Inhibitors of expression and / or function
By designing siRNA oligomers to conjugate with the SLC25A5/ANT2 target, a specific inhibitor was developed, solving the problem of SLC25A5/ANT2 expression and function inhibition in existing technologies, and significantly improving the treatment effect of metabolic diseases and adipogenesis-related diseases.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- E THERAPEUTICS LTD
- Filing Date
- 2024-02-06
- Publication Date
- 2026-05-05
AI Technical Summary
Existing technologies are insufficient to effectively inhibit the expression and function of SLC25A5/ANT2, resulting in poor treatment outcomes for related diseases.
A siRNA oligomer inhibitor was developed that specifically inhibits the expression and function of SLC25A5/ANT2 by conjugating to the target. The siRNA oligomer contains a GalNAc ligand or its derivative and achieves efficient complementarity through nucleoside sequence design to form a double-stranded region for targeted silencing.
It achieves highly efficient inhibition of SLC25A5/ANT2, and has the potential to treat a variety of diseases, especially showing significant effects in metabolic diseases and adipogenesis-related diseases.
Smart Images

Figure BDA0005609547730000041 
Figure BDA0005609547730000051 
Figure BDA0005609547730000081
Abstract
Description
Technical Field
[0001] This application provides inhibitors suitable for therapeutic use, such as nucleic acid compounds, like siRNA. Furthermore, this application provides methods for preparing these compounds, and methods for using such compounds to treat various diseases and conditions. Background Technology
[0002] Inhibitors, such as oligonucleotides / oligonucleotides that act as inhibitors of gene expression and / or the expression or function of other targets (e.g., LNCRNAs), have important therapeutic applications in medicine. Oligonucleotides / oligonucleotides can be used to silence genes that cause specific diseases. Gene silencing prevents protein formation by inhibiting translation. Importantly, gene silencers are a promising alternative to traditional small organic compounds that inhibit the function of disease-related proteins. siRNAs, antisense RNAs, and microRNAs are oligonucleotides / oligonucleotides that prevent protein formation through gene silencing.
[0003] Over the past two decades, numerous modified siRNA compounds have been developed for diagnostic and therapeutic purposes, including siRNA / RNAi therapeutics for treating a wide range of diseases, including central nervous system diseases, inflammatory diseases, metabolic disorders, oncology, infectious diseases, and eye diseases.
[0004] This application relates to inhibitors (such as oligomers, such as nucleic acids, such as oligonucleotides / oligonucleotide compounds) and their use in the treatment and / or prevention of diseases.
[0005] The SLC25A5 gene belongs to the ANT gene family, which itself is a superfamily containing genes encoding brown adipose mitochondrial uncoupling proteins and genes encoding mitochondrial phosphocarrier proteins. This gene is a member of the mitochondrial carrier subfamily of solute carrier protein genes. Its product, adenine nucleotide transporter 2 (ANT2), is a major component of the mitochondrial permeability transition pore complex, catalyzing the exchange of mitochondrial ATP with cytoplasmic ADP. Due to its antitransport function, ANT2 maintains mitochondrial membrane potential by regulating the ADP / ATP ratio in oxidative phosphorylation. When ANT2 is acylated by SIRT4, it promotes mitochondrial membrane uncoupling. Although uncoupling of membrane potential usually leads to apoptosis, ANT2 has been found to have anti-apoptotic effects. Therefore, it is hypothesized that ANT2, as a component of MMS19-XPD, mediates a TFIIH-dependent DNA damage response. Summary of the Invention
[0006] This application relates to, and in particular to, the following as defined in the claims:
[0007] In one aspect, this application relates to an inhibitor of expression and / or function of SLC25A5 / ANT2, wherein the inhibitor is conjugated to one or more ligands.
[0008] In a further aspect, this application relates to an inhibitor described in this application, wherein the inhibitor is a siRNA oligomer.
[0009] On the other hand, this application relates to inhibitors of the expression and / or function of SLC25A5 / ANT2, wherein the inhibitor is a siRNA oligomer.
[0010] In a further aspect, this application relates to an inhibitor as described in this application, wherein the inhibitor comprises an siRNA oligomer conjugated to one or more ligand portions.
[0011] In a further aspect, this application relates to an inhibitor as described in this application, wherein the one or more ligand portions comprise one or more GalNAc ligands or comprise one or more GalNAc ligand derivatives.
[0012] In a further aspect, this application relates to an inhibitor as described in this application, wherein the one or more ligand portions comprise one or more GalNAc ligand derivatives.
[0013] In a further aspect, this application relates to an inhibitor described in this application, wherein the target of the inhibitor is SLC25A5 / ANT2.
[0014] In a further aspect, this application relates to an inhibitor as described in this application, wherein the inhibitor is a nucleic acid for inhibiting SLC25A5 expression, the nucleic acid comprising a double-stranded region, the double-stranded region comprising a first strand and a second strand at least partially complementary to the first strand, wherein
[0015] (i) at least partially complementary to a portion of the RNA transcribed from the SLC25A5 gene, and
[0016] (ii) Contains at least 17 consecutive nucleosides, which differ from any of the first-strand sequences listed in Table 2 by 0 or 1 nucleoside.
[0017] In a further aspect, this application relates to an inhibitor as described in this application, wherein the inhibitor is a nucleic acid for inhibiting SLC25A5 expression, the nucleic acid comprising a double-stranded region, the double-stranded region comprising a first strand and a second strand at least partially complementary to the first strand, wherein the first strand:
[0018] (i) at least partially complementary to a portion of the RNA transcribed from the SLC25A5 gene, and
[0019] (ii) Contains at least 17 consecutive nucleosides, wherein the consecutive nucleosides differ from any of the first-strand modification sequences listed in Table 3 by 0 or 1 nucleoside.
[0020] In a further aspect, this application relates to an inhibitor as described in this application, wherein the first chain comprises nucleoside 2-18 of any sequence as defined in claim 8 or 9, and in particular wherein the first chain comprises nucleoside 2-18 of any sequence as defined in Table 2 or Table 3.
[0021] In a further aspect, this application relates to an inhibitor as described in this application, wherein the second chain comprises a nucleoside sequence of at least 17 consecutive nucleosides, the consecutive nucleosides differing from any of the second chain sequences listed in Table 2 by 0 or 1 nucleoside, and wherein the second chain has at least 85% complementary regions to the first chain on the 17 consecutive nucleosides.
[0022] In a further aspect, this application relates to an inhibitor as described in this application, wherein the second chain comprises a nucleoside sequence of at least 17 consecutive nucleosides, the consecutive nucleosides differing from any of the second chain modification sequences listed in Table 4 by 0 or 1 nucleoside, and wherein the second chain has at least 85% complementary regions to the first chain on the 17 consecutive nucleosides.
[0023] In a further aspect, this application relates to an inhibitor as described in this application, wherein the first chain comprises any of the first chain sequences listed in Table 2.
[0024] In a further aspect, this application relates to an inhibitor as described in this application, wherein the first chain comprises any of the first chain modification sequences listed in Table 3.
[0025] In a further aspect, this application relates to an inhibitor as described in this application, wherein the second strand comprises any of the second strand sequences listed in Table 2.
[0026] In a further aspect, this application relates to an inhibitor as described in this application, wherein the second chain comprises any of the first chain modification sequences listed in Table 4.
[0027] In a further aspect, this application relates to an inhibitor as described in this application, wherein the first chain comprises any of the following sequences: SEQ ID NO:304, SEQ ID NO:323, SEQ ID NO:439, SEQ ID NO:453, and SEQ ID NO:496.
[0028] In a further aspect, this application relates to an inhibitor as described in this application, wherein the first chain comprises any of the following sequences: SEQ ID NO:856, SEQ ID NO:875, SEQ ID NO:991, SEQ ID NO:1005, and SEQ ID NO:1048.
[0029] In a further aspect, this application relates to an inhibitor as described in this application, wherein the second chain comprises any of the following sequences: SEQ ID NO:580, SEQ ID NO:599, SEQ ID NO:715, SEQ ID NO:729, and SEQ ID NO:772.
[0030] In a further aspect, this application relates to an inhibitor as described in this application, wherein the second chain comprises any of the following sequences: SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281, and SEQ ID NO:1324.
[0031] In a further aspect, this application relates to an inhibitor as described in this application, comprising a first chain and a second chain, wherein the first chain and the second chain comprise nucleoside sequences differing from any combination of the following first and second sequences by 0 or 1 nucleoside, or consist of, or substantially consist of, nucleoside sequences differing from any combination of the following first and second sequences by 0 or 1 nucleoside:
[0032] Unmodified first chain Unmodified second chain SEQ ID NO:304 SEQ ID NO:580 SEQ ID NO:323 SEQ ID NO:599 SEQ ID NO:439 SEQ ID NO:715 SEQ ID NO:453 SEQ ID NO:729 SEQ ID NO:496 SEQ ID NO:772
[0033] In a further aspect, this application relates to an inhibitor described in this application, comprising a first chain and a second chain, the first chain and the second chain comprising, being composed of, or substantially composed of nucleoside sequences differing from any combination of the following first and second sequences by 0 or 1 nucleoside:
[0034] Unmodified first chain Unmodified second chain SEQ ID NO:304 SEQ ID NO:580
[0035] In a further aspect, this application relates to an inhibitor described in this application comprising a first chain and a second chain, the first chain and the second chain comprising, being composed of, or substantially composed of nucleoside sequences differing from any combination of the following first and second sequences by 0 or 1 nucleoside:
[0036] Unmodified first chain Unmodified second chain SEQ ID NO:856 SEQ ID NO:1132 SEQ ID NO:875 SEQ ID NO:1151 SEQ ID NO:991 SEQ ID NO:1267 SEQ ID NO:1005 SEQ ID NO:1281 SEQ ID NO:1048 SEQ ID NO:1324
[0037] In a further aspect, this application relates to an inhibitor as described in this application, comprising a first chain and a second chain, wherein the first chain and the second chain comprise nucleoside sequences differing from any combination of the following first and second sequences by 0 or 1 nucleoside, or consist of, or substantially consist of, nucleoside sequences differing from any combination of the following first and second sequences by 0 or 1 nucleoside:
[0038]
[0039] In a further aspect, this application relates to an inhibitor as described in this application, said inhibitor being an siRNA oligomer having a first strand and a second strand, wherein:
[0040] i) The length of the first strand of siRNA is 15 to 30 nucleotides, preferably 19 to 25 nucleotides, more preferably 23 or 25 nucleotides; even more preferably 23 nucleotides; and / or
[0041] ii) The second strand of siRNA has a length of 15 to 30 nucleotides, preferably 19 to 25 nucleotides, and more preferably 21 nucleotides.
[0042] In a further aspect, this application relates to an inhibitor as described in this application, wherein the length of the first chain is 17 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 19 or 23 nucleosides.
[0043] In a further aspect, this application relates to an inhibitor as described in this application, wherein the length of the second chain is 17 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 19, 21, or 23 nucleosides.
[0044] In a further aspect, this application relates to an inhibitor as described in this application, wherein the length of the double-stranded region of the nucleic acid is 17 to 30 nucleotides, more preferably 19, 21, or 23 nucleotides.
[0045] In a further aspect, this application relates to an inhibitor described in this application, wherein the length of the complementary region between the first strand and a portion of the RNA transcribed from the SLC25A5 gene is 17 to 30 nucleotides.
[0046] In a further aspect, this application relates to an inhibitor described in this application, wherein the nucleic acid further comprises one or more single-stranded nucleoside overhangs, optionally wherein the overhang is on a first or second strand, preferably at the 3' end of the first or second strand, and / or wherein the overhang comprises 1 to 4 nucleosides, more preferably 2 nucleosides.
[0047] In a further aspect, this application relates to an inhibitor described in this application, wherein the nucleic acid is an siRNA oligonucleotide.
[0048] In a further aspect, this application relates to an inhibitor as described in this application, wherein the second sense chain further comprises one or more abasic nucleosides in the terminal region of the second chain, and wherein the abasic nucleosides are linked to adjacent nucleosides via reverse nucleoside internucleotide bonds.
[0049] In a further aspect, this application relates to an inhibitor as described in this application, wherein the second chain comprises:
[0050] i) Two or more abase-free nucleotides in the terminal region of the second strand; and / or
[0051] ii) Two or more abase-free nucleotides in the 5' or 3' end region of the second strand; and / or
[0052] iii) Two or more abasic nucleosides in the 5' or 3' end region of the second strand, wherein the abasic nucleosides are in the overhangs as described herein; and / or
[0053] iv) Two or more consecutive abasic nucleosides in the terminal region of the second chain, preferably one of such abasic nucleosides being the terminal nucleoside; and / or
[0054] v) Two or more consecutive abasic nucleotides in the 5' or 3' end region of the second strand, wherein preferably one such abasic nucleotide is a terminal nucleotide in the 5' or 3' end region of the second strand; and / or
[0055] vi) An antinucleotide bond between at least one baseless nucleotide connecting the terminal region of the second chain and an adjacent basic nucleotide; and / or
[0056] vii) An antinucleotide bond between at least one baseless nucleotide linking the 5' or 3' end region of the second strand and an adjacent basic nucleotide; and / or
[0057] viii) A base-free nucleoside that is the penultimate nucleoside, which is linked to a non-terminal nucleoside (referred to as the penultimate nucleoside in this paper) via a reverse bond; and / or
[0058] ix) When the chain is read in the direction toward the end, it is a baseless nucleoside consisting of two terminal nucleosides linked by a 5'-3' bond;
[0059] x) When the strand is read along the direction toward the end containing the terminal nucleoside, it is a baseless nucleoside consisting of two terminal nucleosides linked by 3'-5' bonds;
[0060] xi) is a nucleoside with no bases at the two ends, wherein the penultimate nucleoside and the penultimate nucleoside are connected by a reverse bond, and the reverse bond is either a 5-5' reverse bond or a 3'-3' reverse bond;
[0061] xii) As a nucleoside with no bases at the two terminal positions, wherein the penultimate nucleoside and the penultimate nucleoside are linked by an anti-bond, and wherein
[0062] (1) When read in the direction of the end containing the terminal and the penultimate abasic nucleotide, the reverse bond is a 5-5' reverse bond, and the bond between the terminal and the penultimate abasic nucleotide is a 3'5' bond; or
[0063] (2) When read along the direction toward the end containing the end and the penultimate abase nucleoside, the reverse bond is a 3-3' reverse bond, and the bond between the end and the penultimate abase nucleoside is a 5'3' bond.
[0064] In a further aspect, this application relates to an inhibitor as described in this application, wherein the reverse nucleoside internucleotide bond is located at the distal end of the 5' terminal region of the second strand, or at the distal end of the 3' terminal region of the second strand.
[0065] In a further aspect, this application relates to an inhibitor described in this application, wherein the reverse nucleoside inter-bond is a 3'3 reverse bond.
[0066] In a further aspect, this application relates to an inhibitor described in this application, wherein the reverse nucleoside inter-bond is a 5'5 reverse bond.
[0067] In a further aspect, this application relates to an inhibitor as described in this application, wherein the second sense chain further comprises one or more abasic nucleosides in the terminal region of the second chain, and wherein the abasic nucleosides are linked to adjacent nucleosides via reverse internucleotide bonds.
[0068] In a further aspect, this application relates to an inhibitor as described in this application, wherein the second chain comprises two consecutive abasic nucleosides in its 5' terminal region, one of which is the terminal nucleoside of the 5' terminal region of the second chain, and the other abasic nucleoside is the penultimate nucleoside of the 5' terminal region of the second chain, wherein:
[0069] (a) The penultimate abasic nucleotide is connected to the first basic nucleotide in the adjacent 5' proximal region via a reverse nucleotide bond; and
[0070] (b) The reverse key is a 5-5' reverse key; and
[0071] (c) When read along the direction of the end containing the end and the penultimate abase nucleoside, the bond between the end and the penultimate abase nucleoside is 3'5'.
[0072] In a further aspect, this application relates to an inhibitor as described in this application, wherein
[0073] (i) The first and second strands each have a length of 23 nucleotides;
[0074] (ii) There are two thiophosphate nucleoside bonds between three consecutive positions in the 5' proximal region of the second chain, wherein the first thiophosphate nucleoside bond is located between the adjacent first basic nucleoside of (a) and the adjacent second basic nucleoside in the 5' proximal region of the second chain, and the second thiophosphate nucleoside bond is located between the adjacent second basic nucleoside and the adjacent third basic nucleoside in the 5' proximal region of the second chain.
[0075] (iii) Two thiophosphate nucleoside bonds are respectively placed between three consecutive positions in the 5' and 3' end regions of the first chain, thereby connecting the terminal nucleosides of the 5' and 3' end regions of the first chain to their respective penultimate 5' and 3' adjacent nucleosides via thiophosphate nucleoside bonds, and connecting each of the first penultimate 5' and 3' nucleosides to its respective penultimate 5' and 3' adjacent nucleosides via thiophosphate nucleoside bonds; and
[0076] (iv) The second strand of the nucleic acid is directly or indirectly conjugated to one or more ligand moieties in the 3' terminal region of the second strand.
[0077] In a further aspect, this application relates to an inhibitor as described in this application, wherein two consecutive inverse abasic nucleotides in the 5' terminal region of the second strand are presented as the following 5' terminal motif.
[0078]
[0079] in:
[0080] T represents 2'Me ribose modification.
[0081] B represents the first two basic nucleoside bases of the 5' terminal region of the second strand, and
[0082] Z represents the remaining 19 consecutive basic nucleosides of the second chain.
[0083] In a further aspect, this application relates to an inhibitor as described in this application, wherein one or more nucleosides on the first and / or second chains are modified to form modified nucleosides.
[0084] In a further aspect, this application relates to an inhibitor as described in this application, wherein the modification is a modification of the 2'-OH group of the ribose, optionally selected from 2'-Me or 2'-F modifications.
[0085] In a further aspect, this application relates to an inhibitor as described in this application, wherein the first chain contains 2'-F at positions 14, 2, 6, or any combination thereof, counting from position 1 of the first chain.
[0086] In a further aspect, this application relates to an inhibitor as described in this application, wherein the second chain contains a 2'-F modification at positions 7 and / or 9, and / or 11 and / or 13, counting from position 1 of the second chain.
[0087] In a further aspect, this application relates to an inhibitor as described in this application, wherein the first chain and the second chain each contain 2'-Me and 2'-F modifications.
[0088] In a further aspect, this application relates to an inhibitor described in this application, which is siRNA, wherein the siRNA comprises at least one thermally unstable modification suitably located at one or more positions 1 to 9 of the first strand, counting from position 1 of the first strand, and / or located at one or more positions on the second strand aligned with positions 1 to 9 of the first strand, wherein the unstable modification is selected from modified unlocked nucleic acids (UNA) and glycol nucleic acids (GNA), preferably glycol nucleic acids.
[0089] In a further aspect, this application relates to an inhibitor as described in this application, wherein the siRNA contains at least one thermally unstable modification at position 7 of the first strand, counting from position 1 of the first strand.
[0090] In a further aspect, this application relates to an inhibitor described in this application, which is siRNA, wherein the siRNA contains three or more 2'-F modifications at positions 7 to 13 of the second strand, counting from position 1 of the second strand, for example, containing four, five, six or seven 2'-F modifications at positions 7 to 13 of the second strand.
[0091] In a further aspect, this application relates to an inhibitor described in this application, which is siRNA, wherein at least three 2'-Me modifications, such as four, five or six 2'-Me modifications, are contained at positions 1 to 6 of the second strand, counting from position 1 of the second strand.
[0092] In a further aspect, this application relates to an inhibitor described in this application, which is siRNA, wherein the first strand contains at least five consecutive 2'-Me modifications in the 3' end region, preferably containing a terminal nucleoside in the 3' end region, or at least in the 3' end region within a range of 1 or 2 nucleosides from the terminal nucleoside.
[0093] In a further aspect, this application relates to an inhibitor described in this application, which is siRNA, wherein the first strand contains seven consecutive 2'-Me modifications in the 3' end region, preferably containing terminal nucleosides in the 3' end region.
[0094] In a further aspect, this application relates to an inhibitor described in this application, wherein the siRNA oligomer further comprises one or more thiophosphate nucleoside bonds.
[0095] In a further aspect, this application relates to an inhibitor as described in this application, wherein the one or more thiophosphate nucleoside internucleotide bonds are located between at least three consecutive positions in the 5' proximal region or the 3' proximal region of the second chain, wherein the proximal region is preferably adjacent to the terminal region (as defined herein) where the one or more abase-free nucleosides of the second chain are located.
[0096] In a further aspect, this application relates to an inhibitor as described in this application, wherein one or more thiophosphate nucleoside interbonds are located between at least three consecutive positions in the 5' end region and / or 3' end region of the first chain, wherein preferably the end positions of the 5' end region and / or 3' end region of the first chain are connected to their adjacent positions by thiophosphate nucleoside interbonds.
[0097] In a further aspect, this application relates to an inhibitor as described in this application, wherein the oligomer is siRNA, the second strand of which is directly or indirectly conjugated to one or more ligand moieties, wherein the ligand moieties are typically present in the terminal region of the second strand, preferably in its 3' terminal region.
[0098] In a further aspect, this application relates to an inhibitor as described in this application, wherein the ligand portion comprises
[0099] i) one or more GalNAc ligands; and / or
[0100] ii) One or more GalNAc ligand derivatives; and / or
[0101] iii) One or more GalNAc ligands and / or GalNAc ligand derivatives conjugated to the siRNA via a linker.
[0102] In a further aspect, this application relates to an inhibitor as described in this application, wherein one or more GalNAc ligands and / or GalNAc ligand derivatives are directly or indirectly conjugated to the 5' or 3' end region of the second strand of the siRNA oligomer, preferably conjugated to its 3' end region.
[0103] In a further aspect, this application relates to an inhibitor as described in this application, wherein the ligand portion comprises
[0104]
[0105] In a further aspect, this application relates to an inhibitor described in this application, which comprises the following structure:
[0106]
[0107] in:
[0108] R1 is selected independently from hydrogen, methyl, and ethyl each time it appears;
[0109] R2 is selected from hydrogen, hydroxyl group, -OC. 1-3 Alkyl group, -C(=O)OC 1-3 Alkyl, halogen, and nitro groups;
[0110] X1 and X2 are each selected independently from the following group: methylene, oxygen, and sulfur;
[0111] m is an integer from 1 to 6;
[0112] n is an integer from 1 to 10;
[0113] q, r, s, t, v are independent integers from 0 to 4, provided that:
[0114] (i) q and r cannot both be 0; and
[0115] (ii) s, t and v cannot all be 0 at the same time;
[0116] Z represents the oligonucleotide moiety.
[0117] In a further aspect, this application relates to an inhibitor described in this application, which comprises the following structure:
[0118]
[0119] Oligonucleotides represent consecutive nucleosides in the second chain.
[0120] In a further aspect, this application relates to an inhibitor described in this application, which comprises the following structure
[0121]
[0122] in:
[0123] r and s are independently selected from integers from 1 to 16; and
[0124] Z represents the oligonucleotide moiety.
[0125] In a further aspect, this application relates to an inhibitor described in this application, which comprises the following structure:
[0126]
[0127] Oligonucleotides represent consecutive nucleosides in the second chain.
[0128] In a further aspect, this application relates to an inhibitor as described in this application, wherein the structure is conjugated to the 3' terminal region of the second chain.
[0129] In a further aspect, this application relates to an inhibitor of this application, which is formulated together with excipients and / or a carrier into a pharmaceutical composition.
[0130] On the other hand, this application relates to a pharmaceutical composition comprising an inhibitor according to one or more of the foregoing aspects and a pharmaceutically acceptable excipient or carrier.
[0131] In a further aspect, this application relates to a pharmaceutical composition described in this application, which further comprises a GLP-1 agonist and / or a THR-β agonist.
