8 As shown, the expression of lncRNA SRGAP2-AS1 was not different in organs and tissues such as the heart, liver, spleen and kidney.

[0062] Example 9 Effect of LncRNA SRGAP2-AS1 knockdown on RSV virulence in mice 1. Model Establishment: Mice were administered the anesthetic via intraperitoneal injection at a rate of 400 μL per 20 g of mouse body weight. After anesthesia, the mice were fixed supine on a restraint board with their heads tilted back to expose the neck. If necessary, ether was inhaled to maintain the depth of anesthesia. The neck and chest area were disinfected with alcohol. The skin was incised along the midline of the neck, and the subcutaneous tissue was lightly dissected to expose the trachea; muscle dissection was not required. Under direct vision, the injection needle was inserted into the trachea at approximately a 30° angle, and 50 μL of the anesthetic solution was slowly injected. After administration, the restraints were released, and the mice were gently shaken to promote even distribution of the anesthetic solution in the lungs. Once respiration stabilized, the skin was sutured, and the mice were placed in a lateral recumbent position and kept warm for observation.

[0063] 2. Take the constructed empty lentivirus group (N=8) and lentivirus knockdown group (N=6); on day 5 of the experiment, inject 50µl of lentivirus and lentivirus knockdown into the mice of the respective groups via intratracheal injection. On day 12, inject 50µl of lentivirus into the mice of the respective groups via intratracheal injection again. Then, the mice in the uninfected RSV group (N=6) were sacrificed on day 21 of the experiment. In the RSV-infected group (N=6), on day 21 of the experiment, mice were infected with 50µl of RSV virus solution via nasal drop. The mice were sacrificed on day 28 of the experiment.

[0064] 3. After homogenizing lung tissue, the expression of RSV mRNA in the sh-NC + RSV group and the shRNA SRGAP2-AS1 + RSV group was detected by RT-qPCR. The results are as follows: Figure 9 As shown.

[0065] HE staining of mouse lung tissue: (1) Dehydration and embedding: The fixed lung tissue was taken out and placed in a dehydration box, and then placed in an automatic dehydrator for dehydration. The dehydrated lung tissue was taken out and placed in a paraffin embedding box, placed on a paraffin embedding stage for embedding, and then stored in a -20℃ refrigerator; (2) Sectioning: Using a paraffin microtome, cut the wax block into sections with a thickness of 4μm. Then, spread the sections flat in a 40℃ slide and use a glass slide to retrieve them. The sections should be placed in the center of the slide, ensuring they are flat and wrinkle-free. The slides are then placed in a 60℃ oven to allow the paraffin to melt completely. (3) Dewaxing: Place the sections in xylene for 15 min, repeat this step once, then place them in 100%, 95%, 85%, and 75% ethanol for 3 min each, and then rinse under running water for 2 min; (4) Staining: Place the dewaxed sections in hematoxylin staining solution and let stand for 5 minutes. Rinse under running water for 2 minutes. Differentiate in differentiation solution for 3 minutes. Rinse under running water twice for 2 minutes each time. Then place the sections in eosin staining solution for 10-30 seconds. Quickly dehydrate in distilled water. Observe the degree of staining of eosin and hematoxylin under a microscope. Finally, air dry and mount the sections, taking care to avoid air bubbles during mounting. (5) Image acquisition was performed under an optical microscope, and the HE staining results are as follows: Figure 10 As shown.

[0066] (6) Lung tissue pathology score: The lung tissue HE pathology slides were scored according to the lung tissue pathology scoring system. See Table 3 for details. The total score is A + 3 × (B + C) + D + E, and the total score is 0-26 points.

[0067] Table 3 Lung Tissue Pathology Scoring Table

[0068] from Figure 9 and Figure 10 In summary, compared with the empty vector knockdown group, RSV mRNA expression decreased in the lncRNA SRGAP2-AS1 knockdown group.

[0069] The blank control group, sh-NC group, and lncRNA SRGAP2-AS1 knockdown group were included for comparison. Under the same growth conditions, compared with the blank control group and RSV infection followed by lncRNA SRGAP2-AS1 knockdown, intratracheal injection of lentivirus induced a lower level of inflammation. The empty lentivirus (sh-NC) group had the highest inflammation score after RSV infection, while the lncRNA SRGAP2-AS1 knockdown group had lower inflammation than the sh-NC group.