[0132] In a further aspect, this application relates to a pharmaceutical composition described in this application, wherein the GLP-1 agonist is a GLP-1 / GIP dual agonist, a GLP-1 / FGF21 dual agonist, a GLP-1 / GCGR dual agonist, or a GLP-1 / GIP / GCGR triple agonist.
[0133] In a further aspect, this application relates to a pharmaceutical composition described in this application, wherein the GLP-1 agonist is semaglutide.
[0134] In a further aspect, this application relates to a pharmaceutical composition described in this application, wherein the THR-β agonist is resmetirom.
[0135] In a further aspect, this application relates to a pharmaceutical composition described in this application, wherein the GLP-1 / GIP dual agonist is tirzepatide.
[0136] In a further aspect, this application relates to a pharmaceutical composition as described in this application, further comprising one or more of the following: an amylin receptor agonist (e.g., pramlintide), and / or an amylin + calcitonin dual receptor agonist, and / or a glucagon receptor agonist, and / or an FXR receptor agonist (e.g., ciloxexor or obeticholic acid), and / or an FGF-21 analog or an FGF-21 receptor agonist (e.g., efruxifermin), and / or an FGF-19 analog or an FGF-19 receptor agonist (e.g., aldafermin), and / or a galactoglobulin 3 inhibitor (e.g., belapectin), and / or a PPARα agonist (e.g., elafibrinor), and / or a PPARγ agonist (e.g., pioglitazone or rosiglitazone), and / or a mixture of P... PARα agonists and / or PPARδ agonists and / or PPARγ agonists, and / or pan-PPARαγδ agonists (e.g., lanafibranor), and / or acetyl-CoA desaturase activators, and / or ASK1 inhibitors (e.g., selonsertib), and / or LOXL2 inhibitors (e.g., simtuzumab), and / or CCR2 / 5 dual inhibitors (e.g., cenicriviroc), and / or inhibitors of enzymes in the de novo lipogenesis (DNL) pathway, including citrate / isocitrate carriers (CIC), ATP-citrate lyase (ACLY), acetyl-CoA carboxylase (ACC), and fatty acid synthase (FAS), and / or inhibitors of enzymes in the cholesterol biosynthesis pathway (e.g., HMGCoA reductase inhibitors, such as atorvastatin).
[0137] On the other hand, this application relates to the use of the inhibitor or pharmaceutical composition described in this application in treatment.
[0138] On the other hand, this application relates to the use of the inhibitors or pharmaceutical compositions described in this application in the prevention and / or treatment of metabolic diseases or disorders, such as metabolic diseases or disorders associated with non-alcoholic fatty liver disease (NAFLD), and / or obesity, and / or diseases or disorders associated with lipogenesis, and / or in the reduction of lipogenesis.
[0139] In a further aspect, this application relates to an inhibitor or pharmaceutical composition for the use described in this application, wherein the inhibitor or pharmaceutical composition is used in combination with a GLP-1 agonist and / or a THR-β agonist.
[0140] In a further aspect, this application relates to an inhibitor for the use described in this application or a pharmaceutical composition for the use described in this application, wherein the GLP-1 agonist is a GLP-1 / GIP dual agonist, a GLP-1 / FGF21 dual agonist, a GLP-1 / GCGR dual agonist, or a GLP-1 / GIP / GCGR triple agonist.
[0141] In a further aspect, this application relates to an inhibitor for the use described in this application or a pharmaceutical composition for the use described in this application, wherein the GLP-1 agonist is semaglutide.
[0142] In a further aspect, this application relates to an inhibitor or pharmaceutical composition for the use described in this application, wherein the THR-β agonist is retinotirol.
[0143] In a further aspect, this application relates to an inhibitor for the use described in this application or a pharmaceutical composition for the use described in this application, wherein the GLP-1 / GIP dual agonist is tesipatide.
[0144] In a further aspect, this application relates to an inhibitor or pharmaceutical composition for the use described in this application, wherein the inhibitor or pharmaceutical composition is used in combination with one or more of the following: an amylin receptor agonist (e.g., pramlintide), and / or an amylin + calcitonin dual receptor agonist, and / or a glucagon receptor agonist, and / or an FXR receptor agonist (e.g., ciloxexor or obeticholic acid), and / or an FGF-21 analog or an FGF-21 receptor agonist (e.g., efruxifermin), and / or an FGF-19 analog or an FGF-19 receptor agonist (e.g., aldafermin), and / or a galactoglobulin 3 inhibitor (e.g., belapectin), and / or a PPARα agonist (e.g., elafibrinor), and / or a PPARγ agonist (e.g., pioglitazone or... Rosiglitazone), and / or a combination of PPARα agonists and / or PPARδ agonists and / or PPARγ agonists, and / or pan-PPARαγδ agonists (e.g., lanafibranor), and / or acetyl-CoA desaturase activators, and / or ASK1 inhibitors (e.g., selonsertib), and / or LOXL2 inhibitors (e.g., simtuzumab), and / or CCR2 / 5 dual inhibitors (e.g., cenicriviroc), and / or inhibitors of enzymes in the de novo lipogenesis (DNL) pathway, including citrate / isocitrate carriers (CIC), ATP-citrate lyase (ACLY), acetyl-CoA carboxylase (ACC), and fatty acid synthase (FAS), and / or inhibitors of enzymes in the cholesterol biosynthesis pathway (e.g., HMGCoA reductase inhibitors, such as atorvastatin).
[0145] On the other hand, this application relates to the use of SLC25A5 / ANT2 as a target in the identification of one or more therapeutic agents for the treatment or prevention of metabolic diseases or disorders, such as metabolic diseases or disorders associated with non-alcoholic fatty liver disease (NAFLD), and / or obesity, and / or diseases or disorders associated with lipogenesis, and / or for the reduction of lipogenesis.
[0146] On the other hand, this application relates to a method for treating or preventing metabolic diseases or disorders, such as metabolic diseases or disorders associated with non-alcoholic fatty liver disease (NAFLD), and / or obesity, and / or diseases or disorders associated with lipogenesis, and / or a method for reducing lipogenesis, said method comprising administering to a patient an inhibitor of the expression and / or function of SLC25A5 / ANT2, such as the inhibitor described in this application.
[0147] In a further aspect, this application relates to a method described in this application, wherein an inhibitor of SLC25A5 / ANT2 expression and / or function is co-administered with a GLP-1 agonist and / or a THR-β agonist.
[0148] In a further aspect, this application relates to a method described in this application, wherein the GLP-1 agonist is a GLP-1 / GIP dual agonist, a GLP-1 / FGF21 dual agonist, a GLP-1 / GCGR dual agonist, or a GLP-1 / GIP / GCGR triple agonist.
[0149] In a further aspect, this application relates to the method described herein, wherein the GLP-1 agonist is semaglutide.
[0150] In a further aspect, this application relates to the method described herein, wherein the GLP-1 / GIP dual agonist is tesipatide.
[0151] In a further aspect, this application relates to the method described herein, wherein the THR-β agonist is remetiro.
[0152] In a further aspect, this application relates to the methods described herein, wherein the inhibitor of SLC25A5 / ANT2 expression and / or function is administered in combination with one or more of the following drugs: an amylin receptor agonist (e.g., pramlintide), and / or an amylin + calcitonin dual receptor agonist, and / or a glucagon receptor agonist, and / or an FXR receptor agonist (e.g., silofexo or obeticholic acid), and / or an FGF-21 analog or an FGF-21 receptor agonist (e.g., efruxifermin), and / or an FGF-19 analog or an FGF-19 receptor agonist (e.g., aldafermin), and / or a galactoglobulin 3 inhibitor (e.g., belapectin), and / or a PPARα agonist (e.g., elafibrinor), and / or a PPARγ agonist (e.g., pioglitazone or rosiglitazone). PPARα agonists and / or mixed PPARδ agonists and / or PPARγ agonists, and / or pan-PPARαγδ agonists (e.g., lanafibranor), and / or acetyl-CoA desaturase activators, and / or ASK1 inhibitors (e.g., selonsertib), and / or LOXL2 inhibitors (e.g., simtuzumab), and / or CCR2 / 5 dual inhibitors (e.g., cenicriviroc), and / or inhibitors of enzymes in the de novo lipogenesis (DNL) pathway, including citrate / isocitrate carriers (CIC), ATP-citrate lyase (ACLY), acetyl-CoA carboxylase (ACC), and fatty acid synthase (FAS), and / or inhibitors of enzymes in the cholesterol biosynthesis pathway (e.g., HMGCoA reductase inhibitors, such as atorvastatin).
[0153] On the other hand, this application relates to the use of an inhibitor or pharmaceutical composition described in this application in the preparation of a medicament for treating metabolic diseases or disorders, such as metabolic diseases or disorders associated with non-alcoholic fatty liver disease (NAFLD), and / or obesity, and / or diseases or conditions associated with lipogenesis, and / or for reducing lipogenesis.
[0154] On the other hand, this application relates to the use of SLC25A5 / ANT2 as a biomarker for metabolic diseases or disorders, such as metabolic diseases or disorders associated with non-alcoholic fatty liver disease (NAFLD), and / or obesity, and / or diseases or disorders associated with lipogenesis.
[0155] On the other hand, this application relates to the use of SLC25A5 / ANT2 in in vivo methods for predicting the sensitivity of metabolic diseases or disorders, such as metabolic diseases or disorders associated with non-alcoholic fatty liver disease (NAFLD), and / or obesity and / or diseases or disorders associated with lipogenesis, typically achieved by monitoring the sequence of SLC25A5 / ANT2 and / or the expression and / or functional levels of SLC25A5 / ANT2 in samples obtained from patients.
[0156] On the other hand, this application relates to a method for predicting a patient's susceptibility to metabolic diseases or disorders, such as those associated with non-alcoholic fatty liver disease (NAFLD), and / or obesity, and / or diseases or disorders related to lipogenesis, said method comprising:
[0157] (a) Obtaining samples from patients,
[0158] (b) Detect the sequence and / or expression and / or function of SLC25A5 / ANT2 in the samples obtained from the patient.
[0159] (c) Based on the sequence and / or expression and / or function of SLC25A5 / ANT2 in the samples obtained from the patient, predict sensitivity for metabolic diseases or disorders, such as those associated with non-alcoholic fatty liver disease (NAFLD), and / or obesity, and / or diseases or disorders associated with adipogenesis.
[0160] (d) Preferably, an effective amount of the SLC25A5 / ANT2 inhibitor is administered to the confirmed patient. Attached Figure Description
[0161] Figure 1a : An exemplary linear configuration of the conjugate.
[0162] Figure 1b : An exemplary branching configuration of a conjugate.
[0163] Figure 2 : The connector and ligand portions of the construct suitable for the purposes of this application, including link 1a. Although Figure 2 This application only describes the linkers conjugated with oligonucleotides, but it should be understood that this application also covers conjugates of the same linkers disclosed herein with oligonucleotides.
[0164] It should also be understood that, although Figure 2 The product molecules are described as based on, for example Figure 2 The linker and ligand moiety described in detail herein are linked to the oligonucleotide moiety as also described herein, but the product may optionally comprise or consist substantially of molecules in which the linker and ligand moiety are substantially as described herein. Figure 2As described in [the text], it is linked to the oligonucleotide moiety, but the cyclooctyl ring is as follows: Figure 2 The F substituent shown is replaced by a substituent, which can occur via hydrolytic substitution, such as an OH substituent, or the OH substituent itself can be synthesized as a linker. Thus, the (a) chain 1a construct can be substantially composed of components having, for example, OH substituents ... Figure 2 The molecular composition of the linker and ligand moiety shown is such that the cyclooctyl ring has an F substituent; or (b) the chain 1a construct can be substantially composed of molecules having, as shown in the figure, Figure 2 The molecular composition of the linker and ligand moieties shown is different, but the cyclooctyl ring, as shown... Figure 2 The F substituent shown is replaced by an OH substituent, or (c) the chain 1a construct may comprise a mixture of molecules as defined in (a) and / or (b).
[0165] Figure 3 : The connector and ligand portions of the construct suitable for the purposes of this application, including link 1b. Although Figure 3 Linkers conjugated with oligonucleotides are described, but it should be understood that this application also covers conjugates of the same linkers disclosed herein with oligonucleotides.
[0166] about Figure 2 The annotations and the cyclooctyl ring Figure 2 The substitution of the F substituent shown is by a substituent (this could occur due to hydrolytic substitution, such as an OH substituent, or the OH substituent itself could be synthesized as a linker). This possible substitution also applies to the chain 1b construct. Thus, (a) the chain 1b construct can be substantially composed of components having, as shown in the diagram... Figure 3 The molecular composition of the linker and ligand moieties shown has an F substituent on the cyclooctyl ring; or (b) the chain 1b construct can be substantially composed of molecules having, as shown in the diagram. Figure 3 The molecular composition of the linker and ligand moieties shown is different, but the cyclooctyl ring, as shown... Figure 3 The F substituent shown is replaced by an OH substituent, or (c) the chain 1b construct may comprise a mixture of molecules as defined in (a) and / or (b).
[0167] Figure 4 : The connector and ligand portions of the construct suitable for the purposes of this application, including link 2a. Although Figure 4 Linkers conjugated with oligonucleotides are described, but it should be understood that this application also covers conjugates of the same linkers disclosed herein with oligonucleotides.
[0168] Figure 5 : The connector and ligand portions of the construct suitable for the purposes of this application, including link 2b. Although Figure 5 Linkers conjugated with oligonucleotides are described, but it should be understood that this application also covers conjugates of the same linkers disclosed herein with oligonucleotides.
[0169] Figure 6 The molecular formula described in statement 1-101 disclosed in this article.
[0170] Figure 7 The molecular formulas described in items 1-56 disclosed herein.
[0171] Figure 8a and 8b : An inverted, base-free construct that can be used with the nucleic acid sequence of this application as described herein. For Figure 8a The GalNAc connector is attached to the 5' end region of the justice chain used. Figure 8a (Not shown in the text). For Figure 8b The GalNAc connector is attached to the 3' end region of the justice chain used. Figure 8b (Not shown in the image).
[0172] Figure 8a The iaia shown in the 3' end region of the positive chain indicates that (i) there are two abasic nucleosides in the 3' end region of the positive chain as the penultimate and terminal nucleosides, (ii) there is a 3'-3' reverse bond between the penultimate nucleoside of the positive chain (i.e., located at position 21 of the positive chain, where position 1 is the terminal 5' nucleoside of the positive chain) and the adjacent penultimate abasic residue, and (iii) there is a 5'-3' bond between the terminal and penultimate abasic nucleoside when read along the 3' end region containing the terminal and penultimate abasic nucleosides.
[0173] Figure 8b The iaia shown in the 5' end region of the positive chain indicates that (i) there are two abasic nucleosides in the 5' end region of the positive chain as the penultimate and terminal nucleosides, (ii) there is a 5'-5' reverse bond between the penultimate nucleoside of the positive chain (i.e., located at position 1 of the positive chain, based on the nucleoside position number on the positive chain, excluding the iaia motif in the 5' end region of the positive chain) and the adjacent penultimate abasic residue, and (iii) there is a 3'-5' bond between the terminal and penultimate abasic nucleoside when read along the 5' end region containing the terminal and penultimate abasic nucleosides.
[0174] Figure 9a and 9b Based on the bistranded constructs in Table 5.
[0175] Figure 10Summarized knockdown effects of single-dose GalNAc-siRNA, ETX-M00001397, ETX-M00001570, ETX-M00001378, ETX-M00001513, and ETX-M00001527 (1 mg / kg or 3 mg / kg) on mRNA and protein in mouse liver tissue. Non-target-specific siRNAs were used as negative controls. The y-axis values represent the relative expression levels of mRNA or protein, and the data were normalized to the saline control group (n=4). Each data point represents the mean ± SEM of the relative expression levels of mRNA or protein across n=4 experiments.
[0176] Figure 11 NAFLD activity scoring (NAS) was performed on liver samples stained with H&E using clinical criteria summarized by Kleiner et al. (2005). Total NAS represented the sum of scores for steatosis, inflammation, and ballooning degeneration, ranging from 0 to 8. NAS scores were determined by Gubra using the Gubra Histopathological Objective Scoring Technology (GHOST) deep learning application developed by Visiopharm (Denmark) with VIS software to enable more accurate and objective disease staging in the DIO-NASH mouse model. Results were expressed as changes (improvement or deterioration) in NAS scores compared to pre-treatment biopsies at the end of the study. The percentage of animals with at least a 1 or 2-point improvement in NAS was also shown.
[0177] Figure 12 ALT and AST levels in plasma samples treated with ETX-312 (ETX-M00001378) for 12 weeks were measured using a commercially available kit (Roche Diagnostics) on a cobasc 501 automated analyzer. ALT and AST levels were elevated in DIO-NASH mice (solvent sc, siCtrl, solvent PO). Treatment with ETX-312 (ETX-M00001378) alone or in combination with semaglutide or retemetirole significantly reduced ALT and AST levels. Results are expressed as absolute values, mean ± SEM from n = 16 experiments. *p < 0.05; ***p < 0.001; ****p < 0.0001.
[0178] Figure 13TIMP-1 and PIIINP are non-invasive blood biomarkers for predicting liver fibrosis in NAFLD / NASH. TIMP-1 in plasma collected from EDTA tubes was measured using a commercially available ELISA kit (R&D Systems). PIIINP in plasma collected from EDTA tubes was measured using a commercially available ELISA kit (Cusabio). TIMP-1 and PIIINP levels were elevated in DIO-NASH mice (solvent sc, siCtrl, solvent PO). Treatment with ETX-312 alone (ETX-M00001378) or in combination with semaglutide or remetrol significantly reduced TIMP-1 and PIIINP levels. Results are expressed in absolute terms as mean ± SEM over n = 16 experiments. Outlier analysis was performed by comparing the studentized residuals of the linear model fitted to the subcutaneous treatment subset of data with the critical bomperoni-corrected α level (0.05 / 88 = ~0.00057). One animal in the smegglutinin group was identified as an outlier, which was validated by influence analysis. This animal was considered highly abnormal and had a high influence, and was excluded from all TIMP-1 and PIIINP analyses. *p<0.05; ***p<0.001; ****p<0.0001.
[0179] Figure 14 The final liver weight to body weight ratio indicated hepatomegaly in DIONASH mice. Treatment with ETX-312 (ETX-M00001378) alone or in combination with retemetine significantly reduced the liver weight to body weight ratio. Results are expressed as liver weight:body weight, and are the mean ± SEM of n = 16 experiments. **p < 0.01; ****p < 0.0001 Invention Details
[0181] This application particularly provides inhibitors, such as oligomers (e.g., nucleic acids), such as repressive RNA molecules (which may be referred to as iRNA or siRNA), and compositions containing the same inhibitors, said inhibitors being able to affect the expression of a target, for example by binding to mRNA transcribed from a gene. The target may be located intracellularly, such as in the cells of a subject (e.g., a human). The inhibitors can be used to prevent and / or treat medical conditions associated with, for example, the expression of a target gene.
[0182] Specifically, this application identifies inhibitors of the expression and / or function of SLC25A5 / ANT2, which can be used for the prevention and / or treatment of metabolic diseases or disorders, such as metabolic diseases or disorders associated with non-alcoholic fatty liver disease (NAFLD), and / or obesity, and / or diseases or disorders associated with lipogenesis.
[0183] ADP / ATP translocase 2 (ANT2) is a protein encoded by the SLC25A5 gene on the X chromosome in humans. This protein acts as a reverse transporter for ADP / ATP exchange between the mitochondrial matrix and the cytoplasm.
[0184] This application relates to an inhibitor of the expression and / or function of SLC25A5 / ANT2. Therefore, in some embodiments, this application relates to an inhibitor of SLC25A5 gene expression, such as siRNA targeting mRNA transcribed from the SLC25A5 gene. In some embodiments, this application relates to an inhibitor of the function of the gene product ANT2. Both of these options are included when references are made herein to SLC25A5 / ANT2 inhibitors or the inhibitors described in this application.
[0185] In humans, ANT2 is encoded by the SLC25A5 gene (SEQ ID NO:1381).
[0186] SEQ ID NO:1381(SLC25A5)
[0187]
[0188] The inventors used network analysis, which enabled them to assign multiple genes or proteins to a smaller number of driving processes; and to mine effective drug targets from these processes.
[0189] This method leverages information often overlooked in standard gene set analyses—known and predicted interactions between genes (and proteins), as well as the inclusion of other genes in the same or related pathways. Specifically, the inventors used network models to analyze a genome-wide association study (GWAS) meta-analysis of non-alcoholic fatty liver disease (NAFLD), and the results highlighted that SLC25A5 / ANT2 is a preferred target for NAFLD among other known NAFLD-related targets.
[0190] The inhibition disclosed in this article can target the SLC25A5 gene or the ANT2 protein produced by the expression of the SLC25A5 gene. When SLC25A5 / ANT2 is mentioned in the article, it is explicitly included to include the inhibition of gene expression or function, as well as the inhibition of protein products.
[0191] definition
[0192] The “first strand” (also referred to herein as the antisense strand or guide strand, which are used interchangeably) refers to a nucleic acid strand, such as an siRNA (e.g., dsiRNA), containing a region substantially complementary to a target sequence (e.g., mRNA). The term “complementary region” as used herein refers to a region on the antisense strand substantially complementary to a sequence (e.g., the target sequence). When the complementary region is not perfectly complementary to the target sequence, mismatches may occur in internal or terminal regions of the molecule. In some embodiments, double-stranded nucleic acids (e.g., the siRNA agents described herein) contain nucleotide mismatches in the antisense strand.
[0193] "Second strand" (also referred to as the sense strand or the passerby strand in this paper, which are used interchangeably) refers to a nucleic acid strand (e.g., siRNA) that contains a region substantially complementary to the antisense strand (as defined in this paper) region.
[0194] In the case where the molecule contains a nucleic acid having a ligand portion and optionally also a linker portion, the nucleic acid described in this application may be referred to as an oligonucleotide portion or an oligonucleotide portion.
[0195] Oligonucleotides are short nucleic acid polymers. Although oligonucleotides contain phosphodiester bonds between their nucleoside components (bases plus sugars), this application is not limited to oligonucleotides in which adjacent nucleosides are always linked by such phosphodiester bonds, but also considers other oligomers of nucleosides linked by bonds other than phosphate bonds. For example, the bond between nucleotides can be a thiophosphate bond. Therefore, the term "oligonucleotide" herein encompasses oligonucleotides and other nucleoside oligomers. According to this application, an oligonucleotide is preferably a nucleic acid having at least a portion that is an oligonucleotide. According to this application, an oligonucleotide is also preferred having one or more or most of phosphodiester backbone bonds between nucleosides. According to this application, an oligonucleotide is also preferred having one or more or most of phosphodiester backbone bonds between nucleosides, and one or more thiophosphate backbone bonds between nucleosides (typically in the terminal regions of the first and / or second chains).
[0196] The nucleic acids described herein are preferably double-stranded oligonucleotides containing one or more phosphate thioester backbone bonds between the nucleosides. Therefore, in all instances where oligonucleotides are mentioned in this application, particularly in the chemical structures disclosed herein, the oligonucleotides can also be oligonucleotides as defined herein.
[0197] In some embodiments, the double-stranded nucleic acid (e.g., siRNA) described in this application contains a nucleoside mismatch in the sense strand. In some embodiments, the nucleoside mismatch is located, for example, within 5, 4, 3, 2, or 1 nucleoside from the 3' end of the nucleic acid (e.g., siRNA).
[0198] In another embodiment, the nucleoside mismatch is located within, for example, the 3' end nucleoside of a nucleic acid (such as siRNA).
[0199] "Target sequence" (also known as target RNA or target mRNA) refers to the continuous portion of the nucleoside sequence of an mRNA molecule formed during gene transcription. It can include mRNA products of primary transcription products after RNA processing, or it can be the continuous portion of the nucleotide sequence of any RNA molecule (such as LNCRNA that needs to be repressed).
[0200] The target sequence can be approximately 10-35 nucleotides long, such as approximately 15-30 nucleotides long. For example, the target sequence length can be approximately 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-2... 9, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleosides. The ranges and lengths between those ranges and lengths are also considered part of this application.
[0201] The terms “ribonucleoside” or “nucleoside” can also refer to modified nucleosides as further described below.
[0202] Nucleic acids can be DNA or RNA, and can contain modified nucleosides. RNA is preferred.
[0203] The terms “iRNA,” “siRNA,” “RNAi agent,” “iRNA agent,” and “RNA interference agent” are used interchangeably in this document and refer to RNA-containing agents that mediate targeted cleavage of RNA transcripts via the RNA-induced silencing complex (RISC) pathway. siRNA directs the sequence-specific degradation of mRNA through RNA interference (RNAi).
[0204] In this document, double-stranded RNA is referred to as "double-stranded siRNA (dsiRNA) agent," "double-stranded siRNA (dsiRNA) molecule," "double-stranded RNA (dsRNA) agent," "double-stranded RNA (dsRNA) molecule," "dsiRNA agent," "dsiRNA molecule," or "dsiRNA," referring to a ribonucleic acid molecular complex with a double-stranded structure comprising two antiparallel and substantially complementary nucleic acid strands, exhibiting "sense" and "antisense" orientations relative to the target RNA. Most nucleosides in each strand of the nucleic acid (such as dsRNA molecules) are preferably ribonucleosides; however, in this case, one or both strands may also contain one or more non-ribonucleosides, such as deoxyribonucleosides or modified ribonucleosides. Furthermore, the term "siRNA" as used in this specification may contain chemically modified ribonucleosides.
[0205] The term "modified nucleoside" refers to a nucleoside that independently has a modified sugar moiety, a modified nucleoside internucleotide, or a modified nucleobase, or any combination thereof. Therefore, the term "modified nucleoside" encompasses substitution, addition, or removal of, for example, functional groups or atoms, from nucleoside internucleotides, sugar moieties, or nucleobases. For the purposes of this specification and claims, any such modification (such as that used in siRNA-type molecules) is covered by "iRNA," "RNAi agent," "siRNA," or "siRNA agent."
[0206] The length of the double-stranded region of the nucleic acid (e.g., dsRNA) described in this application can be approximately 9 to 40 base pairs, for example, 9 to 36 base pairs, for example, approximately 15 to 30 base pairs, such as approximately 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs, such as approximately 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18- 30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23 or 21-22 base pairs.
[0207] The two strands that form a double helix can be different parts of a larger molecule or separate molecules, such as RNA molecules.
[0208] The term "nucleoside overhang" refers to at least one unpaired nucleoside extending from the double-stranded structure of a double-stranded nucleic acid. A double-stranded nucleic acid may contain at least one nucleoside overhang; or, the overhang may contain at least two, three, four, five, or more nucleosides. The nucleoside overhang may contain or consist of nucleoside analogs (including deoxynucleosides). The overhang may be located on the sense strand, antisense strand, or any combination thereof. Furthermore, the nucleoside at the overhang may be present at the 5' end, 3' end, or both ends of the antisense or sense strand.
[0209] In some embodiments, the antisense strand has 1-10 nucleosides at the 3' or 5' end, such as 0-3, 1-3, 2-4, 2-5, 4-10, 5-10, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleoside overhangs.
[0210] "Flat-ended" or "flat-ended" refers to a double-stranded nucleic acid without unpaired nucleosides at its ends, i.e., without nucleoside protrusions. The nucleic acids described in this application include nucleic acids that do not have nucleoside protrusions at one end or neither end.
[0211] Unless otherwise stated, those skilled in the art will understand that the term "complementarity," when used to describe the association of a first nucleoside sequence with a second nucleoside sequence, refers to the ability of an oligonucleotide containing the first nucleoside sequence to hybridize with an oligonucleotide or polynucleotide containing the second nucleoside sequence under certain conditions and form a double-stranded structure. Such conditions can be, for example, stringent conditions, which may include: 400 mM NaCl, 40 mM PIPES at pH 6.4, 1 mM EDTA, at 50 or 70 °C for 12–16 hours, followed by washing (see, for example, Molecular Cloning: A Laboratory Manual, Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press).
[0212] Complementary sequences within nucleic acids (e.g., dsiRNA) as described herein include oligonucleotides or polynucleotides containing a first nucleoside sequence paired with oligonucleotides or polynucleotides containing a second nucleoside sequence across the entire length of one or both nucleoside sequences. In this document, such sequences may be referred to as “perfectly complementary” to each other. However, when the first sequence is referred to herein as “substantially complementary” or “partially complementary” to the second sequence, the two sequences may be perfectly complementary, or they may form one or more mismatched base pairs, such as 2, 4, or 5 mismatched base pairs, but preferably no more than 5, while retaining the ability to hybridize under conditions most relevant to its final application (e.g., repressing gene expression via a RISC pathway). For the identification of complementarity, overhangs should not be considered mismatches. For example, a nucleic acid (e.g., dsRNA) containing one 17-nucleoside oligonucleotide and another 19-nucleoside oligonucleotide, where the longer oligonucleotide contains a 17-nucleoside sequence perfectly complementary to the shorter oligonucleotide, can still be referred to as “perfectly complementary.”
[0213] The “complementary” sequences used in this article may also include non-Watson-Crick base pairs or base pairs formed from non-natural and modified nucleosides, or formed entirely from them, provided that the requirements regarding their hybridization ability are met as described above. Such non-Watson-Crick base pairs include, but are not limited to, G:U Wobble or Hoogstein base pairs.
[0214] The terms “complementary,” “fully complementary,” and “basically / partially complementary” used in this article can be used to refer to base matching between the sense and antisense strands of a nucleic acid (e.g., dsiRNA), or between the antisense strand and the target sequence of a double-stranded nucleic acid (e.g., siRNA).
[0215] In this application, the second strand of the nucleic acid (specifically, dsiRNA for inhibiting SLC25A5) is at least partially complementary to the first strand of the nucleic acid. In some embodiments, the first and second strands of the nucleic acid are partially complementary if the first and second strands form a double-stranded region of at least 17 base pairs in length, and the double-stranded region contains no more than 1, 2, 3, 4, or 5 mismatched base pairs.
[0216] In some embodiments, if the first and second strands of the nucleic acid described in this application form a double-stranded region of at least 19 base pairs in length, and the double-stranded region contains no more than 1, 2, 3, 4, or 5 mismatched base pairs, then the first and second strands of the nucleic acid are partially complementary. In some embodiments, if the first and second strands of the nucleic acid described in this application form a double-stranded region of at least 21 base pairs in length, and the double-stranded region contains no more than 1, 2, 3, 4, or 5 mismatched base pairs, then the first and second strands of the nucleic acid are partially complementary.
[0217] Alternatively, if the first and second strands of the nucleic acid described in this application form a double-stranded region of at least 17 base pairs in length, wherein at least 14, 15, 16, or 17 of the base pairs are complementary base pairs (particularly Watson-Crick base pairs), then the first and second strands of the nucleic acid are partially complementary.
[0218] In some embodiments, if the first and second strands of the nucleic acid described in this application form a double-stranded region of 19 base pairs in length, wherein at least 14, 15, 16, 17, 18, or all 19 base pairs are complementary base pairs (especially Watson-Crick base pairs), then the first and second strands of the nucleic acid are partially complementary. In some embodiments, if the first and second strands of the nucleic acid described in this application form a double-stranded region of 21 base pairs in length, wherein at least 16, 17, 18, 19, 20, or all 21 base pairs are complementary base pairs (especially Watson-Crick base pairs), then the first and second strands of the nucleic acid are partially complementary.
[0219] As used herein, a nucleic acid that is at least partially “substantially complementary” or “partially complementary” to messenger RNA (mRNA) refers to a polynucleotide that is substantially or partially complementary to a continuous portion of a target mRNA (such as the mRNA encoding a gene). In some embodiments, the continuous portion of the mRNA is any of the sequences listed in Table 1, i.e., any of the sequences in SEQ ID NO:1-276. For example, if the sequence of the polynucleotide is substantially or partially complementary to an uninterrupted portion of the mRNA encoding the target gene, then the polynucleotide is complementary to at least a portion of the mRNA of the target gene.
[0220] Therefore, in some preferred embodiments, the antisense oligonucleotides disclosed herein are completely complementary to the target gene sequence.
[0221] In other embodiments, the antisense oligonucleotides disclosed herein are substantially or partially complementary to the target RNA sequence and comprise a continuous nucleotide sequence that is at least about 80% complementary to the equivalent region of the target RNA sequence over its entire length, for example, at least about 85%, 86%, 87%, 88%, 89%, about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or 100% complementary.
[0222] In some embodiments, the first (antisense) strand of the nucleic acid described in this application is partially or completely complementary to a consecutive portion of RNA transcribed from the SLC25A5 gene. In some embodiments, the first strand of the nucleic acid described in this application is partially or completely complementary to a consecutive portion of at least 17 nucleotides of the SLC25A5 mRNA. In some embodiments, the first strand of the nucleic acid described in this application is partially or completely complementary to a consecutive portion of 17, 18, 19, 20, 21, 22, or 23 nucleotides of the SLC25A5 mRNA. In some embodiments, the first strand of the nucleic acid described in this application is partially or completely complementary to a consecutive portion of 17, 18, 19, 20, 21, 22, or 23 nucleotides of any sequence listed in Table 1 (i.e., any sequence in SEQ ID NO: 1-276).
[0223] In some embodiments, if the first (antisense) strand of the nucleic acid described in this application comprises a continuous nucleoside sequence of at least 17 nucleotides, wherein at least 14, 15, 16, or 17 nucleotides in the continuous nucleoside sequence are complementary to a continuous portion of the SLC25A5 mRNA, then the first (antisense) strand is partially complementary to a continuous portion of the SLC25A5 mRNA. In some embodiments, the first strand of the nucleic acid described in this application comprises a continuous nucleoside sequence of at least 17 nucleotides, wherein at least 14, 15, 16, or 17 nucleotides in the continuous nucleoside sequence are complementary to a continuous portion of any sequence listed in Table 1 (i.e., any sequence in SEQ ID NO: 1-276). In some embodiments, the first strand of the nucleic acid described in this application comprises a continuous nucleoside sequence of 19 nucleotides, wherein at least 14, 15, 16, 17, 18, or all 19 nucleotides in the continuous nucleoside sequence are complementary to a continuous portion of any sequence listed in Table 1 (i.e., any sequence in SEQ ID NO: 1-276). In some embodiments, the first strand of the nucleic acid described in this application comprises a continuous nucleoside sequence of 23 nucleosides, wherein at least 18, 19, 20, 21, 22 or all 23 nucleosides in the continuous nucleoside sequence are complementary to a continuous portion of any sequence listed in Table 1 (i.e. any sequence in SEQ ID NO: 1-276).
[0224] In some embodiments, the nucleic acid (such as siRNA) described in this application comprises a positive strand that is substantially or partially complementary to an antisense oligonucleotide, which in turn is complementary to a target gene sequence and comprises a continuous nucleoside sequence. The nucleoside sequence of the positive strand is typically at least about 80% complementary to the equivalent region of the nucleoside sequence of the antisense strand over its entire length, for example, about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or 100% complementary.
[0225] In some embodiments, the nucleic acid (such as siRNA) described in this application comprises an antisense strand that is substantially or partially complementary to a target sequence, and the antisense strand comprises a continuous nucleoside sequence that is at least 80% complementary to the target sequence over its entire length, for example, about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or 100% complementary.
[0226] As used herein, "subject" refers to an animal, such as a mammal, including primates (e.g., humans, non-human primates (e.g., monkeys, and chimpanzees) or non-primates or birds, that expresses the target gene endogenously or heterologously when the target gene sequence has sufficient complementarity with a nucleic acid (e.g., an iRNA agent) to facilitate target knockdown. In some preferred embodiments, the subject is a human.
[0227] The term "treatment" refers to a beneficial or desired outcome, including but not limited to the relief or improvement of one or more symptoms related to gene expression. "Treatment" can also refer to an extension of life expectancy compared to the expected lifespan without treatment.
[0228] As used herein, the term “prevent” is defined as the elimination or reduction of the likelihood of the occurrence of one or more symptoms of a disease or disorder. For example, the inhibitors disclosed herein may be used to prevent the occurrence of metabolic diseases or disorders associated with non-alcoholic fatty liver disease (NAFLD), and / or obesity, and / or diseases or disorders associated with lipogenesis.
[0229] As used herein, “therapeutic effective amount” means to include an amount of nucleic acid (e.g., iRNA) that, when administered to a patient to treat a subject with a disease, is sufficient to achieve effective treatment of the disease (e.g., by reducing, improving, or maintaining an existing disease or one or more symptoms of the disease or its associated comorbidities).
[0230] As used in this article, "pharmaceutically acceptable" means a compound, material, composition, or dosage form that is suitable for tissue contact with human and animal subjects without excessive toxicity, irritation, allergic reactions, or other problems or complications, and has a reasonable benefit / risk ratio.
[0231] As used herein, the phrase "pharmaceutically acceptable carrier" refers to a pharmaceutically acceptable material, composition, or medium, such as a liquid or solid filler, diluent, excipient, manufacturing aid, or solvent encapsulating material, relating to the delivery or transport of a target compound from one organ or body site to another. Each carrier must be "acceptable," meaning it is compatible with other components in the dosage form and will not cause harm to the subject receiving treatment.
[0232] When listing the values or ranges of parameters, the intermediate values and ranges listed are also intended to be part of this application.
[0233] The articles “a” and “one” used in this article refer to one or more grammatical objects of the article (i.e., at least one).
[0234] The term “includes” as used herein means the phrase “includes but is not limited to”, and may be used interchangeably with the phrase.
[0235] Unless the context clearly indicates otherwise, the term “or” as used herein is used to mean “and / or” and is used interchangeably with the term “and / or”. For example, “justice chain or antisense chain” should be understood as “justice chain or antisense chain or justice chain and antisense chain”.
[0236] As used herein, the term “about” refers to the standard tolerance range in this field. For example, “about” can be understood as approximately 2 standard deviations from the mean. In some implementations, “about” means +10%. In some implementations, “about” means +5%. When “about” appears before a series of numbers or ranges, it should be understood that “about” may modify each number in that series or range.
[0237] The term "at least" preceding a number or series of numbers should be understood to include the number adjacent to the term "at least," as well as all subsequent numbers or integers that can be logically understood from the context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For instance, "at least 18 nucleotides in a nucleic acid molecule of 21 nucleotides" means that 18, 19, 20, or 21 nucleotides have the indicated property. When "at least" appears before a series of numbers or a range, it should be understood that "at least" can modify each number in that series or range.
[0238] As used herein, “not more than” or “less than” should be understood as the value adjacent to the phrase and all lower values or integers up to 0 that can be logically inferred from the context. For example, a double strand with “not more than 2 nucleotides” has 2, 1, or 0 nucleotides. When “not more than” appears before a series of numbers or a range, it should be understood that “not more than” can modify each number in that series or range.
[0239] The terminal region of the chain is the last 5 nucleotides from the 5' end or 3' end.
[0240] The nucleobase sequence is the sequence of nucleic acid bases in an oligomer.
[0241] Those skilled in the art can combine various embodiments of this application as needed.
[0242] target
[0243] The inhibitory targets disclosed in this article may be, but are not limited to, mRNA, peptides, proteins, or genes.
[0244] These targets are targets that inhibit which may help prevent and / or treat metabolic diseases or disorders associated with non-alcoholic fatty liver disease (NAFLD), and / or obesity, and / or diseases or disorders associated with lipogenesis, and / or help reduce lipogenesis.
[0245] The target of repression is the gene SLC25A5 or its gene product, such as mRNA transcribed from the SLC25A5 gene or ANT2 protein, and repression can be achieved by inhibiting the expression or function of the SLC25A5 / ANT2 gene or protein or both.
[0246] In a preferred embodiment, the target is mRNA expressed from the SLC25A5 gene.
[0247] Table 1 below lists exemplary target sequences on SLC25A5 mRNA.
[0248] Table 1 below provides the oligonucleotide mRNA target sequences of SLC25A5 and their corresponding positions in transcript ENST00000317881.9. It should be understood that SEQ ID NO:1-276 refers to human (Homo sapiens) mRNA sequences.
[0249] Table 1
[0250]
[0251]
[0252]
[0253]
[0254]
[0255]
[0256]
[0257]
[0258] It should be understood that SEQ ID NO:1-276 involves human (Homo sapiens) mRNA sequences.
[0259] Diseases / symptoms
[0260] This application also provides a method for treating a subject in need. The treatment method described in this application comprises administering a therapeutically effective amount of the nucleic acid (such as siRNA) described in this application, such as a nucleic acid (such as siRNA) targeting SLC25A5, or a pharmaceutical composition containing a nucleic acid targeting SLC25A5, to a subject (e.g., who will benefit from reduced or inhibited SLC25A5 gene expression). The treated disease is related to metabolic disorders or disturbances, such as those associated with non-alcoholic fatty liver disease (NAFLD), and / or obesity, and / or those associated with lipogenesis, and / or lipogenesis.
[0261] The inhibitors described in this application can be used to prevent and / or treat metabolic diseases or disorders. As used herein, the term "metabolic disease" refers to a disease or condition that affects the metabolic processes of a subject, typically caused by disruption of normal metabolism.
[0262] The patient to be treated may be a patient who already has a metabolic disease or disorder, or a patient at risk of developing a metabolic disease or disorder. That is, in some embodiments, the inhibitors described in this application can be used to treat and / or control existing metabolic diseases or disorders. Treating and / or controlling existing metabolic diseases or disorders with the inhibitors described in this application can prevent the worsening of the metabolic disease or disorder and / or reverse it. In some cases, treatment with the inhibitors described in this application can even cure the metabolic disease or disorder. In some embodiments, the inhibitors described in this application can be used to prevent the manifestation of metabolic diseases or disorders in patients at risk of developing them.
[0263] Those skilled in the art can diagnose whether a patient has a metabolic disease or disorder, or is at risk of developing a metabolic disease or disorder. For example, a metabolic disease or disorder can be diagnosed based on weight changes and / or one or more blood markers, including, but not limited to, blood glucose levels, blood insulin levels, blood free fatty acid levels, blood HbA1c levels, blood fibrinogen levels, blood cholesterol levels, and blood triglyceride levels. Those skilled in the art are aware of the thresholds for one or more blood markers that indicate the presence of a metabolic disease or disorder, or the risk of developing a metabolic disease or disorder.
[0264] In some implementations, the metabolic disease is fatty liver, particularly non-alcoholic fatty liver disease (NAFLD). As used herein, “fatty liver” refers to a condition characterized by excessive fat accumulation in the liver that can lead to serious conditions such as chronic hepatitis and cirrhosis. In patients with fatty liver, lipids, particularly triglycerides, accumulate in hepatocytes to an extent exceeding physiological limits. The biochemical standard for diagnosing fatty liver is that triglycerides constitute approximately 10% (100 mg / g wet weight) or more of the liver tissue's wet weight. Fatty liver is typically monitored by observing elevated serum levels of liver-specific enzymes (such as ALT and AST transaminases), indicators of hepatocyte damage, and by observing symptoms including fatigue and pain in the liver area. However, definitive diagnosis often requires a biopsy and may require imaging support such as ultrasound and / or MRI. As used herein, “NAFLD” or “non-alcoholic fatty liver” refers to a condition caused by fat deposition in the liver (steatodegenesis) rather than excessive alcohol consumption. It is associated with insulin resistance and metabolic syndrome.
[0265] In a preferred embodiment, fatty liver is non-alcoholic steatohepatitis (NASH). As used herein, NASH refers to a liver disease characterized by fat accumulation (lipid droplets) and inflammation and degeneration of hepatocytes. Once it develops, the disease is accompanied by a high risk of cirrhosis, altered liver function, and the potential to progress to liver failure. Subsequently, NASH often progresses to liver cancer.
[0266] In some embodiments, this application relates to the use of the inhibitor described herein in reducing one or more of steatosis, lobular inflammation, and / or hepatocellular ballooning degeneration.
[0267] In some embodiments, this application relates to the use of the inhibitor described herein in the treatment and / or prevention of diseases or disorders associated with increased steatosis, increased lobular inflammation, and / or increased hepatocellular ballooning degeneration.
[0268] In some embodiments, this application relates to the use of the inhibitor described herein in the treatment and / or prevention of fatty liver (such as NAFLD or NASH), wherein the inhibitor described herein results in one or more of the following: reduced steatosis, reduced lobular inflammation, and / or reduced hepatocellular ballooning degeneration.
[0269] In some embodiments, this application relates to the use of the inhibitor described herein in the treatment and / or prevention of hepatic steatosis.
[0270] In some embodiments, this application relates to the use of the inhibitor described herein in the treatment and / or prevention of lobular inflammation.
[0271] In some embodiments, this application relates to the use of the inhibitor described herein in the treatment and / or prevention of hepatocellular ballooning degeneration.
[0272] In some embodiments, this application relates to the use of the inhibitor described herein in the treatment and / or prevention of liver fibrosis in patients.
[0273] In some embodiments, this application relates to the use of the inhibitor described herein in the treatment and / or prevention of diseases or disorders associated with liver fibrosis.
[0274] In some embodiments, this application relates to the use of the inhibitors described herein in the treatment and / or prevention of fatty liver such as NAFLD or NASH, wherein the inhibitors described herein reduce the fibrotic stage.
[0275] Those skilled in the art know methods for identifying stages of hepatic steatosis, lobular inflammation, hepatocellular ballooning degeneration, or fibrosis in patients.
[0276] In some embodiments, this application relates to the use of the inhibitor described herein in reducing the levels of one or more of alanine aminotransferase (ALT), aspartate aminotransferase (AST), tissue inhibitor of metalloproteinases-1 (TIMP-1), and / or type III procollagen peptide (PIIINP) in a patient.
[0277] In some embodiments, this application relates to the use of the inhibitor described herein in the treatment and / or prevention of diseases associated with elevated levels of one or more of alanine aminotransferase (ALT), aspartate aminotransferase (AST), tissue inhibitor of metalloproteinases-1 (TIMP-1), and / or type III procollagen peptide (PIIINP) in a patient.
[0278] In some embodiments, this application relates to the use of the inhibitor described herein in the treatment and / or prevention of metabolic diseases or disorders associated with elevated levels of one or more of alanine aminotransferase (ALT), aspartate aminotransferase (AST), tissue inhibitor of metalloproteinases-1 (TIMP-1), and / or type III procollagen peptide (PIIINP) in a patient.
[0279] In some embodiments, this application relates to the use of the inhibitor described herein in the treatment and / or prevention of metabolic diseases or disorders, wherein the inhibitor described herein reduces the level of one or more of alanine aminotransferase (ALT), aspartate aminotransferase (AST), tissue inhibitor of metalloproteinases-1 (TIMP-1), and / or type III procollagen peptide (PIIINP) in a patient.
[0280] In some embodiments, this application relates to the use of the inhibitor described herein in the treatment and / or prevention of fatty liver (such as NAFLD or NASH), wherein the inhibitor described herein reduces the level of one or more of alanine aminotransferase (ALT), aspartate aminotransferase (AST), tissue inhibitor of metalloproteinases-1 (TIMP-1), and / or type III procollagen peptide (PIIINP) in the patient.
[0281] Those skilled in the art are familiar with methods and commercial kits for identifying ALT, AST, TIMP-1 and PIIINP levels in patients.