[0070] Example 10 Knockdown of lncRNA SRGAP2-AS1 downregulates EMT marker expression. To clarify the effect of lncRNA SRGAP2-AS1 knockdown on EMT in mouse lung tissue, sh-NC group (sh-NC+RSV) and lncRNA SRGAP2-AS1 knockdown group (sh-SRGAP2-AS1+RSV) infected with RSV at the same time and viral titer were selected. E-Cadherin protein expression was detected by IHC. The specific procedures were as follows: (1) Dewaxing: After the sample slides were completely dewaxed with xylene, they were treated with gradient ethanol as follows: soak in xylene I for 15 min and then lift up and down 10 times → soak in xylene II for 15 min and then lift up and down 10 times. Then, lift up and down 20 times in 100% ethanol I, 100% ethanol II, 95% ethanol, 80% ethanol and 70% ethanol respectively. Then, place the slides in a basin and rinse with running water for 10 min. (2) Antigen retrieval: According to the instructions, add one packet of citrate buffer powder to 2L of ultrapure water, adjust the pH, insert the slide into the stainless steel slide holder, and then put it into the pressure cooker containing citrate buffer, so that the slide is completely submerged in the citrate buffer. Heat on high until it sprays violently for 1 minute and 15 seconds, turn off the heat, rinse the pressure cooker with tap water to cool it down, and then take out the slide holder and put it in tap water to rinse the slide and remove the citrate buffer. (3) Endogenous oxidase blockade: an immunohistochemical pen was used to draw circles around the tissue, and 3% hydrogen peroxide was dropped onto the tissue. The treatment lasted for 15 mins to block endogenous peroxidase. The tissue was washed twice with PBS, with an interval of 3 min between each wash. Finally, the tissue was rinsed once with Tween PBS to eliminate surface tension. (4) Incubation of primary antibody: Drop the TLR3 and NF-kBp65 primary antibody containing blocking solution onto the tissue section, place it in a humidified chamber, and incubate overnight at 4°C; (5) Incubation with secondary antibody: Discard the antibody on the slide, and vigorously rinse the sample twice with a wash bottle containing PBS, with an interval of 3 min each time, to remove unbound primary antibody; finally, wash once with Tween PBS to eliminate surface tension. Add universal secondary antibody to the tissue and incubate at room temperature for 30 mins.

[0071] (6) DAB staining: Wash the slide twice with PBS at 3 min intervals, add DAB for 3 min, observe under a light microscope, wash, and mount. Western blot was used to detect the protein expression levels of α-SMA, E-Cadherin, and Collagen I in RSV-infected lung tissue after mouse lncRNA SRGAP2-AS1 knockdown.

[0072] Lung tissue from a mouse model with knocked-down lncRNA SRGAP2-AS1 and infected with RSV was placed in a pre-chilled grinder, liquid nitrogen was added, and the frozen tissue was rapidly pulverized using a grinding column. Lysis was then performed by adding 125 μL of lysis buffer per 10 mg of tissue, followed by pipetting and mixing. The mixture was transferred to a 1.5 mL EP tube, and the lysed sample was vortexed (30 seconds each time, 5 minutes apart, repeated 5 times). The sample was then centrifuged at 12000 rpm for 20 minutes at 4°C after pre-chilling. The supernatant obtained after centrifugation was collected in a new EP tube as the total protein extract. Protein concentration was determined using a BCA kit. After SDS-PAGE electrophoresis, the protein was electroporated onto a PVDF membrane, blocked with skim milk at room temperature for 1 h, and then incubated overnight at 4°C with primary antibody and low-speed shaking. Wash 3 times with 1×TBST (5 min / wash), add secondary antibody, incubate at room temperature and low speed for 1 h, wash 3 times with 1×TBST (7 min / wash), mix protein chemiluminescence A and B in a 1:1 ratio, drop onto PVDF membrane for color development, take pictures with gel imaging system, and perform grayscale scanning quantitative analysis.

[0073] The results are as follows Figure 10 As shown: Compared with the sh-NC+RSV group, the expression of E-cadherin protein was increased in the sh-SRGAP2-AS1+RSV group. Compared with the Control group, the expression of E-cadherin protein was decreased, while the expression of α-SMA and Collagen I proteins was increased in the sh-NC+RSV group. Compared with the RSV-infected sh-NC group, the lncRNA SRGAP2-AS1 knockdown group showed downregulated expression levels of α-SMA and Collagen I and upregulated expression of E-cadherin protein after RSV infection.