[0282] In some embodiments, this application relates to the use of the inhibitor described herein in reducing the liver weight to body weight ratio.
[0283] In some embodiments, this application relates to the use of the inhibitor described herein in the treatment and / or prevention of diseases or disorders associated with increased liver weight.
[0284] In some embodiments, this application relates to the use of the inhibitor described herein in the treatment and / or prevention of metabolic diseases or disorders associated with increased liver weight.
[0285] In some embodiments, this application relates to the use of the inhibitors described herein in the treatment and / or prevention of metabolic diseases or disorders, wherein the inhibitors described herein reduce the ratio of liver weight to body weight in patients.
[0286] In some embodiments, this application relates to the use of the inhibitors described herein in the treatment and / or prevention of fatty liver diseases (such as NAFLD or NASH), wherein the inhibitors described herein reduce the ratio of liver weight to body weight in patients.
[0287] In some implementations, the metabolic disease is obesity. As used herein, the term "obesity" refers to a condition in which the natural energy reserves stored in the adipose tissue of an animal (particularly humans and other mammals) increase to a degree associated with certain health conditions or increased mortality. As used herein, "obesity" for adults is defined as a body mass index (BMI) greater than 30. Obesity is generally associated with excessive weight gain, particularly diet-induced weight gain. Here, "(diet-induced) weight gain" is defined as weight gain resulting from excessive dietary intake, including excessive intake of fats (particularly saturated fats) and optional monosaccharides (particularly sucrose and fructose). For a given subject, excessive dietary intake (particularly excessive intake of fats and optional monosaccharides) means that dietary expenditure (particularly expenditure of fats and optional monosaccharides) exceeds the amount required to meet physiological needs and maintain the subject's energy balance. The effectiveness of treatment in reducing or preventing diet-induced weight gain in subjects can be assessed by comparing the weight gain of treated subjects with that of untreated subjects receiving the same diet and having the same level of physical activity.
[0288] In some implementations, a patient is considered at risk of obesity if their BMI is greater than 25. In some implementations, a patient is considered obese if their BMI is greater than 30.
[0289] The term “body mass index” as used in this article refers to the ratio of weight (in kilograms) to the square of height (in meters).
[0290] "Diseases related to lipogenesis" refer to medical conditions characterized by the excessive accumulation of adipose tissue due to the abnormal proliferation and differentiation of fat cells in the body. These conditions often lead to health complications such as obesity, metabolic disorders, and related comorbidities.
[0291] In this application, "reducing lipogenesis" refers to a medical or pharmaceutical intervention aimed at reducing the formation and accumulation of fat cells in the body. The reduction in lipogenesis can be identified and / or quantified based on the size and / or number of fat cells in tissue samples obtained from a patient. Alternatively or additionally, the reduction in lipogenesis can be identified and / or quantified by gene expression analysis, measurement of adipogenesis markers (i.e., by ELISA), assessment of lipid accumulation in samples, and / or measurement of triglyceride levels in cells or tissues.
[0292] Therefore, in a specific implementation, this application relates to an inhibitor suitable for use in or for the prevention and / or treatment of metabolic diseases or disorders, such as metabolic diseases or disorders associated with non-alcoholic fatty liver disease (NAFLD), and / or obesity, and / or diseases or disorders associated with lipogenesis, and / or for reducing lipogenesis.
[0293] Inhibitors
[0294] The inhibitors described in this application comprise nucleic acids (such as siRNA), antibodies and their antigen-binding fragments (e.g., monoclonal antibodies), peptides, antibody-drug conjugates, and small molecules. Nucleic acids (such as siRNA) are preferred.
[0295] Some preferred features of the inhibitors described in this application are as follows, wherein these inhibitors are oligonucleotides (such as siRNA).
[0296] In some embodiments, the nucleic acid comprises a first strand containing a sequence at least partially complementary to a portion of the RNA transcribed from the SLC25A5 gene (SEQ ID NO: 1381). In a preferred embodiment, the nucleic acid comprises a first strand containing a sequence at least partially complementary to the SLC25A5 mRNA.
[0297] In some embodiments, the nucleic acid used to suppress SLC25A5 gene expression comprises a double-stranded region, the double-stranded region comprising a first strand and a second strand at least partially complementary to the first strand, wherein the first strand:
[0298] (i) at least partially complementary to a portion of the RNA transcribed from the SLC25A5 gene, and
[0299] (ii) Contains at least 17 consecutive nucleosides, wherein the consecutive nucleosides differ from any sequence in SEQ ID NO:277-552 by 0 or 1 nucleoside.
[0300] In some embodiments, the first chain comprises nucleosides 2-18 of any sequence listed in SEQ ID NO:277-552.
[0301] In some embodiments, the first chain comprises any of the sequences in SEQ ID NO:277-552.
[0302] In some embodiments, the second chain comprises a nucleoside sequence of at least 17 consecutive nucleosides that differ from any of the sequences in SEQ ID NO:553-828 by 0 or 1 nucleoside; wherein the second chain has at least 85% complementary regions on the first chain of the 17 consecutive nucleosides.
[0303] In some embodiments, the second chain comprises any of the sequences in SEQ ID NO:553-828.
[0304] In some embodiments, the nucleic acid used to suppress SLC25A5 gene expression comprises a double-stranded region, the double-stranded region comprising a first strand and a second strand at least partially complementary to the first strand, wherein the first strand:
[0305] (i) is at least partially complementary to a portion of the RNA transcribed from the SLC25A5 gene, and
[0306] (ii) Contains at least 21 consecutive nucleosides that differ from any of the sequences in SEQ ID NO:277-552 by 0 or 1 nucleoside.
[0307] In some embodiments, the first chain comprises nucleosides 2-22 of any sequence listed in SEQ ID NO:277-552.
[0308] In some embodiments, the second chain comprises a nucleoside sequence of at least 17 consecutive nucleosides, the consecutive nucleosides differing from any sequence in SEQ ID NO:553-828 by 0 or 1 nucleoside; wherein the second chain has at least 85% complementary regions to the first chain on the 17 consecutive nucleosides.
[0309] In some embodiments, the second chain comprises any of the sequences in SEQ ID NO:553-828.
[0310] In some embodiments, the second chain comprises a nucleoside sequence of at least 19 consecutive nucleosides, the consecutive nucleosides differing from any sequence in SEQ ID NO:553-828 by 0 or 1 nucleoside; wherein the second chain has at least 85% complementary regions to the first chain on the 19 consecutive nucleosides.
[0311] In some embodiments, the second chain comprises a nucleoside sequence of at least 21 consecutive nucleosides, the consecutive nucleosides differing from any sequence in SEQ ID NO:553-828 by 0 or 1 nucleoside; wherein the second chain has at least 85% complementary regions to the first chain on the 21 consecutive nucleosides.
[0312] In some embodiments, the nucleic acid comprises a first strand comprising a nucleoside sequence differing from any sequence in SEQ ID NO:277-552 by 0 or 1 nucleoside, or consisting of or substantially consisting of a nucleoside sequence differing from any sequence in SEQ ID NO:277-552 by 0 or 1 nucleoside.
[0313] And a second chain comprising a nucleoside sequence that differs from any sequence in SEQ ID NO:553-828 by 0 or 1 nucleoside, or consisting of or substantially consisting of a nucleoside sequence that differs from any sequence in SEQ ID NO:553-828 by 0 or 1 nucleoside.
[0314] The preferred bisense region described herein is formed between a first (antense) chain and a complementary second (justice) chain. Table 2 below lists exemplary pairings of complementary antisense chains and justice chains.
[0315] Table 2 provides the unmodified first (antisense) strand sequence and the corresponding unmodified second (sense) strand sequence of the siRNA oligonucleotide described in this application, as well as their corresponding positions in the overall gene sequence of SEQ ID NO:1381, as shown below.
[0316] Table 2:
[0317]
[0318]
[0319]
[0320]
[0321]
[0322]
[0323]
[0324]
[0325]
[0326]
[0327]
[0328]
[0329]
[0330] In a specific implementation, this application relates to a nucleic acid comprising a first strand and a second strand, wherein the first and second strands comprise a nucleoside sequence differing from any of the following first and second sequences by 0 or 1 nucleoside, and are composed of or substantially composed of nucleoside sequences differing from any of the following first and second sequences by 0 or 1 nucleoside:
[0331] Unmodified first chain Unmodified second chain SEQ ID NO:304 SEQ ID NO:580 SEQ ID NO:323 SEQ ID NO:599 SEQ ID NO:439 SEQ ID NO:715 SEQ ID NO:453 SEQ ID NO:729 SEQ ID NO:496 SEQ ID NO:772
[0332] In a particularly preferred embodiment, this application relates to a nucleic acid comprising a first strand and a second strand, the first strand and the second strand comprising a nucleoside sequence differing from any of the following first and second sequences by 0 or 1 nucleoside, and consisting of or substantially consisting of a nucleoside sequence differing from any of the following first and second sequences by 0 or 1 nucleoside:
[0333] Unmodified first chain Unmodified second chain SEQ ID NO:304 SEQ ID NO:580
[0334] In some embodiments, the nucleic acid used to suppress SLC25A5 gene expression comprises a double-stranded region, the double-stranded region comprising a first strand and a second strand at least partially complementary to the first strand, wherein the first strand:
[0335] (i) at least partially complementary to a portion of the RNA transcribed from the SLC25A5 gene, and
[0336] (ii) Contains at least 17 consecutive nucleosides, wherein the consecutive nucleosides differ from any sequence of SEQ ID NO:829-1104 by 0 or 1 nucleoside.
[0337] In some embodiments, the first chain comprises nucleosides 2-18 of any sequence listed in SEQ ID NO:829-1104.
[0338] In some embodiments, the nucleic acid used to suppress SLC25A5 gene expression comprises a double-stranded region, the double-stranded region comprising a first strand and a second strand at least partially complementary to the first strand, wherein the first strand:
[0339] (i) at least partially complementary to a portion of the RNA transcribed from the SLC25A5 gene, and
[0340] (ii) Contains at least 21 consecutive nucleosides, wherein the consecutive nucleosides differ from any sequence in SEQ ID NO:829-1104 by 0 or 1 nucleoside.
[0341] In some embodiments, the first chain comprises nucleosides 2-22 of any sequence listed in SEQ ID NO:829-1104.
[0342] In some embodiments, the first chain comprises any of the sequences in SEQ ID NO:829-1104.
[0343] The modification patterns of the nucleic acids listed in SEQ ID NO:829-1104 are summarized in Table 3 below:
[0344] Table 3 provides the first (antisense) sequence of the modified siRNA oligonucleotide described in this application, and the corresponding unmodified first (antisense) sequence, as shown below.
[0345] Table 3
[0346]
[0347]
[0348]
[0349]
[0350]
[0351]
[0352]
[0353]
[0354]
[0355]
[0356]
[0357]
[0358]
[0359]
[0360] In some embodiments, the second chain comprises a nucleoside sequence of at least 17 consecutive nucleosides, the consecutive nucleoside sequence differing from any of the sequences in SEQ ID NO:1105-1380 by 0 or 1 nucleoside; wherein the second chain has at least 85% complementary regions to the first chain on the 17 consecutive nucleosides.
[0361] In some embodiments, the second chain comprises a nucleoside sequence of at least 19 consecutive nucleosides, which differ from any of the sequences in SEQ ID NO:1105-1380 by 0 or 1 nucleoside; wherein the second chain has at least 85% complementary regions to the first chain on the 19 consecutive nucleosides.
[0362] In some embodiments, the second chain comprises a nucleoside sequence of at least 21 consecutive nucleosides, the consecutive nucleosides differing from any of the sequences in SEQ ID NO:1105-1380 by 0 or 1 nucleoside; wherein the second chain has at least 85% complementary regions to the first chain on the 21 consecutive nucleosides.
[0363] In some embodiments, the second chain comprises any of the sequences in SEQ ID NO:1105-1380.
[0364] The modification patterns of the nucleic acids listed in SEQ ID NO:1105-1380 are summarized in Table 4 below:
[0365] Table 4 provides the modified second (sense) sequence of the siRNA oligonucleotide described in this application, as well as the corresponding unmodified second (sense) sequence, as shown below.
[0366] Table 4
[0367]
[0368]
[0369]
[0370]
[0371]
[0372]
[0373]
[0374]
[0375]
[0376]
[0377] As used herein, particularly in Tables 3 and 4, the following abbreviations are used for modified nucleosides:
[0378] A-Adenosine
[0379] C-cytidine
[0380] G-guanosine
[0381] T-thymidine
[0382] m—2'-O-methyl
[0383] f—2' Fluorine
[0384] s-thiophosphate bond
[0385] o-thermally unstable nucleoside
[0386] ia—inverted abase-free nucleoside
[0387] Am represents 2'-O-methyl-adenosine, Cm represents 2'-O-methyl-cytidine, Gm represents 2'-O-methyl-guanosine, Um represents 2'-O-methyl-uridine, Af represents 2'-fluoro-adenosine, Cf represents 2'-fluoro-cytidine, Gf represents 2'-fluoro-guanosine, and Uf represents 2'-fluoro-uridine.
[0388] Furthermore, the letter "s" is an abbreviation for the thiophosphate bond between two consecutive (modified) nucleosides. For example, the abbreviation "AmsAm" is used to represent two consecutive 2'-O-methyl-adenosine nucleosides linked by a 3'5' thiophosphate bond. Nucleosides linked by a standard 3'5' phosphodiester bond are not abbreviated. For example, the abbreviation "AmAm" is used to represent two consecutive 2'-O-methyl-adenosine nucleosides linked by a 3'5' phosphodiester bond.
[0389] As shown in Table 4 above, some modified second-strand sequences contain the preferred 5'iaia motif. However, it should also be understood that the range of these modified second-strand sequences also includes Me / F modified second strands without the 5'iaia motif.
[0390] In some embodiments, the nucleic acid comprises a first chain comprising (modified) nucleoside sequences differing from any sequence in SEQ ID NO:829-1104 by 0 or 1 nucleoside, or consisting of or substantially consisting of (modified) nucleoside sequences differing from any sequence in SEQ ID NO:829-1104 by 0 or 1 nucleoside.
[0391] And a second chain comprising (modified) nucleoside sequences differing from any of the sequences in SEQ ID NO:1105-1380 by 0 or 1 nucleoside, or consisting of (modified) nucleoside sequences differing from any of the sequences in SEQ ID NO:1105-1380 by 0 or 1 nucleoside.
[0392] The preferred combinations of complementary modified antonymous (first) chains and just (second) chains are shown in Table 5 below.
[0393] Table 5 identifies the doubly linked entities using doubly linked entity IDs, referring to the antonymous and righteous IDs modified in Tables 3 and 4 above.
[0394] Table 5
[0395]
[0396]
[0397]
[0398]
[0399]
[0400] For the double strands in Table 5:
[0401] ETX-M00001351—ETX-M00001626 preferably has the following characteristics: Figure 8bIts double-stranded structure.
[0402] In a particularly preferred embodiment, this application relates to a nucleic acid comprising a first strand and a second strand, the first strand and the second strand comprising a nucleoside sequence differing from any of the following first and second sequences by 0 or 1 nucleoside, or consisting of, or substantially consisting of, a nucleoside sequence differing from any of the following first and second sequences by 0 or 1 nucleoside:
[0403]
[0404] In a particularly preferred embodiment, this application relates to a nucleic acid comprising a first strand and a second strand, the first strand and the second strand comprising a nucleoside sequence differing from any of the following first and second sequences by 0 or 1 nucleoside, or consisting of, or substantially consisting of, a nucleoside sequence differing from any of the following first and second sequences by 0 or 1 nucleoside:
[0405]
[0406] If there is any ambiguity between the sequences in this specification and the sequences in the attached sequence list, the sequences provided herein shall be considered correct sequences.
[0407] non-base nucleotides
[0408] In some embodiments, the nucleic acid described in this application contains one, for example two, for example three, for example four or more abasic nucleosides. Abasic nucleosides are modified nucleosides because they lack a base that normally appears at position 1 of the sugar moiety. Generally, a hydrogen atom is present at position 1 of the sugar moiety in the nucleic acid described in this application.
[0409] The abasic nucleoside is located in the terminal region of the second chain, preferably within the last five nucleosides of the chain. The terminal region may consist of the last five nucleosides, including the abasic nucleoside.
[0410] As a preferred feature (unless mutually exclusive, combination is explicitly considered), the second chain may include:
[0411] Two or more anucleotides in the terminal region of the second chain; and / or
[0412] Two or more anucleotides in the 5' or 3' end region of the second strand; and / or
[0413] Two or more abasic nucleotides in the 5' or 3' end region of the second chain, wherein the abasic nucleotides are present in the overhangs as described herein; and / or
[0414] Two or more consecutive abasic nucleosides in the terminal region of the second chain, preferably one of such abasic nucleosides as the terminal nucleoside; and / or
[0415] The second chain contains two or more consecutive abasic nucleosides in the 5' or 3' terminal region, preferably one of which is a terminal nucleoside in the 5' or 3' terminal region of the second chain; and / or
[0416] A reverse nucleoside internucleotide bond connects at least one base-free nucleoside in the terminal region of the second chain to an adjacent basic nucleoside; and / or
[0417] A reverse nucleoside internucleotide bond connects at least one base-free nucleoside in the 5' or 3' end region of the second chain to an adjacent basic nucleoside; and / or
[0418] The penultimate nucleoside, being a base-free nucleoside, is linked to a non-terminal nucleoside (referred to herein as the penultimate nucleoside) via a reverse bond; and / or
[0419] When the chain is read along the direction toward the end containing the terminal nucleoside, it is a baseless nucleoside consisting of two terminal nucleosides linked by a 5'-3' bond;
[0420] When the chain is read along the direction toward the end containing the terminal nucleoside, it is a baseless nucleoside consisting of two terminal nucleosides linked by a 3'-5' bond;
[0421] As a nucleoside with no bases at the two ends, the penultimate nucleoside is linked to the penultimate nucleoside via a reverse bond, and the reverse bond is either a 5-5' reverse bond or a 3'-3' reverse bond;
[0422] As a nucleoside without bases at the two terminal positions, the penultimate nucleoside is linked to the penultimate nucleoside via a reverse bond, and in which
[0423] (1) The reverse bond is a 5-5' reverse bond, and when read toward the end containing the terminal and penultimate abasic nucleoside, the bond between the terminal and penultimate abasic nucleoside is 3'5'; or
[0424] (2) The reverse bond is a 3-3' reverse connection, and when read along the end containing the end and the penultimate abase nucleoside, the bond between the end and the penultimate abase nucleoside is 5'3'.
[0425] Preferably, the second chain has no nucleoside at its end.
[0426] Preferably, the terminal region of the second chain has two or more abase-free nucleosides, preferably at the terminal position and the penultimate position.
[0427] Preferably, two or more abasic nucleosides are consecutive; for example, all abasic nucleosides may be consecutive. For example, the terminal 1, terminal 2, terminal 3, or terminal 4 nucleotides may be abasic nucleosides.
[0428] Abase-free nucleosides can also be linked to adjacent nucleosides via 5'-3' phosphodiester bonds or reverse bonds, unless there is only one abase-free nucleoside at the end, in which case it has a reverse bond with the adjacent nucleoside.
[0429] Reverse bonds (also known as inverted bonds, which are common in the art) consist of 5'-5', 3'-3', 3'-2', or 2'-3' phosphodiester bonds between adjacent sugar moieties of a nucleoside.
[0430] Non-terminal abasic nucleosides have two phosphodiester bonds, one for each adjacent nucleoside, and these bonds can be anti-bonds or 5'-3 phosphodiester bonds, or each can have one.
[0431] A preferred embodiment includes two abase-free nucleosides at the end and penultimate position of the second chain, wherein the reverse nucleoside bond is located between the penultimate (abase-free) nucleoside and the penultimate nucleoside.
[0432] Preferably, there are two base-free nucleosides at the end and penultimate position of the second chain, and the penultimate nucleoside is connected to the penultimate nucleoside via an inverse internucleotide bond, and connected to the terminal nucleoside via a 5'-3' or 3'-5' phosphodiester bond (read along the direction of the molecule end).
[0433] Preferably, the nucleic acid described in this application comprises one or more abasic nucleosides, optionally wherein the one or more abasic nucleosides are located in the terminal region of the second chain, and / or wherein at least one abasic nucleoside is linked to an adjacent basic nucleoside via a reverse nucleoside internucleotide bond.
[0434] The different preferred features are as follows:
[0435] The reverse nucleoside internucleotide bond is a 3'-3' reverse bond. This reverse nucleoside internucleotide bond is located in the terminal region distal to the 5' end of the phosphate ester in the second chain.
[0436] The reverse nucleoside interbond is a 5'-5' reverse bond. This reverse nucleoside interbond is located in the terminal region distal to the 3' terminal hydroxyl group of the second chain.
[0437] In some embodiments, the second chain contains two consecutive abasic nucleosides in its 5' terminal region, one of which is the terminal nucleoside in the 5' terminal region of the second chain, and the other is the penultimate nucleoside in the 5' terminal region of the second chain, wherein: (a) the penultimate abasic nucleoside is connected to the first adjacent basic nucleoside in the adjacent 5' proximal terminal region by a reverse nucleoside bond; (b) the reverse bond is a 5-5' reverse bond; and (c) when read along the direction toward the end containing the terminal and penultimate abasic nucleosides, there is a 3'5' bond between the terminal and penultimate abasic nucleosides. More typically, (i) the first and second chains each have a length of 23 nucleotides; (ii) two thiophosphate nucleotide inter-bonds are present between three consecutive positions in the 5' proximal region of the second chain, wherein the first thiophosphate nucleotide inter-bond exists between the adjacent first basic nucleotide of (a) and the adjacent second basic nucleotide in the 5' proximal region of the second chain, and the second thiophosphate nucleotide inter-bond exists between the adjacent second basic nucleotide and the adjacent third basic nucleotide in the 5' proximal region of the second chain; (iii) in the... Two phosphate-thioester nucleoside bonds are respectively located between three consecutive positions in the 5' and 3' end regions of the first strand, thereby each terminal nucleoside in the 5' and 3' end regions of the first strand is connected to the corresponding penultimate 5' and 3' adjacent nucleoside via a phosphate-thioester nucleoside bond, and each first 5' and 3' penultimate nucleoside is connected to the corresponding penultimate 5' and 3' adjacent nucleoside via a phosphate-thioester nucleoside bond; and (iv) the second strand of the nucleic acid is directly or indirectly conjugated to one or more ligand moieties in the 3' end region of the second strand.
[0438] Alternatively, the second chain comprises two consecutive abasic nucleosides, preferably located at the protruding end of the 3' terminal region of the second chain, one of which is the terminal nucleoside of the 3' terminal region of the second chain, and the other is the penultimate nucleoside of the 3' terminal region of the second chain, wherein: (a) the penultimate abasic nucleoside is connected to the first adjacent basic nucleoside in the adjacent 3' proximal terminal region by a reverse nucleoside bond; (b) the reverse bond is a 3-3' reverse bond; and (c) when read along the direction toward the end containing the terminal and penultimate abasic nucleosides, there is a 5'-3' bond between the terminal and penultimate abasic nucleosides. More typically, (i) the first and second chains each have a length of 23 nucleotides; (ii) two thiophosphate nucleotide bonds are present between three consecutive positions in the 3' proximal region of the second chain, wherein the first thiophosphate nucleotide bond exists between the adjacent first basic nucleotide of (a) and the adjacent second basic nucleotide in the 3' proximal region of the second chain, and the second thiophosphate nucleotide bond exists between the adjacent second basic nucleotide and the adjacent third basic nucleotide in the 3' proximal region of the second chain; (iii) in the... Two phosphate-thioester nucleoside bonds are respectively located between three consecutive positions in the 5' and 3' end regions of the first strand, thereby each terminal nucleoside in the 5' and 3' end regions of the first strand is connected to the corresponding penultimate 5' and 3' adjacent nucleoside via a phosphate-thioester nucleoside bond, and each first 5' and 3' penultimate nucleoside is connected to the corresponding penultimate 5' and 3' adjacent nucleoside via a phosphate-thioester nucleoside bond; and (iv) the second strand of the nucleic acid is directly or indirectly conjugated to one or more ligand moieties in the 5' end region of the second strand.
[0439] The following are examples of structures (the specific RNA nucleosides shown are not limited and can be any RNA nucleosides):
[0440] A A3'-3' reverse bond (and also shows the 5'-3 orientation of the last phosphodiester bond between the two baseless molecules toward the molecule's end)
[0441]
[0442] B shows the 5'-5' reverse bond (and also shows the 3'-5' orientation of the last phosphodiester bond between the two baseless molecules toward the molecule's end).
[0443]
[0444] When one or more reverse nucleoside bonds (i.e., 5'-5' or 3'-3' reverse nucleoside bonds) are present, the nucleic acid contains one or more abasic nucleosides. The reverse bond arises from a change in the orientation of adjacent nucleoside sugars, resulting in a 3'-5' orientation rather than the conventional 5'-3' orientation (refer to the numbering of ring atoms on the nucleoside sugar). The one or more abasic nucleosides present in the nucleic acid described in this application preferably include such inverted nucleoside sugars.
[0445] If the terminal nucleoside has an inverted orientation, this results in an "inverted" end configuration for the entire nucleic acid. While some structures drawn and cited in this paper are represented using the conventional 5'-3' orientation (refer to the numbering of ring atoms on the nucleoside sugar), it is understood that the presence of a terminal nucleoside with an orientation change and a proximal 3'-3' reverse bond will result in an overall 5'-5' end configuration for the nucleic acid (i.e., a conventional 3' end nucleoside becomes a 5' end nucleoside). Alternatively, it can be understood that the presence of a terminal nucleoside with an orientation change and a proximal 5'-5' reverse bond will result in an overall 3'-3' end configuration for the nucleic acid.
[0446] As described herein, a proximal 3'-3' or 5'-5' reverse bond may comprise a reverse bond directly adjacent to / connected to a terminal nucleoside with an inverted orientation (such as a single terminal nucleoside with an inverted orientation). Alternatively, a proximal 3'-3' or 5'-5' reverse bond as described herein may comprise a reverse bond between two or more adjacent nucleosides with inverted orientations, such as between two or more terminal nucleosides with inverted orientations, such as between a terminal and penultimate nucleoside. In this way, the reverse bond can be connected to the penultimate nucleoside with an inverted orientation. While those skilled in the art will understand that the inverted orientation described above can result in a nucleic acid molecule having an overall 3'-3' or 5'-5' end structure as described herein, it should also be understood that in the presence of one or more additional reverse bonds and / or nucleosides with inverted orientations, the entire nucleic acid may have a 3'-5' end structure relative to the conventional 5' / 3' end.
[0447] In one respect, nucleic acids can have 3'-3' reverse bonds, and the terminal sugar moiety can contain a 5'OH group instead of a 5' phosphate group located at the 5' position of the terminal sugar.
[0448] Therefore, those skilled in the art will clearly understand that variants of the more conventional 5'-3' structure (refer to the ring atom numbering on the terminal nucleotide sugar) depicted herein, such as the 5'-5', 3'-3', and 3'-5' (read along the direction of this end) ends, are included within the scope of this disclosure, wherein one or more reverse bonds are present.
[0449] For example, in cases where inverted nucleoside bonds and / or one or more nucleosides with inverted orientations produce inverted ends, and the relative positions of bonds (e.g., with linkers) or the localization of internal features (e.g., modified nucleosides) are defined relative to the 5' or 3' end of the nucleic acid, then the 5' or 3' end is the conventional 5' or 3' end that would exist without the inverted bond, and wherein the conventional 5' or 3' end is identified based on the directionality and / or nucleoside orientation of most internal nucleoside bonds within the nucleic acid. From these internal bonds and / or nucleoside orientations, it can be determined which ends of the nucleic acid would constitute the conventional 5' or 3' end of the molecule in the absence of the inverted bond (refer to the ring atom numbering on the terminal nucleoside sugar).
[0450] For example, in the structure shown below, the first two positions at the "5'" end have no base residues. When the terminal nucleotide has an inverted orientation, the "5'" end (i.e., the conventional 5' end) shown in the diagram below can actually contain a 3'OH, given the inverted nucleotide at the terminal position. Nevertheless, when read according to the standard 5'[PO4] to 3'[OH] direction of nucleic acid molecules (refer to the ring atom numbering on the nucleotide sugar), most molecules contain a conventional nucleotide internucleotide bond from the 3'OH of the sugar to the 5' phosphate of the next sugar, which can be used to identify the conventional 5' and 3' ends without an inverted terminal configuration.
[0451] A 5'
[0452] AA-Me-Me-Me-Me-Me-Me-F-Me-FFF-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me 3'
[0453] Preferably, the reverse bond is located at the end of the nucleic acid (e.g., RNA), the end being distal to the ligand portion of the molecule (e.g., the portion containing GalNAc).
[0454] GalNAc-siRNA constructs with 5'-GalNAc on the positive strand can have a reverse bond at the other end of the positive strand.
[0455] GalNAc-siRNA constructs with 3'-GalNAc on the positive strand can have a reverse bond at the other end of the positive strand.
[0456] In some embodiments, the second (sense) strand of the nucleic acid described in this application contains two consecutive anucleotides at the 5' end region, as shown in the 5' end motif below.
[0457]
[0458] in:
[0459] B represents a nucleoside base.
[0460] T represents H, OH, or 2' ribose modification.
[0461] Z represents the remaining nucleoside in the second chain.
[0462] In some embodiments, the second (sense) strand of the nucleic acid described in this application contains two consecutive anucleotides at the 5' end region, as shown in the 5' end motif below.
[0463]
[0464] in:
[0465] B represents a nucleoside base.
[0466] T represents H, OH, or 2' ribose modification (preferably 2' ribose modification, more preferably 2' Me or 2' F ribose modification).
[0467] V represents O or S (O is preferred).
[0468] R represents H or C 1-4 Alkyl (preferably H),
[0469] Z represents the remaining nucleoside in the second chain.
[0470] More preferably, the following 5' terminal motifs
[0471]
[0472] in:
[0473] B represents a nucleoside base.
[0474] T represents 2' ribose modification (preferably 2'Me or 2'F ribose modification),
[0475] Z represents the remaining nucleoside in the second chain.
[0476] Preferably, the reverse bond is located at the end of the nucleic acid (e.g., RNA), the end being distal to the ligand portion of the molecule (e.g., the portion containing GalNAc).
[0477] GalNAc-siRNA constructs with 5'-GalNAc on the positive strand can have a reverse bond at the other end of the positive strand.
[0478] GalNAc-siRNA constructs with 3'-GalNAc on the positive strand can have a reverse bond at the other end of the positive strand.
[0479] In some embodiments, the second (sense) strand of the nucleic acid described in this application contains two consecutive anucleotides at the 5' end region, as shown in the 5' end motif below.
[0480]
[0481] in:
[0482] B represents a nucleoside base.
[0483] T represents H, OH, or 2' ribose modification (preferably 2' ribose modification, more preferably 2' Me or 2' F ribose modification).
[0484] V represents O or S (O is preferred).
[0485] R represents H or C 1-4 Alkyl (preferably H),
[0486] Z contains 11 to 26 consecutive nucleotides, preferably 15 to 21 consecutive nucleotides, more preferably 19 consecutive nucleotides, and more preferably the following 5' terminal motif.
[0487]
[0488] in:
[0489] B represents a nucleoside base.
[0490] T represents 2' ribose modification (preferably 2'Me or 2'F ribose modification),
[0491] Z contains 19 consecutive nucleosides.
[0492] Nucleic acid length
[0493] In one aspect, i) the length of the first strand of the nucleic acid is 17 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 19 or 23 nucleosides; and / or ii) the length of the second strand of the nucleic acid is 17 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 19 or 21 nucleosides.
[0494] Typically, the length of the double-stranded region of the nucleic acid is 17 to 30 nucleotides, more preferably 19 or 21 nucleotides. Similarly, the length of the complementary region between the first strand and a portion of the RNA transcribed from the SLC25A5 gene is 17 to 30 nucleotides.
[0495] Generally, the length of the double-stranded structure of nucleic acids (such as iRNA) is approximately 15 to 30 base pairs, for example, lengths of 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20. 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs. Ranges and lengths between the above ranges and lengths are also considered part of this application.
[0496] Similarly, the length of the complementary regions between the antisense sequence and the target sequence and / or between the antisense sequence and the sense sequence is approximately 15 to 30 nucleotides, for example, lengths of 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21. 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleosides. The ranges and lengths between the above ranges and lengths are also considered part of this application.
[0497] In some preferred embodiments, the length of the complementary region between the antisense sequence and the target sequence and / or the complementary region between the antisense sequence and the sense sequence is at least 17 nucleotides. For example, the length of the complementary region between the antisense strand and the target site is 19 to 21 nucleotides, for example, the length of the complementary region is 21 nucleotides.
[0498] In a preferred embodiment, the length of each chain does not exceed 30 nucleosides.
[0499] In some preferred embodiments, the length of the double-stranded structure of the nucleic acid (e.g., siRNA) is 19 or 21 base pairs. In particularly preferred embodiments, the double-stranded structure may have one of the following structures:
[0500] For example, ETX-M00001351–ETX-M00001626
[0501]
[0502] or
[0503]
[0504] The nucleic acids (e.g., dsRNA) described herein may also include one or more single-stranded nucleoside overhangs, such as 1-4, 2-4, 1-3, 2-3, 1, 2, 3, or 4 nucleosides. The nucleoside overhangs may contain or consist of nucleosides / nucleoside analogs (including deoxynucleosides / nucleosides). The overhangs may be located on the sense strand, antisense strand, or any combination thereof. Furthermore, the nucleosides of the overhangs may be at the 5' end, 3' end, or both ends of the antisense strand or sense strand of the nucleic acid (e.g., dsRNA).
[0505] In some preferred embodiments, at least one chain contains a 3' overhang of at least one nucleoside, for example, at least one chain contains a 3' overhang of at least two nucleosides. The overhang is suitably located on the antisense / guide chain and / or the sense / passenger chain.
[0506] Nucleic acid modification
[0507] In some embodiments, the nucleic acid (e.g., RNA), such as dsiRNA, described in this application does not contain further modifications, such as chemical modifications or conjugations known in the art and described herein.
[0508] In other preferred embodiments, the nucleic acid (e.g., RNA), such as dsiRNA, described in this application is further chemically modified to enhance stability or other beneficial properties.
[0509] In some embodiments of this application, virtually all nucleosides are modified.
[0510] The nucleic acids characterized in this application can be synthesized or modified by methods well established in the art, such as those in "Current protocols in nucleic acid chemistry," Beaucage, S. Letal. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA, the contents of which are incorporated herein by reference.
[0511] Modifications include, for example, terminal modifications, such as 5'-end modifications (phosphorylation, conjugation, reverse bond) or 3'-end modifications (conjugation, DNA nucleoside within RNA or RNA nucleoside within DNA, reverse bond, etc.); base modifications, such as substitution with a stable base, an unstable base, or a base that pairs with an extended pairing partner, or a conjugated base; sugar modifications (e.g., at the 2'-position or 4'-position) or sugar substitution; or backbone modifications, including modifications or substitutions of phosphodiester bonds.
[0512] Specific examples of nucleic acids (e.g., siRNA compounds) used in the embodiments described herein include, but are not limited to, RNA comprising a modified backbone or lacking natural nucleoside internucleotide bonds. Nucleic acids (e.g., RNA) having a modified backbone comprise nucleic acids whose backbone does not contain phosphorus atoms. For the purposes of this specification, and as sometimes cited in the art, modified nucleic acids (e.g., RNA) lacking phosphorus atoms in their internucleotide backbone may also be considered oligonucleotides. In some embodiments, modified nucleic acids (e.g., siRNA) have phosphorus atoms in their internucleotide backbone.
[0513] Modified nucleic acid (e.g., RNA) backbones include, for example, thiophosphates, chiral thiophosphates, dithiophosphates, phosphate triesters, aminoalkyl phosphate triesters, methyl and other alkylphosphonates (including 3'-alkylphosphonates and chiral phosphonates), phosphonites, aminophosphates (including 3'-aminoaminophosphates and aminoalkylaminophosphates), thioaminophosphates, thioalkylphosphonates, thioalkyl phosphate triesters, and borophosphates with normal 3'-5' bonds, 2'-5' linked analogs of these compounds, and those with inverted polarity (where adjacent nucleoside unit pairs are linked at 5'-3' or 5'-2'). Various salts, mixed salts, and free acid forms are also included.
[0514] Modified nucleic acids (e.g., RNA) may also contain one or more substituted sugar moieties. Nucleic acids characterized herein (e.g., siRNA) such as dsiRNA may contain one of the following at the 2'-position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S-, or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl, and alkynyl groups may be substituted or unsubstituted. Preferred modifications are 2'-O-methyl and 2'-F.
[0515] In some preferred embodiments, the nucleic acid comprises at least one modified nucleoside.
[0516] The nucleic acids described in this application may contain one or more modified nucleosides on the first and / or second strand.
[0517] In some implementations, virtually all nucleosides of the sense strand and all nucleosides of the antisense strand contain modifications.
[0518] In some implementations, all nucleosides in the sense strand and substantially all nucleosides in the antisense strand contain modifications.
[0519] In some implementations, all nucleosides in the sense strand and all nucleosides in the antisense strand contain modifications.
[0520] In one embodiment, at least one of the modified nucleosides is selected from the group consisting of: deoxy-nucleosides, 3'-terminal deoxy-thymidine (dT) nucleosides, 2'-O-methyl modified nucleosides (also referred to herein as 2'-Me, where Me is methoxy), 2'-fluorine modified nucleosides, 2'-deoxy-modified nucleosides, locked nucleosides, open-ring nucleosides, conformation-restricted nucleosides, ethyl-restricted nucleosides, base-free nucleosides, 2'-amino-modified nucleosides, 2'-O-allyl-modified nucleosides, and 2'-methyl ... '-C-alkyl-modified nucleosides, 2'-hydroxy-modified nucleosides, 2'-methoxyethyl-modified nucleosides, 2'-O-alkyl-modified nucleosides, morpholino-modified nucleosides, aminophosphates, nucleosides containing non-natural bases, tetrahydropyran-modified nucleosides, 1,5-dehydrohexyl-modified nucleosides, cyclohexenyl-modified nucleosides, nucleosides containing thiophosphate groups, nucleosides containing methylphosphonate groups, nucleosides containing 5'-phosphate groups, and nucleosides containing 5'-phosphate mimics. In another embodiment, the modified nucleoside comprises a short sequence of 3'-terminal deoxy-thymidine (dT).
[0521] The modification on the nucleoside may preferably be selected from, but is not limited to, LNA, HNA, CeNA, 2-methoxyethyl, 2'-O-alkyl, 2-O-allyl, 2'-C-allyl, 2'-fluoro, 2'-deoxy, 2'-hydroxy, and combinations thereof. In another embodiment, the modification on the nucleoside is a 2-O-methyl (“2-Me”) or 2'-fluoro modification.
[0522] A preferred modification is the modification of the 2'-OH group of the ribose, optionally selected from 2'-Me or 2'-F modifications.
[0523] In some embodiments, the nucleic acid (e.g., an RNAi agent) further comprises at least one phosphate thioester or methylphosphonate nucleoside bond. For example, the phosphate thioester or methylphosphonate nucleoside bond may be located at the 3' end or at the end region of one strand (i.e., the sense strand or the antisense strand); or at the ends of both strands (i.e., the sense strand and the antisense strand).
[0524] In some embodiments, the thiophosphate or methylphosphonate nucleoside internucleotide bond is located at the 5' end or the terminal region of one chain (i.e., the sense chain or the antisense chain); or at the end of two chains (i.e., the sense chain and the antisense chain).
[0525] In some embodiments, the thiophosphate or methylphosphonate nucleoside internucleotide bond is located at the 5'-end and 3'-end or at the end region of one chain (i.e., the sense chain or the antisense chain); or at the end of two chains (i.e., the sense chain and the antisense chain).
[0526] Any nucleic acid may contain one or more phosphate thioester (PS) modifications, such as at least two PS nucleotide bonds at the end of the chain.
[0527] At least one of the oligonucleotide chains preferably contains at least two consecutive thiophosphate modifications in the last three nucleotides of the oligonucleotide.
[0528] Therefore, this application also relates to: the nucleic acid disclosed herein, which comprises thiophosphate nucleoside inter-bonds, the thiophosphate nucleoside inter-bonds being located between at least two or three consecutive positions, for example, located in the 5' end region and / or 3' end region and / or near-end region of the second strand, wherein the near-end region is preferably adjacent to the end region of the one or more abase-free nucleosides of the second strand.
[0529] The nucleic acid disclosed herein contains a thiophosphate nucleoside inter-link, which is located between at least two or three consecutive positions in the 5' end region and / or 3' end region of the first chain, wherein preferably, the end positions of the 5' end region and / or 3' end region of the first chain are connected to their adjacent positions by a thiophosphate nucleoside inter-link.
[0530] The nucleic acid chain can be RNA, which contains phosphate thioside bonds between three nucleosides and two adjacent terminal abase-free nucleosides.
[0531] Preferably, the nucleic acid is a double-stranded RNA, wherein the double-stranded RNA contains two adjacent abase-free nucleotides at the 5' end of the second strand, and a ligand motif consisting of one or more GalNAc ligand motifs at a relative position at the 3' end of the second strand. More preferably, the same nucleic acid may also contain phosphate thioester bonds between nucleotides at positions 3-4 and 4-5 of the second strand, read from position 1 of the second strand.
[0532] Position 1 of the first or second strand is the nucleoside closest to the end of the nucleic acid (ignoring any abase nucleosides), and is linked to the adjacent nucleoside (at position 2) by internal bonds from 3' to 5', referring to the bonds between the backbone sugar portions, and read in the direction away from the molecule end.
[0533] Therefore, "position 1 of the positive strand" is the nearest 5' nucleotide (excluding nucleosides) at the conventional 5' end of the positive strand. Typically, the nucleotide at position 1 of the positive strand will be equivalent to the 5' nucleotide of the selected target nucleic acid sequence, and more generally, the positive strand will have nucleotides equivalent to the nucleotides of the target nucleic acid sequence starting from position 1 of the positive strand, while also allowing for acceptable mismatches between sequences.
[0534] The “position 1 of the antisense strand” used in this article refers to the nearest 5' nucleotide at the conventional 5' end of the antisense strand (excluding nucleosides without bases). As mentioned earlier, there are complementary regions between the sense and antisense strands, so the antisense strand will also have complementary regions with the target nucleic acid sequence mentioned above.
[0535] Preferred modifications that can be used with the sequences described in this application may be as follows:
[0536] Modification 1:
[0537] First chain modification:
[0538] NmsNfsNmNfNmNfNmNfNfNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm(5' to 3')
[0539] Second chain modification:
[0540] iaiaNmsNmsNmNmNmNmNfNfNfNfNfNmNmNmNmNmNmNmNfNmNm(5' to 3')
[0541] Modification 2:
[0542] First chain modification:
[0543] NmsNfsNmNfNmNfNmNfNfNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm(5' to 3')
[0544] Second chain modification:
[0545] iaiaNmsNmsNmNmNmNfNfNmNfNfNfNfNmNmNmNmNmNmNmNmNm(5' to 3')
[0546] Modification 3:
[0547] First chain modification:
[0548] NmsNfsNmNfNmNfNmNfNfNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm(5' to 3')
[0549] Second chain modification:
[0550] iaiaNmsNmsNmNmNmNmNfNmNfNfNfNfNmNmNmNmNmNmNmNmNm(5' to 3')
[0551] Modification 4:
[0552] First chain modification:
[0553] NmsNfsNmNfNmNfNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm(5' to 3')
[0554] Second chain modification:
[0555] iaiaNmsNmsNmNmNmNmNfNmNfNfNfNfNmNmNmNmNmNmNmNmNm(5' to 3')
[0556] Modification 5:
[0557] First chain modification:
[0558] NmsNfsNmNmNmNfNmNmNfNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm(5' to 3')
[0559] Second chain modification:
[0560] iaiaNmsNmsNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm(5' to 3')
[0561] Modification 6:
[0562] First chain modification:
[0563] NmsNfsNmNmNmNfNmNmNmNmNmNmNmNfNmNfNmNfNmNmNmsNmsNm(5' to 3')
[0564] Second chain modification:
[0565] iaiaNmsNmsNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm(5' to 3')
[0566] Modification 7:
[0567] First chain modification:
[0568] NmsNfsNmNmNmNyNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm(5' to 3')
[0569] Second chain modification:
[0570] iaiaNmsNmsNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm(5' to 3')
[0571] Modification 8:
[0572] First chain modification:
[0573] NmsNfsNmNmNmNyNmNfNfNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm(5' to 3')
[0574] Second chain modification:
[0575] iaiaNmsNmsNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm(5' to 3')
[0576] Modification 9:
[0577] First chain modification:
[0578] NmsNfsNmNmNmNfNmNmNmNmNmNmNmNfNmNfNmNmNmNfNmsNmsNm(5' to 3')
[0579] Second chain modification:
[0580] iaiaNmsNmsNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm(5' to 3')
[0581] Modification 10:
[0582] First chain modification:
[0583] NmsNfsNmNfNmNfNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm(5' to 3')
[0584] Second chain modification:
[0585] iaiaNmsNmsNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm(5' to 3')
[0586] Modification 11:
[0587] First chain modification:
[0588] NmsNfsNmNfNmNfNmNfNfNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm(5' to 3')
[0589] Second chain modification:
[0590] iaiaNmsNmsNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm(5' to 3')
[0591] Modification 12:
[0592] First chain modification:
[0593] NmsNfsNmNmNmNfNmNfNfNmNmNmNmNfNmNfNmNfNmNmNmsNmsNm(5' to 3')
[0594] Second chain modification:
[0595] iaiaNmsNmsNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm(5' to 3')
[0596] Modification 13:
[0597] First chain modification:
[0598] NmsNfsNmNmNmNfNmNfNfNmNmNmNmNfNmNfNmNmNmNfNmsNmsNm(5' to 3')
[0599] Second chain modification:
[0600] iaiaNmsNmsNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm(5' to 3')
[0601] In each of the above modifications:
[0602] ia represents an inverted nucleoside without a base;
[0603] Nm represents a nucleoside modified with 2'Me ribose;
[0604] Nf represents a nucleoside modified with 2'F ribose;
[0605] Ny represents a nucleoside with a thermally unstable modification, preferably wherein the thermally unstable modification is selected from modified open-ring nucleic acids (UNA) and ethylene glycol nucleic acids (GNA), more preferably ethylene glycol nucleic acids, and most preferably (S)-ethylene glycol nucleic acids;
[0606] s represents the internucleotide bond between thiophosphate esters.
[0607] Particularly preferred modifications that can be used with the sequences described in this application may be:
[0608] Modifier 6: First chain modification:
[0609] NmsNfsNmNmNmNfNmNmNmNmNmNmNmNfNmNfNmNfNmNmNmsNmsNm(5' to 3')
[0610] Second chain modification:
[0611] iaiaNmsNmsNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm(5' to 3')
[0612] In each of the above modifications:
[0613] ia represents an inverted nucleoside without a base;
[0614] Nm represents a nucleoside modified with 2'Me ribose;
[0615] s represents the internucleotide bond between thiophosphate esters.