[0074] Example 11 Expression of lncRNA SRGAP2-AS1 in clinical samples We collected data from adult patients who presented with lower respiratory tract infection symptoms and were hospitalized in the respiratory wards and intensive care units of the First and Fifth Affiliated Hospitals of Zunyi Medical University between January 2021 and July 2023, and who met the inclusion and exclusion criteria. Inclusion criteria: 1) Presenting with typical lower respiratory tract infection symptoms before admission; 2) Acute onset, with a course of illness not exceeding 21 days; 3) Age ≥ 18 years. Diagnostic criteria: 1) Diagnostic criteria for lower respiratory tract infection in adults: ① Symptoms: Cough as the main symptom, accompanied by at least one other lower respiratory tract symptom (sputum production, dyspnea, wheezing, or chest discomfort / pain); ② Physical signs: Medium to fine moist rales heard on lung auscultation; ③ Ancillary examinations: Chest imaging showing newly appearing punctate or patchy infiltrates or ground-glass opacities, with or without pleural effusion. 2) Diagnostic criteria for severe patients (referring to the 2018 edition of the "Guidelines for the Diagnosis and Treatment of Community-Acquired Pneumonia in Chinese Adults"). ① Main criteria: a. Requires endotracheal intubation and mechanical ventilation. b. Septic shock still requires vasoactive drug therapy after aggressive fluid resuscitation. ② Secondary criteria: a. Respiratory rate ≥30 breaths / min; b. Oxygenation index ≤250 mmHg (1 mmHg=0.133 kPa); c. Multilobar infiltration; d. Altered consciousness and / or disorientation; e. Blood urea nitrogen ≥7.14 mmol / L; f. Systolic blood pressure <90 mmHg, requiring aggressive fluid resuscitation.

[0075] Exclusion criteria: 1) Lower respiratory tract infection occurring more than 48 hours after admission. 2) Patients with predominantly dry cough during hospitalization, making specimen collection difficult. 3) Patients with immunodeficiency diseases, connective tissue diseases, or hematological disorders. 4) Patients with incomplete clinical or laboratory data who are unwilling to participate in the study. 5) Age.

[0076] Sputum samples collected from adult patients were tested using RT-qPCR.

[0077] The results are as follows Figure 12 As shown, the overall level of host lncRNA SRGAP2-AS1 in RSV sputum samples was elevated, higher than in the uninfected group. This indicates that lncRNA SRGAP2-AS1 can serve as a biomarker for detecting RSV virus.

[0078] The technical solutions provided by the embodiments of the present invention have been described in detail above. Specific examples have been used to illustrate the principles and implementation methods of the embodiments of the present invention. The descriptions of the embodiments above are only for helping to understand the principles of the embodiments of the present invention. At the same time, for those skilled in the art, there will be changes in the specific implementation methods and application scope based on the embodiments of the present invention. Therefore, the content of this specification should not be construed as a limitation of the present invention.

Claims

1. A biomarker for diagnosing respiratory syncytial virus, characterized in that: The biomarker is a lncRNA molecule.

2. The biomarker for diagnosing respiratory syncytial virus according to claim 1, characterized in that: The lncRNA molecule is SRGAP2-AS1.

3. The use of a biomarker for diagnosing respiratory syncytial virus according to claim 1 or 2 in the preparation of products for detecting or diagnosing respiratory syncytial virus.

4. The application according to claim 3, characterized in that: The product is a testing reagent or kit.

5. The application according to claim 4, characterized in that: The detection reagent or kit detects the expression level of SRGAP2-AS1 in biological samples.

6. The application according to claim 4, characterized in that: The expression level of SRGAP2-AS1 in the detection reagent or kit is positively correlated with the degree of respiratory syncytial virus infection.

7. The application according to claim 5, characterized in that: The biological samples were selected from oral secretions, serum, and bronchoalveolar lavage fluid.

8. The application according to claim 4, characterized in that: The detection reagents or kits are used for the detection, auxiliary diagnosis, or assessment of respiratory syncytial virus infection.

Images