[0616] Nucleic acid conjugation with ligands
[0617] Another modification of nucleic acids (e.g., siRNA, such as the RNA described in this application) involves linking the nucleic acid (e.g., siRNA) to one or more ligand moieties, for example, to enhance the activity, cellular distribution, or cellular uptake of the nucleic acid (e.g., siRNA), such as entry into the cell.
[0618] In some embodiments, the inhibitor described herein is conjugated to a ligand portion capable of achieving and / or promoting targeting of hepatocytes. In some embodiments, targeting of hepatocytes is achieved using an N-acetylgalactosamine (GalNAc) conjugate, as described in more detail below. That is, in some embodiments, the inhibitor described herein is an siRNA-GalNAc conjugate.
[0619] In some implementations, the described ligand moiety can be linked to a nucleic acid (e.g., siRNA oligonucleotide) via a cleavable or non-cleavable linker. The term "linker" or "linking group" refers to the organic part that connects two parts of a compound, such as covalently linking two parts of a compound.
[0620] The ligand can attach to the 3' or 5' end of the justice chain.
[0621] The preferred ligand is conjugated to the 3' end of the positive strand of a nucleic acid (e.g., siRNA agent).
[0622] Therefore, this application further relates to a conjugate for inhibiting the expression of a target (e.g., a target gene) in a cell, the conjugate comprising a nucleic acid moiety and one or more ligand moieties, the nucleic acid moiety comprising nucleic acids as disclosed herein.
[0623] In one aspect, the second strand of the nucleic acid is directly or indirectly (e.g., via a linker) conjugated to one or more ligand moieties, wherein the ligand moieties are typically located in the terminal region of the second strand, preferably in its 3' terminal region.
[0624] In some embodiments, the ligand portion comprises GalNAc or a GalNAc derivative that is linked to a nucleic acid (e.g., dsiRNA) via a linker.
[0625] Therefore, this application relates to a conjugate wherein the ligand moiety comprises
[0626] i) one or more GalNAc ligands; and / or
[0627] ii) One or more GalNAc ligand derivatives; and / or
[0628] iii) One or more GalNAc ligands conjugated to the nucleic acid via a linker.
[0629] The GalNAc ligand can be directly or indirectly conjugated to the 5' or 3' end region of the second strand of the nucleic acid, preferably conjugated to its 3' end region.
[0630] GalNAc ligands are well known in the art, especially as described in EP3775207A1.
[0631] In some implementations, the ligand portion comprises one or more ligands.
[0632] In some implementations, the ligand portion comprises one or more carbohydrate ligands.
[0633] In some embodiments, the one or more carbohydrates may be monosaccharides, disaccharides, trisaccharides, tetrasaccharides, oligosaccharides, and / or polysaccharides.
[0634] In some embodiments, the one or more carbohydrates comprise one or more galactose moieties, one or more lactose moieties, one or more N-acetylgalactosamine moieties, and / or one or more mannose moieties.
[0635] In some embodiments, the one or more carbohydrates comprise one or more N-acetylgalactosamine moieties.
[0636] In some embodiments, the compounds described anywhere herein comprise two or three N-acetylgalactosamine moieties.
[0637] In some implementations, the one or more ligands are connected in a linear or branched configuration, for example, each configuration is connected to a branch point in the entire junction.
[0638] Exemplary linear configurations and exemplary branching configurations are as follows: Figure 1a and 1b As shown:
[0639] Figure 1a In (linear), (a) and / or (b) can typically represent a linking bond or group, such as a phosphate ester or thiophosphate ester group.
[0640] Figure 1b In some embodiments, the one or more ligands are connected in a biantennary or triantennary branching configuration. Typically, a triantennary branching configuration, such as the N-acetylgalactosamine triantennary branching structure, is preferred.
[0641] connector
[0642] The exemplary compounds of this application include a “connector portion”, as shown in Formula (I), which is part of the entire “connector”.
[0643] Formula I
[0644]
[0645] in:
[0646] R1 is selected independently from hydrogen, methyl, and ethyl each time it appears;
[0647] R2 is selected from hydrogen, hydroxyl group, -OC. 1-3 Alkyl group, -C(=O)OC 1-3 Alkyl, halogen, and nitro groups;
[0648] X1 and X2 are each selected independently from the following group: methylene, oxygen, and sulfur;
[0649] m is an integer from 1 to 6;
[0650] n is an integer from 1 to 10;
[0651] q, r, s, t, v are independent integers from 0 to 4, provided that:
[0652] (i) q and r cannot both be 0; and
[0653] (ii) s, t and v cannot all be 0 at the same time;
[0654] Z is the oligonucleotide moiety.
[0655] As further understood in the art, the exemplary compounds of this application comprise an entire connector located between the oligonucleotide moiety and the ligand moiety of these compounds. The entire connector “connects” the oligonucleotide moiety and the ligand moiety to each other.
[0656] The entire linker is typically assumed to contain one or more linker building blocks. For example, there exists a linker moiety, described as a “linker moiety” as represented by formula (I), which is located adjacent to the ligand moiety and typically connects the ligand moiety directly or indirectly to the oligonucleotide moiety via a branch point. The linker moiety shown in formula (I) is also often referred to as the “ligand arm” of the entire linker. Another linker moiety may also exist between the oligonucleotide moiety and the branch point (but not always), which is often referred to as the “tethering moiety” of the entire linker, “tethering” the oligonucleotide moiety to the remainder of the conjugated compound. Such 'ligand arms’ and / or 'linker moiety’ and / or 'tethering moiety’ can be assumed with reference to the linear and / or branched configurations described above.
[0657] As can be seen from the claims and patent specification, the scope of this application extends to linear or branched configurations, and there is no limitation on the number of individual ligands that may be present. Furthermore, based on prior art and the expertise of oligonucleotide chemists, the recipient will also recognize that many structures can be used as linker sites.
[0658] The remaining portion of the entire connector (excluding the connector portion) listed in the claims, as well as the remainder of the patent specification, is represented by the chemical composition in formula (I), which the inventors consider to be particularly unique to this application. However, more generally, these chemical compositions can be described as the “tethered portion” as previously described, where the “tethered portion” is a part of the entire connector comprising the atomic group between Z (i.e., the oligonucleotide portion) and the connector portion, as shown in formula (I).
[0659] The chain part of Formula I
[0660] In the case of formula (I), the “chain part” comprises the group of atoms between Z (i.e., the oligonucleotide part) and the linker part.
[0661] In some embodiments, R1 is hydrogen in every occurrence. In some embodiments, R1 is methyl. In some embodiments, R1 is ethyl.
[0662] In some embodiments, R2 is a hydroxyl group. In some embodiments, R2 is a halogen. In some embodiments, R2 is fluorine. In some embodiments, R2 is chlorine. In some embodiments, R2 is bromine. In some embodiments, R2 is iodine. In some embodiments, R2 is a nitro group.
[0663] In some embodiments, X1 is methylene. In some embodiments, X1 is oxygen. In some embodiments, X1 is sulfur.
[0664] In some embodiments, X2 is methylene. In some embodiments, X2 is oxygen. In some embodiments, X2 is sulfur.
[0665] In some implementations, m = 3.
[0666] In some implementations, n = 6.
[0667] In some embodiments, X1 is oxygen and X2 is methylene. In some embodiments, both X1 and X2 are methylene.
[0668] In some implementations, q = 1, r = 2, s = 1, t = 1, v = 1. In other implementations, q = 1, r = 3, s = 1, t = 1, v = 1.
[0669] In some implementations, R1 is hydrogen each time it appears, n=6, m=3, R2 is fluorine, X2 is methylene, v=1, t=1, s=1, X1 is methylene, q=1 and r=2.
[0670] Therefore, in some embodiments, the exemplary compound described in this application comprises the following structure:
[0671]
[0672] In some implementations, R1 is hydrogen each time it appears, n=6, m=3, R2 is fluorine, X2 is methylene, v=1, t=1, s=1, X1 is oxygen, q=1 and r=2.
[0673] Therefore, in some embodiments, the exemplary compound described in this application comprises the following structure:
[0674] Alternative chain part
[0675] During the synthesis of the compounds described in this application, alternative chain-linking structures may occur. In some embodiments, the alternative chain-linking portion has one or more atomic variations throughout the chain-linking portion of the connector compared to the chain-linking portion described anywhere herein.
[0676] In some embodiments, the alternative chain portion is a compound of formula (I) described anywhere herein, wherein R2 is a hydroxyl group.
[0677] In some implementations, R1 is hydrogen each time it appears, n=6, m=3, R2 is hydroxyl, X2 is methylene, v=1, t=1, s=1, X1 is methylene, q=1 and r=2.
[0678] Therefore, in some embodiments, the compound described in this application comprises the following structure:
[0679]
[0680] In some implementations, R1 is hydrogen each time it appears, n=6, m=3, R2 is hydroxyl, X2 is methylene, v=1, t=1, s=1, X1 is oxygen, q=1 and r=2.
[0681] Therefore, in some embodiments, the compound described in this application comprises the following structure:
[0682]
[0683] Connector section
[0684] With regard to formula (I), the “connector portion” shown in formula (I) comprises the group of atoms located between the chain portion and the ligand portion described anywhere in this document.
[0685] In some implementation schemes:
[0686] As shown in equation (I) anywhere in this document.
[0687]
[0688] It is any one of formula (VIa), (VIb) or (VIc), preferably formula (VIa):
[0689]
[0690] in:
[0691] A I The protecting group is hydrogen or a suitable hydroxyl group;
[0692] a is an integer, either 2 or 3; and
[0693] b is an integer from 2 to 5; or
[0694]
[0695] in:
[0696] A I It is hydrogen, or a suitable hydroxyl protecting group;
[0697] a is an integer, either 2 or 3;
[0698] c and d are independent integers from 1 to 6; or
[0699]
[0700] in:
[0701] A I It is hydrogen, or a suitable hydroxyl protecting group;
[0702] a is an integer, either 2 or 3;
[0703] e is an integer from 2 to 10.
[0704] In some implementations, the portion shown in formula (I) is:
[0705]
[0706] For example (VIa):
[0707]
[0708] in:
[0709] A I The protecting group is hydrogen or a suitable hydroxyl group;
[0710] a is 3; and
[0711] b is an integer 3.
[0712] In some implementations, as shown in formula (I) anywhere herein
[0713]
[0714] For equation (VII):
[0715]
[0716] in:
[0717] A I It is hydrogen;
[0718] a is an integer, either 2 or 3, preferably 3.
[0719] Other exemplary compounds described in this application include a “connector portion” as shown in formula (I*), which is part of the entire “connector”.
[0720]
[0721]
[0722] in:
[0723] r and s are independently selected from integers from 1 to 16; and
[0724] Z is the oligonucleotide moiety.
[0725] As further understood in the art, exemplary compounds of this application comprise an entire connector located between the oligonucleotide moiety and the ligand moiety of these compounds. The entire connector “connects” the oligonucleotide moiety and the ligand moiety to each other.
[0726] The entire linker is typically assumed to contain one or more linker building blocks. For example, there exists a linker moiety, described as a “linker moiety” as represented by formula (I*), which is located adjacent to the ligand moiety and typically connects the ligand moiety directly or indirectly to the oligonucleotide moiety via a branching point. The linker moiety shown in formula (I*) is also often referred to as the “ligand arm” of the entire linker. Another linker moiety may also exist between the oligonucleotide moiety and the branching point (but not always), which is often referred to as the “tethering moiety” of the entire linker, “tethering” the oligonucleotide moiety to the remainder of the conjugated compound. Such 'ligand arms’ and / or 'linker moiety’ and / or 'tethering moiety’ can be assumed with reference to the linear and / or branched configurations described above.
[0727] As can be seen from the claims and patent specification, the scope of this application extends to linear or branched configurations, and there is no limitation on the number of individual ligands that may be present. Furthermore, based on prior art and the expertise of oligonucleotide chemists, the recipient will also recognize that many structures can be used as linker sites.
[0728] The remaining portion of the entire connector (excluding the connector portion) listed in the claims, as well as the remainder of the patent specification, is represented by the chemical composition in formula (I), which the inventors consider to be particularly unique to this application. However, more generally, these chemical compositions can be described as the “tethered portion” as previously described, where the “tethered portion” is a part of the entire connector comprising the atomic group between Z (i.e., the oligonucleotide portion) and the connector portion, as shown in formula (I).
[0729] Chain section
[0730] In the case of formula (I*), the “chain part” comprises the group of atoms between Z (i.e., the oligonucleotide part) and the linker part.
[0731] In some implementations, s is selected from an integer from 4 to 12. In some implementations, s is 6.
[0732] In some implementations, r is selected from an integer from 4 to 14. In some implementations, r is 6. In some implementations, r is 12.
[0733] In some implementations, r is 12 and s is 6.
[0734] Therefore, in some embodiments, the exemplary compound described in this application comprises the following structure:
[0735]
[0736] In some implementations, r is 6 and s is 6.
[0737] Therefore, in some embodiments, the exemplary compound described in this application comprises the following structure:
[0738]
[0739] Connector section
[0740] With regard to formula (I*), the “connector portion” shown in formula (I) comprises the set of atoms located between the connector portion and the ligand portion described anywhere in this document.
[0741] In some implementations, such as the portion shown in formula (I*) described anywhere herein
[0742]
[0743] It is any one of formula (IV*), (V*) or (VI*), preferably formula (IV*):
[0744] Formula (IV*)
[0745] in:
[0746] A I The protecting group is hydrogen or a suitable hydroxyl group;
[0747] a is an integer, either 2 or 3; and
[0748] b is an integer from 2 to 5; or
[0749]
[0750] in:
[0751] A I The protecting group is hydrogen or a suitable hydroxyl group;
[0752] a is an integer, either 2 or 3; and
[0753] c and d are independent integers from 1 to 6; or
[0754]
[0755] in:
[0756] A I The protecting group is hydrogen or a suitable hydroxyl group;
[0757] a is an integer, either 2 or 3; and
[0758] e is an integer from 1 to 10.
[0759] In some implementations, the portion shown in formula (I)
[0760]
[0761] For example (VIa*):
[0762]
[0763]
[0764] in:
[0765] A I The protecting group is hydrogen or a suitable hydroxyl group;
[0766] a is 3; and
[0767] b is an integer 3.
[0768] In some implementations, the portion shown in formula (I)
[0769]
[0770] For equation (VII*):
[0771] Equation (VII*)
[0772] in:
[0773] A I It is hydrogen;
[0774] a is an integer, either 2 or 3.
[0775] In some implementations, a = 2. In some implementations, a = 3. In some implementations, b = 3.
[0776] In some implementations, the GalNAc ligand is contained in Figures 2 to 5 or Figure 6 In any of the adapters shown in (Formula XI), the “oligonucleotide” can be any nucleic acid disclosed herein. Therefore, the “oligonucleotide” can contain bonds other than phosphodiester bonds, such as one or more thiophosphate bonds. Preferably, the nucleic acid described herein is a double-stranded oligonucleotide as defined herein, and the adapter is conjugated to the second strand via a phosphodiester bond, more preferably to the 3' terminal region of the second strand.
[0777] In some implementations, the GalNAc ligand is contained in Figure 4 In the connector shown, the term "oligonucleotide" can be any nucleic acid disclosed herein. Therefore, an "oligonucleotide" can contain bonds other than phosphodiester bonds, such as one or more thiophosphate bonds. Preferably, the nucleic acid described herein is a double-stranded oligonucleotide as defined herein, and the connector is attached to the second strand via a phosphodiester bond, more preferably to the 3' terminal region of the second strand.
[0778] In some implementations, the GalNAc ligand is contained in Figure 6 In the linker shown in (Formula XI), the “oligonucleotide” can be any nucleic acid disclosed herein. Therefore, the “oligonucleotide” can contain bonds other than phosphodiester bonds, such as one or more thiophosphate bonds. Preferably, the nucleic acid described herein is a double-stranded oligonucleotide as defined herein, and the linker is conjugated to the second strand via a phosphodiester bond, more preferably to the 3' terminal region of the second strand.
[0779] In some implementations, the GalNAc ligand is contained in Figures 2 to 5 or Figure 6 In any of the adapters shown in (Formula XI), "oligonucleotide" represents the nucleic acid described in this application, wherein the nucleic acid described in this application comprises a modified or unmodified second chain, the second chain comprising or consisting of any one of SEQ ID NO:553 to SEQ ID NO:828, preferably wherein the adapter is conjugated to the 3' end region of the second chain via a phosphodiester bond, i.e., conjugated to the 3' end region of any one of SEQ ID NO:553 to SEQ ID NO:828.
[0780] In some implementations, the GalNAc ligand is contained in Figure 4In the connector shown, “oligonucleotide” represents the nucleic acid described in this application, wherein the nucleic acid described in this application comprises a modified or unmodified second chain, the second chain comprising or consisting of any one of SEQ ID NO:553 to SEQ ID NO:828, preferably wherein the connector is conjugated to the 3' end region of the second chain via a phosphodiester bond, i.e., conjugated to the 3' end region of any one of SEQ ID NO:553 to SEQ ID NO:828.
[0781] In some implementations, the GalNAc ligand is contained in Figure 6 In the adapter shown in (Formula XI), "oligonucleotide" represents the nucleic acid described in this application, wherein the nucleic acid described in this application comprises a modified or unmodified second chain, the second chain comprising or consisting of any one of SEQ ID NO:553 to SEQ ID NO:828, preferably wherein the adapter is conjugated to the 3' end region of the second chain via a phosphodiester bond, i.e., conjugated to the 3' end region of any one of SEQ ID NO:553 to SEQ ID NO:828.
[0782] In some implementations, the GalNAc ligand is contained in Figures 2 to 5 or Figure 6 In any of the adapters shown in (Formula XI), "oligonucleotide" represents the nucleic acid described in this application, wherein the nucleic acid described in this application comprises a modified or unmodified second strand, the second strand comprising or consisting of any one of SEQ ID NO:580, SEQ ID NO:599, SEQ ID NO:715, SEQ ID NO:729 or SEQ ID NO:772, preferably wherein the adapter is conjugated to the 3' end region of the second strand via a phosphodiester bond, i.e., conjugated to the 3' end region of any one of SEQ ID NO:580, SEQ ID NO:599, SEQ ID NO:715, SEQ ID NO:729 and SEQ ID NO:772.
[0783] In some implementations, the GalNAc ligand is contained in Figure 4In the connector shown, "oligonucleotide" represents the nucleic acid described in this application, wherein the nucleic acid described in this application comprises a modified or unmodified second strand, the second strand comprising or consisting of any one of SEQ ID NO:580, SEQ ID NO:599, SEQ ID NO:715, SEQ ID NO:729 and SEQ ID NO:772, preferably wherein the connector is conjugated to the 3' end region of the second strand via a phosphodiester bond, i.e., conjugated to the 3' end region of any one of SEQ ID NO:580, SEQ ID NO:599, SEQ ID NO:715, SEQ ID NO:729 and SEQ ID NO:772.
[0784] In some implementations, the GalNAc ligand is contained in Figure 5 In the adapter shown in (Formula XI), "oligonucleotide" represents the nucleic acid described in this application, wherein the nucleic acid described in this application comprises a modified or unmodified second chain, the second chain comprising or consisting of any one of SEQ ID NO:580, SEQ ID NO:599, SEQ ID NO:715, SEQ ID NO:729 and SEQ ID NO:772, preferably wherein the adapter is conjugated to the 3' end region of the second chain via a phosphodiester bond, i.e., conjugated to the 3' end region of any one of SEQ ID NO:580, SEQ ID NO:599, SEQ ID NO:715, SEQ ID NO:729 and SEQ ID NO:772.
[0785] In some implementations, the GalNAc ligand is contained in Figures 2 to 5 or Figure 6 In any of the adapters shown in (Formula XI), "oligonucleotide" represents the nucleic acid described in this application, wherein the nucleic acid described in this application comprises a modified second strand, the second strand comprising or consisting of any one of SEQ ID NO:1105 to SEQ ID NO:1380, preferably wherein the adapter is conjugated to the 3' end region of the second strand by a phosphodiester bond, i.e., conjugated to the 3' end region of any one of SEQ ID NO:1105 to SEQ ID NO:1380.
[0786] In some implementations, the GalNAc ligand is contained in Figure 4In the connector shown, “oligonucleotide” represents the nucleic acid described in this application, wherein the nucleic acid described in this application comprises a modified second strand, the second strand comprising or consisting of any one of SEQ ID NO:1105 to SEQ ID NO:1380, preferably wherein the connector is conjugated to the 3' end region of the second strand via a phosphodiester bond, i.e., conjugated to the 3' end region of any one of SEQ ID NO:1105 to SEQ ID NO:1380.
[0787] In some implementations, the GalNAc ligand is contained in Figure 6 In the linker shown in (Formula XI), "oligonucleotide" represents the nucleic acid described in this application, wherein the nucleic acid described in this application comprises a modified second chain, the second chain comprising or consisting of any one of SEQ ID NO:1105 to SEQ ID NO:1380, preferably wherein the linker is conjugated to the 3' end region of the second chain via a phosphodiester bond, i.e., conjugated to the 3' end region of any one of SEQ ID NO:1105 to SEQ ID NO:1380.
[0788] In some implementations, the GalNAc ligand is contained in Figures 2 to 5 or Figure 6 In any of the adapters shown in (Formula XI), "oligonucleotide" represents the nucleic acid described in this application, wherein the nucleic acid described in this application comprises a modified second strand, the second strand comprising or consisting of any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281 and SEQ ID NO:1324, preferably wherein the adapter is conjugated to the 3' end region of the second strand via a phosphodiester bond, i.e., conjugated to the 3' end region of any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281 and SEQ ID NO:1324.
[0789] In some implementations, the GalNAc ligand is contained in Figure 4In the connector shown, “oligonucleotide” represents the nucleic acid described in this application, wherein the nucleic acid described in this application comprises a modified second strand, the second strand comprising or consisting of any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281 and SEQ ID NO:1324, preferably wherein the connector is conjugated to the 3' end region of the second strand by a phosphodiester bond, i.e., conjugated to the 3' end region of any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281 and SEQ ID NO:1324.
[0790] In some implementations, the GalNAc ligand is contained in Figure 6 In the adapter shown in (Formula XI), "oligonucleotide" represents the nucleic acid described in this application, wherein the nucleic acid described in this application comprises a modified second strand, the modified second strand comprising or consisting of any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281 and SEQ ID NO:1324, preferably wherein the adapter is conjugated to the 3' end region of the second strand via a phosphodiester bond, i.e., conjugated to the 3' end region of any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281 and SEQ ID NO:1324.
[0791] In some implementations, the GalNAc ligand is contained in Figures 2 to 5 or Figure 6 In the adapter shown in (Formula XI), "oligonucleotide" represents the nucleic acid described in this application, wherein the nucleic acid described in this application comprises a modified second strand, the modified second strand comprising or consisting of any one of SEQ ID NO:1105 to SEQ ID NO:1380, preferably comprising any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281 and SEQ ID NO:1324, wherein the second strand has the following structure
[0792]
[0793] in:
[0794] T represents 2'Me ribose modification.
[0795] B represents the nucleoside bases of the first two basic nucleosides in the 5' end region of any one of SEQ ID NO:1105 to SEQ ID NO:1380, preferably the nucleoside bases of the first two basic nucleosides in the 5' end region of any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281 and SEQ ID NO:1324, and
[0796] Z represents the remaining 19 consecutive basic nucleosides of any one of SEQ ID NO:1105 to SEQ ID NO:1380, preferably the remaining 19 consecutive basic nucleosides of any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281 and SEQ ID NO:1324.
[0797] In some implementations, the GalNAc ligand is contained in Figure 6 In the adapter shown in (Formula XI), "oligonucleotide" represents the nucleic acid described in this application, wherein the nucleic acid described in this application comprises a modified second strand, the modified second strand comprising or consisting of any one of SEQ ID NO:1105 to SEQ ID NO:1380, preferably comprising any one of NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281 and SEQ ID NO:1324, wherein the second strand has the following structure
[0798]
[0799] in:
[0800] T represents 2'Me ribose modification.
[0801] B represents the nucleoside bases of the first two basic nucleosides in the 5' end region of any one of SEQ ID NO:1105 to SEQ ID NO:1380, preferably the nucleoside bases of the first two basic nucleosides in the 5' end region of any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281 and SEQ ID NO:1324, and
[0802] Z represents the remaining 19 consecutive basic nucleosides of any one of SEQ ID NO:1105 to SEQ ID NO:1380, preferably the remaining 19 consecutive basic nucleosides of any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281 and SEQ ID NO:1324.
[0803] In some implementations, the GalNAc ligand is contained in Figure 4 In the connector shown, "oligonucleotide" represents the nucleic acid described in this application, wherein the nucleic acid described in this application comprises a modified second strand, the modified second strand comprising or consisting of any one of SEQ ID NO:1105 to SEQ ID NO:1380, wherein the second strand has the following structure
[0804]
[0805] in:
[0806] T represents 2'Me ribose modification.
[0807] B represents the nucleoside bases of the first two basic nucleosides in the 5' end region of any one of SEQ ID NO:1105 to SEQ ID NO:1380, preferably the nucleoside bases of the first two basic nucleosides in the 5' end region of any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281 and SEQ ID NO:1324, and
[0808] Z represents the remaining 19 consecutive basic nucleosides of any one of SEQ ID NO:1105 to SEQ ID NO:1380, preferably the remaining 19 consecutive basic nucleosides of any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281 and SEQ ID NO:1324.
[0809] carriers and cells
[0810] In one aspect, this application provides a cell containing nucleic acids (such as the repressive RNA [RNAi] described herein).
[0811] In one aspect, this application provides a cell comprising the vector described herein.
[0812] In one aspect, this application provides a vector containing an oligonucleotide inhibitor (e.g., iRNA, such as siRNA).
[0813] Pharmaceutically acceptable compositions
[0814] In one aspect, this application provides a pharmaceutical composition for inhibiting the expression of a target gene, the composition comprising an inhibitor, such as an oligomer, such as a nucleic acid disclosed herein.
[0815] Pharmaceutically acceptable compositions may contain excipients and / or carriers.
[0816] Some examples of materials that can serve as pharmaceutically acceptable carriers include: (1) sugars, such as lactose, glucose, and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; (4) tragacanth gum powder; (5) malt; (6) gelatin; (7) lubricants, such as magnesium stearate, sodium lauryl sulfate, and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; (10) glycols, such as propylene glycol; (11) 1) Polyols, such as glycerol, sorbitol, mannitol and polyethylene glycol; (12) Esters, such as ethyl oleate and ethyl laurate; (13) Agar; (14) Buffers, such as magnesium hydroxide and aluminum hydroxide; (15) Alginate; (16) Atherless water; (17) Isotonic saline; (18) Ringer's solution; (19) Ethanol; (20) pH buffer solution; (21) Polyesters, polycarbonates and / or polyanhydrides; (22) Compatibilizers, such as peptides and amino acids; (23) Serum components, such as serum albumin, HDL and LDL; and (22) Other non-toxic compatible substances used in pharmaceutical preparations.
[0817] Representative drug carriers include, but are not limited to, binders (e.g., pregelatinized corn starch, polyvinylpyrrolidone, or hydroxypropyl methylcellulose); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylate, or dicalcium phosphate); lubricants (e.g., magnesium stearate, talc, silica, colloidal silica, stearic acid, metal stearate, hydrogenated vegetable oil, corn starch, polyethylene glycol, sodium benzoate, sodium acetate); disintegrants (e.g., starch, sodium carboxymethyl starch); and wetting agents (e.g., sodium dodecyl sulfate).
[0818] Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral application and that do not react harmfully with nucleic acids may also be used to formulate the compositions described in this application. Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohols, polyethylene glycol, gelatin, lactose, amylose, magnesium stearate, talc, silica, viscous paraffin, hydroxymethyl cellulose, polyvinylpyrrolidone, etc.
[0819] Formulations for topical application of nucleic acids may comprise sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents (e.g., alcohols), or nucleic acid solutions in liquid or solid oil bases. The solutions may also contain buffers, diluents, and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral application and that do not cause adverse reactions with nucleic acids may also be used.
[0820] In one embodiment, the nucleic acid or composition is administered in a non-buffered solution. In some embodiments, the non-buffered solution is saline or water. In other embodiments, the nucleic acid (e.g., an RNAi agent) is administered in a buffered solution. In such embodiments, the buffered solution may contain acetate, citrate, prolyl, carbonate, or phosphate, or any combination thereof. For example, the buffered solution may be a phosphate-buffered saline (PBS).
[0821] dose
[0822] The pharmaceutical compositions described in this application can be administered at doses sufficient to inhibit gene expression or alter the expression or function of a target. Generally, when the composition contains nucleic acids, a suitable dose of the nucleic acid (e.g., siRNA) described in this application is from about 0.001 to about 200.0 mg per kilogram of body weight per day for the recipient, typically from about 1 to 50 mg per kilogram of body weight per day. Typically, a suitable dose of the nucleic acid (e.g., siRNA) described in this application is from about 0.1 mg / kg to about 5.0 mg / kg, for example from about 0.3 mg / kg to about 3.0 mg / kg.
[0823] Repeated dosing regimens may include the periodic administration of therapeutic doses of nucleic acid (e.g., siRNA), such as every other day or once a year. In some embodiments, the nucleic acid (e.g., siRNA) is administered approximately once a month to approximately once a quarter (i.e., once every three months).
[0824] In various embodiments, the nucleic acid (e.g., siRNA agent) is administered at a dose of about 0.01 mg / kg to about 10 mg / kg or about 0.5 mg / kg to about 50 mg / kg. In some embodiments, the nucleic acid (e.g., siRNA agent) is administered at a dose of about 10 mg / kg to about 30 mg / kg. In some embodiments, the nucleic acid (e.g., siRNA agent) is administered at a dose selected from about 0.5 mg / kg, 1 mg / kg, 1.5 mg / kg, 3 mg / kg, 5 mg / kg, 10 mg / kg, and 30 mg / kg. In some embodiments, the nucleic acid (e.g., siRNA agent) is administered about once a week, once a month, once every two months, or once a quarter (i.e., once every three months) at a dose of about 0.1 mg / kg to about 5.0 mg / kg. In some embodiments, the nucleic acid (e.g., siRNA agent) is administered to the subject once a week. In some embodiments, the nucleic acid (e.g., siRNA agent) is administered to the subject once a month. In some implementations, the nucleic acid (e.g., siRNA agent) is administered once per quarter (i.e. every three months).
[0825] After the initial treatment regimen, it can be administered at a less frequent frequency. For example, after three months of weekly or bi-weekly administration, it can be repeated monthly for six months or a year; or even longer.
[0826] The pharmaceutical composition may be administered once daily, or in two, three, or more sub-dose doses at appropriate intervals throughout the day, or even via continuous infusion or delivery by a controlled-release formulation. In this case, the nucleic acid (e.g., siRNA) contained in each sub-dose must be correspondingly smaller to achieve the total daily dose. Dosage units may also be mixed for delivery over several days, for example using a universal sustained-release formulation that can provide sustained release of the nucleic acid (e.g., siRNA) over several days. Sustained-release formulations are well known in the art and are particularly suitable for delivering pharmaceutical agents to specific sites, for example, and can be used with the pharmaceutical agents described in this application. In this embodiment, the dosage unit comprises a corresponding multiple of the daily dose.
[0827] In other embodiments, a single dose of the pharmaceutical composition can be administered for an extended period, such that subsequent doses are administered at intervals not exceeding 3, 4, or 5 days, or at intervals not exceeding 1, 2, 3, or 4 weeks. In some embodiments of this application, a single dose of the pharmaceutical composition is administered once weekly. In other embodiments of this application, a single dose of the pharmaceutical composition is administered twice monthly. In some embodiments, the siRNA is administered approximately once monthly to once quarterly (i.e., approximately every three months), or even once every six months or twelve months.
[0828] As is known in the art, the effective dose and in vivo half-life of the individual nucleic acids (e.g., siRNA) covered by this application can be estimated using common methods or based on in vivo experiments using suitable animal models.
[0829] The pharmaceutical compositions described in this application can be administered in a variety of ways, depending on whether local or systemic treatment is required, and depending on the area to be treated. Administration can be local (e.g., via a transdermal patch); pulmonary, such as by inhalation or blowing in powders or aerosols, including via a nebulizer; intratracheal, intranasal, epidermal and transdermal, oral, or parenteral. Parenteral administration includes intravenous, intra-arterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion; subcutaneous administration, such as via an implanted device; or intracranial administration, such as via intraparenchymal, intrathecal, or intraventricular administration. In some preferred embodiments, the composition is administered via intravenous infusion or injection. In some embodiments, the composition is administered via subcutaneous injection.
[0830] In one implementation, the nucleic acid (e.g., siRNA) agent is administered subcutaneously to the subject.
[0831] The inhibitor (e.g., nucleic acid, such as siRNA) can be delivered in a way that targets specific tissues (e.g., hepatocytes in particular).
[0832] Methods for inhibiting gene expression or inhibiting target expression or function in vitro
[0833] This application also provides a method for inhibiting SLC25A5 gene expression in cells. The method comprises contacting cells with an amount of the nucleic acid described in this application (e.g., a siRNA agent, such as a double-stranded siRNA agent) that effectively inhibits SLC25A5 gene expression in cells, thereby inhibiting SLC25A5 gene expression in cells. It should be noted that the nucleic acid "for inhibiting SLC25A5 expression" is a nucleic acid capable of inhibiting SLC25A5 expression, preferably as described below.
[0834] Contact between cells and nucleic acids (e.g., siRNA, such as double-stranded siRNA agents) can be performed in vitro or in vivo. In vivo contact between cells and nucleic acids may include, for example, contacting cells or cell populations within a subject (e.g., a human subject) with the nucleic acid (e.g., siRNA). Combinations of in vitro and in vivo cell contact methods are also feasible. As described above, cell contact can be direct or indirect. Furthermore, cell contact can be achieved by targeting a ligand portion, comprising any ligand portion described herein or known in the art. In a preferred embodiment, the targeting ligand portion is a carbohydrate portion (e.g., a GalNAc3 ligand) or any other ligand portion that guides the siRNA agent to a target site.
[0835] The term “inhibition” as used in this article is used interchangeably with “reduction,” “silence,” “downregulation,” “curb,” and other similar terms, and includes any level of inhibition.
[0836] In some embodiments of the method described in this application, the expression or activity of the gene or repressive target is inhibited by at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or inhibited to below the detection level of the assay, preferably when measured by qPCR as described herein and / or when siRNA is introduced into target cells via transfection, to the aforementioned levels. In some embodiments, the method comprises clinically relevant inhibition of target gene expression, for example, as demonstrated by clinically relevant outcomes following treatment of a subject with an agent to reduce gene expression and / or target activity.
[0837] In some embodiments, when transfected into cells, the IC50 value of the nucleic acid described in this application for inhibiting SLC25A5 gene expression is below a defined threshold. In some embodiments, the threshold may be 2500 pM, 2000 pM, 1900 pM, 1800 pM, 1700 pM, 1600 pM, 1500 pM, 1400 pM, 1300 pM, 1200 pM, 1100 pM, 1000 pM, 900 pM, 800 pM, 700 pM, 600 pM, 500 pM, 400 pM, 300 pM, 200 pM, or 100 pM, preferably as determined by qPCR, more preferably as determined by reverse transcriptase (RT)-qPCR, as described herein.
[0838] In a preferred embodiment, when the nucleic acid described in this application is transfected into cells, its IC50 value for inhibiting SLC25A5 gene expression is less than 2500 pM. In a more preferred embodiment, when the nucleic acid described in this application is transfected into cells, its IC50 value for inhibiting SLC25A5 gene expression is less than 1000 pM. In a more preferred embodiment, when the nucleic acid described in this application is transfected into cells, its IC50 value for inhibiting SLC25A5 gene expression is less than 500 pM. In the most preferred embodiment, when the nucleic acid described in this application is transfected into cells, its IC50 value for inhibiting SLC25A5 gene expression is less than 100 pM.
[0839] SLC25A5 gene repression can be quantified using the following methods:
[0840] Huh7 cells (a human hepatocyte-derived cell line obtained from the JCRB cell bank) were cultured at 37°C and 5% CO2 in DMEM (Durbeco Modified Eagle Medium) supplemented with 10% FBS and 1% non-essential amino acids. Cells were then transfected using a 6-point logarithmic dose-response curve with duplexes of siRNA targeting SLC25A5 mRNA or a negative control siRNA (siRNA-control; sense strand 5'-GCCTGTACCAAGGCTTTAA-3' (SEQ ID NO:1383), antisense strand 5'-TTAAAGCCTTGGTACAGGC-3' (SEQ ID NO:1382)). The final duplex concentration ranged from 3 nM to 0.03 pM. Transfection was performed by adding 9.7 μL of Opti-MEM (ThermoFisher) and 0.3 μL of Lipofectamine RNAiMAX (ThermoFisher) to each 10 μL siRNA duplex. Incubate the mixture at room temperature for 15 minutes, then add it to 100 μL of complete growth medium containing 20,000 Huh7 cells. Cells can be incubated at 37°C / 5% CO2 for 24 hours before purifying all RNA using the RNeasy 96 Kit (Qiagen). In a single experiment, each duplex can be tested by transfection in replicate wells.
[0841] cDNA synthesis can be performed using the FastKing RT (containing gDNase) Kit (Tiangen). Real-time quantitative PCR (qPCR) can be performed on an ABI Prism 7900HT or ABI Quant Studio 7 using specific primers for human SLC25A5 (forward: ACTGACATCATGTACACAGGCAC (SEQ ID NO:1384), reverse: ACCCATGCCTCTGAGAACATT (SEQ ID NO:1385)) and human GAPDH (forward: GAAGGTGAAGGTCGGAGTC (SEQ ID NO:1386), reverse: GAAGATGGTGATGGGATTTC (SEQ ID NO:1387)) using the SensiFAST SYBR Hi-ROX Kit (Meridian).
[0842] qPCR can be repeated for cDNA from each well, and the average cycle threshold (Ct) can be calculated. Relative SLC25A5 expression can be calculated using the comparative Ct (ΔΔCt) method, normalized to GAPDH and referenced to untreated cells. The maximum inhibition rate and IC50 value of SLC25A5 expression can be calculated using a four-parameter (variable slope) model via GraphPad Prism 9.
[0843] In some embodiments, when the nucleic acid described in this application is transfected into cells, its pEC50 value for inhibiting SLC25A5 gene expression is lower than 5, 6, 7, 8, 9 or 10, preferably as determined by qPCR, more preferably as determined by reverse transcriptase (RT)-qPCR, as described herein.
[0844] Therefore, Huh7 cells (human hepatocyte-derived cell line obtained from the JCRB cell bank) can be cultured in Dürbeco modified Eagle medium (DMEM) supplemented with 10% FBS and 1% non-essential amino acids at 37°C, 5% CO2, and 95% humidity.
[0845] A 6-point logarithmic dose-response curve can be used to transfect the sample with a double-stranded siRNA targeting SLC25A5 mRNA or a negative control siRNA (siRNA-control; sense strand 5'-GCCTGTACCAAGGCTTTAA-3' (SEQ ID NO:1383), antisense strand 5'-TTAAAGCCTTGGTACAGGC-3' (SEQ ID NO:1382)) to achieve a final assay concentration of 3 nM to 0.03 pM. Transfection can be performed by diluting Lipofectamine RNAiMAX (ThermoFisher) in Opti-MEM (ThermoFisher) medium at a ratio of 48.5:1.5. This solution can be added to an equal volume of siRNA and diluted to the desired concentration in phosphate buffer. The mixture of lipofectamine RNAiMAX and siRNA is incubated at room temperature for 15 minutes, and then 20 μL is added to the wells of a 96-well plate. Huh7 cells can be isolated from the flask using trypsin and resuspended at a density of 200,000 cells / mL. 100 μL of the Huh7 cell suspension can be added to each well of a 96-well plate containing siRNA. Cells can be incubated at 37°C, 5% CO2, and 95% humidity for 24 hours. Each siRNA sample can be tested in three replicate wells over two days, for a total of six replicates.
[0846] Intracellular RNA can be isolated using the Rneasy kit (Qiagen) according to the manufacturer's instructions. cDNA synthesis can be performed using the FastKing RT kit with gDNase (Tiangen). Target cDNA quantification can be performed using specific primers against human SLC25A5 (forward: ACTGACATCATGTACACAGGCAC (SEQ ID NO:1384), reverse: ACCCATGCCTCTGAGAACATT (SEQ ID NO:1385)) and human GAPDH (forward: GAAGGTGAAGGTCGGAGTC (SEQ ID NO:1386), reverse: GAAGATGGTGATGGGATTTC (SEQ ID NO:1387)) using the SensiFAST SYBR Hi-ROX kit (Meridian) on an ABI Prism 7900HT or ABI QuantStudio 7.
[0847] qPCR can be repeated for cDNA from each well, and the average cycle threshold (Ct) can be calculated. Relative SLC25A5 expression can be calculated using the comparative Ct (ΔΔCt) method, normalized to GAPDH and referenced to untreated cells. The maximum inhibition rate of SLC25A5 expression and pEC50 value (EC50 - log₂C₅) can be calculated using a four-parameter (variable slope) model via GraphPad Prism 9. 10 ).
[0848] Alternatively or additionally, suppression of SLC25A5 gene expression can be characterized as a decrease in the mean relative expression level of the SLC25A5 gene.
[0849] In some embodiments, when cells are transfected with 0.1 nM of the nucleic acid described in this application, the average relative expression level of SLC25A5 is less than 1, 0.9, 0.8, 0.7, 0.6, 0.5 or 0.4, preferably as determined by qPCR, more preferably as determined by reverse transcriptase (RT)-qPCR, as described herein.
[0850] In some embodiments, when cells are transfected with 5 nM of the nucleic acid of this application, the mean relative expression of SLC25A5 is less than 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4 or 0.3, preferably identified by qPCR, more preferably identified by reverse transcriptase (RT)-qPCR, as described herein.
[0851] The average relative expression level of the SLC25A5 gene can be quantified using the following methods:
[0852] Huh7 cells (a human hepatocyte-derived cell line obtained from the JCRB cell bank) can be cultured at 37°C and 5% CO2 in DMEM supplemented with 10% FBS. Cells can then be transfected with duplexes of siRNA targeting SLC25A5 mRNA or negative control siRNA (siRNA-control; sense strand 5'-GCCTGTACCAAGGCTTTAA-3' (SEQ ID NO:1383), antisense strand 5'-TTAAAGCCTTGGTACAGGC-3' (SEQ ID NO:1382)), with a final duplex concentration ranging from 5 nM to 0.1 nM. Transfection is performed by adding 9.7 μL of Opti-MEM (ThermoFisher) and 0.3 μL of Lipofectamine RNAiMAX (ThermoFisher) to each 10 μL siRNA duplex. Incubate the mixture at room temperature for 15 minutes, then add it to 100 μL of complete growth medium containing 20,000 Huh7 cells. Cells can be incubated at 37°C / 5% CO2 for 24 hours before purifying all RNA using the RNeasy 96 Kit (Qiagen). Each duplex can be tested in two independent experiments by transfection in replicate wells.
[0853] cDNA synthesis can be performed using the FastKing RT (containing gDNase) Kit (Tiangen). Real-time quantitative PCR (qPCR) can be performed on an ABI Prism 7900HT or ABI Quant Studio 7 using specific primers for human SLC25A5 (forward: ACTGACATCATGTACACAGGCAC (SEQ ID NO:1384), reverse: ACCCATGCCTCTGAGAACATT (SEQ ID NO:1385)) and human GAPDH (forward: GAAGGTGAAGGTCGGAGTC (SEQ ID NO:1386), reverse: GAAGATGGTGATGGGATTTC (SEQ ID NO:1387)) using the SensiFAST SYBR Hi-ROX Kit (Meridian).
[0854] qPCR can be repeated for cDNA from each well, and the average cycle threshold (Ct) can be calculated. Relative SLC25A5 expression can be calculated using the comparison Ct (ΔΔCt) method with average Ct value normalized to GAPDH and referenced to untreated cells.
[0855] The maximum inhibition rate and IC50 value of SLC25A5 expression can be calculated using a four-parameter (variable slope) model via GraphPad Prism 9.
[0856] In some embodiments, when the nucleic acid described in this application is transfected into cells, its pEC50 value for inhibiting SLC25A5 gene expression is lower than 5, 6, 7, 8, 9 or 10, preferably as determined by qPCR, more preferably as determined by reverse transcriptase (RT)-qPCR, as described herein.
[0857] Suppression of SLC25A5 gene expression can be confirmed by a reduction in the amount of mRNA of the target SLC25A5 gene compared with a suitable control group.
[0858] In other implementations, the suppression of SLC25A5 gene expression can be assessed based on a reduction in parameters related to gene expression function (e.g., protein expression or signaling pathways).
[0859] Methods for treating or preventing diseases related to gene expression / target functional expression
[0860] This application also provides a method for reducing or inhibiting gene expression in cells or reducing the expression or function of a target gene using the nucleic acid (e.g., siRNA) described in this application or a composition containing the nucleic acid (e.g., siRNA) described in this application. The method comprises contacting cells with the nucleic acid (e.g., dsiRNA) described in this application and maintaining the cells for a sufficient time to allow for the degradation of the gene's mRNA transcript, thereby inhibiting gene expression in the cells. The reduction in target gene expression or function can be assessed by any method known in the art. In a preferred embodiment, the gene is SLC25A5.
[0861] In the method described in this application, cells can be contacted either in vitro or in vivo, i.e., the cells can be inside the subject.
[0862] Cells suitable for treatment using the methods described in this application can be any cells expressing target genes associated with metabolic diseases or disorders, such as metabolic diseases or disorders associated with non-alcoholic fatty liver disease (NAFLD), and / or obesity, and / or diseases or disorders associated with adipogenesis, and / or adipogenesis.
[0863] The in vivo method described in this application may include administering to a subject a composition comprising a nucleic acid (e.g., siRNA) described in this application, wherein the nucleic acid (e.g., siRNA) comprises a nucleoside sequence complementary to at least a portion of the RNA transcript of the SLC25A5 gene of the mammal to be treated.
[0864] This application further provides a method for treating a subject in need. The treatment method described in this application comprises administering the nucleic acid (e.g., siRNA) described in this application to a subject, for example, a subject who benefits from reduced or inhibited gene expression and / or target expression and / or function, to administer a therapeutically effective amount of the nucleic acid (e.g., siRNA) of the target gene or a pharmaceutical composition containing the nucleic acid of the target gene.
[0865] The nucleic acids (e.g., siRNA) described in this application can be administered as “free” nucleic acids or “free” siRNA without the presence of a pharmaceutical composition. The naked nucleic acids can be in a suitable buffer solution. The buffer solution may contain acetate, citrate, prolyl, carbonate, or phosphate, or any combination thereof. In one embodiment, the buffer solution is phosphate-buffered saline (PBS). The pH and osmotic pressure of the buffer solution can be adjusted to make it suitable for administration to a subject.
[0866] Alternatively, the nucleic acid (e.g., siRNA) described in this application can be administered as a pharmaceutical composition (e.g., dsiRNA liposome formulation).
[0867] In one embodiment, the method comprises applying the composition characterized herein to reduce the expression of a target gene, for example, for a duration of about 1, 2, 3, 4, 5, 6, 7, 8, 12, 16, 18, 24 hours, 28, 32, or about 36 hours. In one embodiment, the reduction in target gene expression lasts for a longer period of time, for example, at least about two, three, four days, or longer, for example, about one week, two weeks, three weeks, or four weeks, or longer, for example, about one month, two months, or three months.
[0868] Therapeutic doses of nucleic acid (e.g., siRNA) may be administered to the subject, for example, from about 0.01 mg / kg to about 200 mg / kg.
[0869] Nucleic acids (e.g., siRNA) can be administered periodically via intravenous infusion over a period of time. In some embodiments, treatment can be administered at a lower frequency after an initial treatment regimen. siRNA administration can reduce the level of the gene product of a target gene in, for example, patient cells or tissues by at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or below the detection level of the assay method used. In some embodiments, administration is associated with a reduction in at least one clinically stable or preferably clinically relevant sign or symptom leading to a gene-related disorder.
[0870] Alternatively, nucleic acids (e.g., siRNA) can be administered subcutaneously, i.e., by subcutaneous injection. A single or multiple injections can be used to deliver the required daily dose of nucleic acid (e.g., iRNA) to the subject. Injections can be repeated over a period of time. Regularly repeated administration is possible. In some embodiments, treatment can be administered at a lower frequency after the initial treatment regimen. Repeated dosing regimens may include regularly administered therapeutic doses of nucleic acid, such as every other day or once a year. In some embodiments, nucleic acid is administered approximately once a month to approximately once a quarter (i.e., approximately once every three months).
[0871] Combination therapy
[0872] The inhibitors of this application can be used in combination with other therapeutic agents for treatment, particularly for any metabolic diseases or disorders disclosed herein.
[0873] In some embodiments, the inhibitors described herein (such as any siRNA molecules disclosed herein) may be used in combination with GLP-1 agonists, including but not limited to GLP-1 / GIP dual agonists, GLP-1 / FGF21 dual agonists, GLP-1 / GCGR dual agonists, and GLP-1 / GIP / GCGR triple agonists and / or THR-β agonists.
[0874] In other words, in some embodiments, the inhibitors described in this application, especially the siRNA molecules disclosed herein, can be used in combination with GLP-1 agonists to treat metabolic diseases or disorders. In specific embodiments, the inhibitors described in this application, especially the siRNA molecules disclosed herein, can be used in combination with GLP-1 agonists to treat fatty liver, particularly NAFLD and / or NASH.
[0875] As used herein, the term "GLP-1 agonist" refers to a compound capable of fully or partially activating the human GLP-1 receptor. Therefore, this term is equivalent to the term "GLP-1 receptor agonist" as used in other literature. The term GLP-1 agonist, and the specific GLP-1 agonists described herein, also encompass their salt forms.
[0876] Therefore, a GLP-1 agonist should exhibit "GLP-1 activity," which refers to the ability of a compound (i.e., a GLP-1 analog or a compound containing a GLP-1 analog) to bind to a GLP-1 receptor and initiate a signal transduction pathway, thereby producing an insulinotropic effect or other physiological effects known in the art. In some embodiments, the "GLP-1 agonist" binds to, for example, compounds with an affinity constant (K... D GLP-1 receptor or activation potency (EC) 50GLP-1 receptors with concentrations below 1 mM, such as below 100 nM (as measured by methods known in the art (see, for example, WO 98 / 08871)), exhibit insulin-promoting activity, which can be measured by in vivo or in vitro assays known to those skilled in the art. For example, a GLP-1 agonist can be administered to animals with elevated blood glucose levels (e.g., using an intravenous glucose tolerance test (IVGTT)). Those skilled in the art will be able to identify appropriate glucose doses and suitable blood sampling protocols (e.g., depending on the animal species, for IVGTT) and measure plasma insulin concentrations over time. Suitable assays have been described, for example, in WO 2015 / 155151.
[0877] The term "half-maximal effective concentration" (EC50) is used to describe the concentration of substances at half maximum concentration. 50 (This typically refers to a reference dose-response curve, inducing a concentration that produces half the response between baseline and maximum.) EC 50 The concentration used to measure the potency of a compound is expressed as the concentration at which its maximum effect is achieved (50%). Because GLP-1 agonists containing the substituents described herein have albumin-binding activity, care must be taken to ensure that human serum albumin is present in the assay.
[0878] The in vitro potency of the GLP-1 agonist can be determined in the absence of human serum albumin (HSA) as described in Example 29 of WO 2015 / 155151, and the EC50 can be determined. 50 The lower the value, the better the efficacy. In one implementation, the measured efficacy (EC) 50 (excluding HSA) is 5-1000 pM, for example 10-750 pM, 10-500 pM, or 10-200 pM. In one embodiment, EC 50 (Excluding HSA) Maximum is 500pM, for example, maximum is 300pM, for example, maximum is 200pM.
[0879] In one implementation, EC 50 (excluding HSA) is equivalent to human GLP-1 (7-37).
[0880] In one implementation, EC 50 (Excluding HSA) Maximum 50 pM. In another such implementation, EC 50 The maximum is 40 pM, for example, a maximum of 30 pM, for example, a maximum of 20 pM, for example, a maximum of 10 pM. In one implementation, EC 50 Around 10pM.
[0881] Alternatively, the in vitro potency assay of Example 29 (containing HSA) in WO 2015 / 155151 can be used to measure the binding of GLP-1 agonists to albumin. In the presence of serum albumin, the in vitro potency EC50 is [not specified]. 50 The increase in the value reflects the affinity for serum albumin.
[0882] In one implementation scheme, the measured potency (EC) 50 (Based on 1% HSA) 5-1000 pM, for example 100-750 pM, 200-500 pM or 100-400 pM. In one embodiment, EC 50 (Based on 1% HSA) Maximum 750pM, for example, maximum 500pM, for example, maximum 400pM, for example, maximum 300pM or for example, maximum 250pM.
[0883] If necessary, the fold change relative to a known GLP-1 receptor agonist can be calculated as EC. 50 (Test analogue) / EC 50 (Known analogues) are considered equivalent in efficacy if the ratio is 0.5-1.5 or 0.8-1.2.
[0884] In one implementation scheme, the effectiveness EC 50 (HSA-free) equivalent to the potency of liraglutide. In one embodiment, the potency EC 50 (Without HSA) Equivalent to the efficacy of smegglutinin.
[0885] In some embodiments, the GLP-1 agonist is a GLP-1 analog that optionally contains “a substituent”. When referring to a GLP-1 peptide (hereinafter “peptide”), the term “analyte” as used herein means a peptide in which at least one amino acid residue has been substituted by another amino acid residue, and / or in which at least one amino acid residue has been deleted, and / or in which at least one amino acid residue has been added, and / or in which at least one amino acid residue has been modified. Such addition or deletion of amino acid residues can occur at the N-terminus and / or C-terminus of the peptide.
[0886] In some embodiments, the term "GLP-1 analogue" (or "analogue of GLP-1") as used herein refers to a peptide or compound that is a variant of human glucagon-like peptide-1 (GLP-1(7-37)). GLP-1(7-37) has the sequence HAEGTFTSDV SSYLEGQAAKEFIAWLVKGRG (SEQ ID NO: 1388). In some embodiments, the term "variant" refers to a compound comprising one or more amino acid substitutions, deletions, additions, and / or insertions.
[0887] In one embodiment, the GLP-1 agonist exhibits at least 60%, 65%, 70%, 80%, or 90% sequence identity with GLP-1(7-37) along the entire length of GLP-1(7-37).
[0888] Generally, the term GLP-1 agonist is intended to encompass GLP-1 agonists and any pharmaceutically acceptable salts, amides, or esters thereof. In some embodiments, the composition comprises a GLP-1 agonist or a pharmaceutically acceptable salt, amide, or ester thereof. In some embodiments, the composition comprises a GLP-1 agonist and one or more pharmaceutically acceptable counterions.
[0889] In some embodiments, the inhibitor described herein, particularly the siRNA molecule described herein, may be administered in combination with one or more GLP-1 agonists selected from the following patent applications: WO93 / 19175, WO96 / 29342, WO98 / 08871, WO99 / 43707, WO99 / 43706, WO99 / 43341, WO99 / 43708, WO2005 / 027978, WO2005 / 058954. Patent applications WO2005 / 058958, WO2006 / 005667, WO2006 / 037810, WO2006 / 037811, WO2006 / 097537, WO2006 / 097538, WO2008 / 023050, WO2009 / 030738, WO2009 / 030771, WO2009 / 030774 and WO2021 / 219710 are incorporated herein by reference in their entirety.
[0890] In some embodiments, the inhibitors described herein, particularly the siRNA molecules described herein, can be administered in combination with GLP-1 agonists selected from the group consisting of: dulaglutide. Exenatide Exenatide sustained-release Liraglutide Lixila peptide Smegglutide injection Hesmegglutide tablets
[0891] In some embodiments, the GLP-1 agonist is smegglutide having the formula N-ε26-[2-(2-{2-[2-(2-{2-[(S)-4-carboxy-4-(17-carboxy-heptadecanoylamino)butyrylamino]ethoxy}ethoxy)acetamido]ethoxy}ethoxy)acetyl][Aib8,Arg34]GLP-1(7-37).
[0892] As used herein, the term "GLP-1 agonist" also includes dual or triple agonists capable of activating multiple receptors. These dual or triple agonists can be molecules capable of activating the GLP-1 receptor and at least one other receptor. In some embodiments, the dual or triple agonist can be a chimeric molecule comprising a first portion activating the GLP-1 receptor and other portions activating other receptors. In some embodiments, the GLP-1 agonist is a dual or triple agonist that, in addition to the GLP-1 receptor, activates one or more of the following receptors: glucose-dependent insulinotropic peptide (GIP) receptor, fibroblast growth factor 21 (FGF21) receptor, and glucagon receptor (GCGR).
[0893] In some embodiments, the inhibitors described in this application, particularly the siRNA molecules disclosed herein, can be used in combination with GLP-1 / GIP dual agonists to treat metabolic diseases or disorders. In specific embodiments, the inhibitors described in this application, particularly the siRNA molecules disclosed herein, can be used in combination with GLP-1 / GIP dual agonists to treat fatty liver disease, especially NAFLD and / or NASH.
[0894] As used in the context of this application, the term "GLP-1 / GIP dual agonist" refers to a substance or ligand capable of activating both the GLP-1 receptor and the glucose-dependent insulinotropic peptide (GIP) receptor. GLP-1 / GIP receptor co-agonists and their potential medical uses have been described in numerous patent applications, such as WO 2010 / 011439, WO 2013 / 164483, WO 2014 / 192284, WO 2015 / 067715, WO 2015 / 022420, WO 2015 / 086728, WO 2015 / 086729, WO 2016 / 111971, WO 2020 / 023386, US 9745360, US2014 / 162945, US2014 / 0357552, WO 2021 / 150673, WO 2021 / 260530, WO 2022 / 018185, and WO Patent applications numbered 2022 / 079639 are incorporated herein by reference in their entirety.
[0895] In some embodiments, the inhibitors described herein, particularly the siRNA molecules disclosed herein, can be combined with the GLP-1 / GIP dual agonist tesipatide. In combination for the treatment of metabolic diseases or disorders. In specific embodiments, the inhibitors described herein, particularly the siRNA molecules disclosed herein, can be used in conjunction with the GLP-1 / GIP dual agonist tesipatide. It is used in combination to treat fatty liver disease, especially NAFLD and / or NASH.
[0896] As used herein, "tirzepatide" refers to the GLP-1 / GIP dual agonist peptide described in U.S. Patent No. 9,474,780, CAS Registry No. 2023788-19-2. Tirzepatide is described in Example 1 of U.S. Patent No. 9,474,780, and its sequence is as follows:
[0897] YX1EGTFTSDYSIX2LDKIAQKAFVQWLMGGPSSGAPPPS(SEQ ID NO:1389)
[0898] Where X1 is α-aminoisobutyric acid (Aib); X2 is Aib; K at position 20 is associated with the K side chain via (2-[2-(2-amino-ethoxy)-ethoxy]-acetyl)2-(γGlu)1-CO-(CH2). 18 Chemical modification is achieved by conjugating the ε-amino group of -CO2H; the C-terminal amino acid is amidated to form a C-terminal primary amide.
[0899] In some embodiments, the inhibitors described in this application, particularly the siRNA molecules disclosed herein, can be used in combination with a GLP-1 / FGF21 dual agonist to treat metabolic diseases or disorders. In specific embodiments, the inhibitors described in this application, particularly the siRNA molecules disclosed herein, can be used in combination with a GLP-1 / FGF21 dual agonist to treat fatty liver disease, especially NAFLD and / or NASH.
[0900] As used in the context of this application, the term "GLP-1 / FGF21 dual agonist" refers to a substance or ligand capable of activating both the GLP-1 receptor and the fibroblast growth factor 21 (FGF21) receptor. Preferably, the GLP-1 / FGF21 dual agonist is a chimeric molecule comprising a GLP-1 agonist as defined above and the molecule FGF21 or a functionally active variant or analog thereof. In some embodiments, the GLP-1 / FGF21 dual agonist may further comprise an antibody Fc region.
[0901] GLP-1 / FGF21 receptor co-agonists and their potential medical uses are described in several patent applications, such as WO 2010 / 142665, WO2014 / 037373, WO 2018 / 115401, WO 2018 / 166461, WO 2019 / 243557 and WO 2022 / 002408, all of which are incorporated herein by reference.
[0902] In some embodiments, the inhibitors described in this application, particularly the siRNA molecules disclosed herein, can be used in combination with GLP-1 / GCGR dual agonists to treat metabolic diseases or disorders. In specific embodiments, the inhibitors described in this application, particularly the siRNA molecules disclosed herein, can be used in combination with GLP-1 / GCGR dual agonists to treat fatty liver disease, especially severe NAFLD and / or NASH.
[0903] As used in the context of this application, the term "GLP-1 / GCGR dual agonist" refers to a substance or ligand capable of activating both the GLP-1 receptor and the glucagon receptor (GCGR). GLP-1 / GCGR receptor co-agonists and their potential medical uses have been described in numerous patent applications, such as WO 2008 / 101017, WO 2009 / 155258, WO 2011 / 075393, WO2011 / 160630, WO 2014 / 056872, WO 2014 / 091316, WO 2015 / 086733, WO 2017 / 181452, WO2018 / 100174, WO 2019 / 030268, WO 2019 / 060660, and WO 2023 / 006923, all of which are incorporated herein by reference.
[0904] In some embodiments, the inhibitors described in this application, particularly the siRNA molecules disclosed herein, can be used in combination with the GLP-1 / GCGR dual agonist Survodutide (BI 456906) to treat metabolic diseases or disorders. In specific embodiments, the inhibitors described in this application, particularly the siRNA molecules disclosed herein, can be used in combination with the GLP-1 / GCGR dual agonist Survodutide (BI456906) to treat fatty liver disease, particularly NAFLD and / or NASH.
[0905] In some embodiments, the inhibitors described in this application, particularly the siRNA molecules disclosed herein, can be used in combination with GLP-1 / GIP / GCGR triple agonists for the treatment of metabolic diseases or disorders. In specific embodiments, the inhibitors described in this application, particularly the siRNA molecules disclosed herein, can be used in combination with GLP-1 / GIP / GCGR dual agonists for the treatment of fatty liver, especially for the treatment of NAFLD and / or NASH.
[0906] As used in the context of this application, the term "GLP-1 / GIP / GCGR triple agonist" refers to a substance or ligand capable of activating the GLP-1 receptor, GIP receptor, and glucagon receptor (GCGR). GLP-1 / GIP / GCGR receptor co-agonists and their potential medical uses are described in numerous patent applications, such as WO 2014 / 096150, WO 2015 / 067716, WO 2019 / 125292, WO 2022 / 090447, and WO 2022 / 268029, all of which are incorporated herein by reference.
[0907] In some embodiments, the inhibitors described in this application, particularly the siRNA molecules disclosed herein, can be used in combination with Retatrutid (LY-3437943) to treat metabolic diseases or disorders. In specific embodiments, the inhibitors described in this application, particularly the siRNA molecules disclosed herein, can be used in combination with Retatrutid (LY-3437943) to treat fatty liver, especially NAFLD and / or NASH.
[0908] Those skilled in the art know methods for formulating GLP-1 agonists (including dual and triple agonists) for use in any suitable route of administration. In some embodiments, the GLP-1 agonist may be administered orally or by injection, for example, by subcutaneous injection.
[0909] In some embodiments, the inhibitors described in this application, particularly the siRNA molecules disclosed herein, can be used in combination with THR-β agonists to treat metabolic diseases or disorders. In specific embodiments, the inhibitors described in this application, particularly the siRNA molecules disclosed herein, can be used in combination with THR-β agonists to treat fatty liver, especially NAFLD and / or NASH.
[0910] As used herein, the term "THR-β agonist" refers to a compound that can fully or partially activate the human thyroid hormone receptor β. The term THR-β agonist, and the specific THR-β agonists described herein, also include their salt forms.
[0911] Various THR-β agonists have been described in this field, and in particular summarized by Zucchi (Thyroid Hormone Analogues: An Update, Thyroid. August 2020; 30(8): 1099–1105), which is incorporated herein by reference in its entirety.
[0912] In some embodiments, the THR-β agonist administered in combination with the inhibitor described in this application is such as MGL-3196 (resmetirom), KB-2115 (eprotirome), GC-1 (sobetirome), or MB07344 / VK2809 as described by Zucchi.
[0913] In some embodiments, the THR-β agonist is any compound disclosed in MGL-3196 (resmetirom) or WO2014 / 043706, which is incorporated herein by reference in its entirety.
[0914] Resmetirom is a selective thyroid hormone receptor (THR) beta agonist. Publications related to resmetirom can also be found in U.S. Patent No. 9,266,861, U.S. Patent Application No. 16 / 343,065, and PCT Application No. PCT / US2019 / 040276, the entire contents of which are incorporated herein by reference.
[0915] In some embodiments, the THR-β agonist is any compound disclosed in KB-2115 (eprotirome) or WO 2007 / 110226 or WO2009 / 077147, the entire contents of which are incorporated herein by reference.
[0916] Those skilled in the art know methods for formulating THR-β agonists for use in any suitable route of administration.
[0917] In some embodiments, the inhibitors described in this application, particularly the siRNA molecules disclosed herein, can be used in combination with GLP-1 agonists (such as any of the GLP-1 agonists disclosed herein, including dual or triple agonists) and THR-β agonists (such as any of the THR-β agonists disclosed herein) to treat metabolic diseases or disorders. In specific embodiments, the inhibitors described in this application, particularly the siRNA molecules disclosed herein, can be used in combination with GLP-1 agonists (such as any of the GLP-1 agonists disclosed herein, including dual or triple agonists) and THR-β agonists (such as any of the THR-β agonists disclosed herein) to treat fatty liver, particularly NAFLD and / or NASH.
[0918] The inhibitors described in this application, particularly the siRNA molecules disclosed herein, may alternatively or additionally be administered in combination with and / or co-administered with one or more of the following substances: amylin receptor agonists (e.g., pramlintide), and / or dual amylin + calcitonin receptor agonists, and / or glucagon receptor agonists, and / or FXR receptor agonists (e.g., cilofexor or obeticholic acid), and / or FGF-21 analogs or FGF-21 receptor agonists (e.g., efruxifermin), and / or FGF-19 analogs or FGF-19 receptor agonists (e.g., aldafermin), and / or galactoceletin 3 inhibitors (e.g., belapectin), and / or PPARα agonists (e.g., elafibrinor), and / or PPARα agonists (e.g., pioglitazone or rosiglitazone), and / or mixtures of PPARα agonists and / or P... PARδ agonists and / or PPARγ agonists, and / or pan-PPARαγδ agonists (e.g., lanafibranor), and / or acetyl-CoA desaturase activators, and / or ASK1 inhibitors (e.g., selonsertib), and / or LOXL2 inhibitors (e.g., simtuzumab), and / or CCR2 / 5 dual inhibitors (e.g., cenicriviroc), and / or inhibitors of enzymes in the de novo lipogenesis (DNL) pathway, including citrate / isocitrate carriers (CIC), ATP-citrate lyase (ACLY), acetyl-CoA carboxylase (ACC), and fatty acid synthase (FAS), and / or inhibitors of enzymes in the cholesterol biosynthesis pathway (e.g., HMGCoA reductase inhibitors, such as atorvastatin); preferably for the treatment of any metabolic disease or disorder disclosed herein, more preferably for the treatment of NAFLD.
[0919] In some embodiments, the inhibitors described herein, particularly the siRNA molecules disclosed herein, can be combined with any molecule disclosed in Figure 1 of Nathani and Bansal (Gastroenterol Hepatol (NY). 2023 Jul; 19(7):371–381; incorporated herein by reference), especially with one or more of the following: THR-β agonists (e.g., remetrol, VK2809, or TERN-501), PPAR agonists (e.g., Lanifibranor, Saroglitazar, or Elafibranor), GLP-1 agonists (e.g., liraglutide, smegglutide, or Tirzepatide), CCR2 / 5 inhibitors (e.g., centicriviroc), ASK1 inhibitors (e.g., Selonsertib), ACC inhibitors (e.g., cis-2 / 5 inhibitors), and siRNA inhibitors (e.g., cis-2 / 5 inhibitors). Such as Firsocostat or PF-05221304), SCD inhibitors (e.g., Aramchol), FGF21 analogs (e.g., Efruxifermin or Pegbelfermin), Galectin-3 inhibitors (e.g., Belapectin), LOXL2 inhibitors (e.g., Simtuzumab), FXR agonists (e.g., obeticholic acid, Tropifexor, Cilofexor, EDP-305 or MET409) and / or FGF19 analogs (e.g., Aldafermina), for the treatment of any metabolic disease or disorder disclosed herein, more preferably for the treatment of NAFLD.
[0920] In some embodiments, the inhibitors described herein, particularly the siRNA molecules disclosed herein, may be combined with any molecule disclosed by Batchuluun et al. (Nat Rev Drug Discov, 2022, 21(4):283-305. doi:10.1038 / s41573-021-00367-2.; incorporated herein by reference), especially with one or more of the following: citrate / isocitrate carrier (CIC) inhibitors (e.g., benzotricarboxylate, CPTI-1, or CPTI-2), ATP-citrate lyase (ACLY) inhibitors (e.g., hexacarboxylic acid, hydroxycitrate, BMS-303141, emodin derivatives, furanylcarboxylate derivatives, MEDICA). 16. SB-204990 or NDI-091143), acetyl-CoA carboxylase (ACC) inhibitors (such as fenofibrate, PF-05221304, PF-05175157, MK-4074, A-908292, carboxamide derivative-1k, CP-640186, monocyclic derivative-1q, ND-654, ND-646, olefin derivative-2e, (S)-9c, soraphen A. TOFA or WZ66) and / or fatty acid synthase (FAS) inhibitors (such as orlistat, TVB-2640, FT-4101, BI-99179, cyanobacterium, C75, Fasnall, GSK2194069, IPI-9119, MP-ML-24-N1 or TVB-3166) for the treatment of any metabolic disease or disorder disclosed herein, more preferably for the treatment of NAFLD.
[0921] The combination therapy or "combination" contemplated herein comprises the co-administration of the inhibitor described herein, particularly the siRNA described herein, and one or more other therapeutic agents, preferably the one or more other therapeutic agents disclosed above. The inhibitor described herein may be administered before, after, or simultaneously with the one or more other therapeutic agents.
[0922] In some embodiments, the inhibitors described herein, particularly the siRNAs described herein, can be co-administered with GLP-1 agonists (including GLP-1 / GIP dual agonists, GLP-1 / FGF21 dual agonists, GLP-1 / GCGR dual agonists, and GLP-1 / GIP / GCGR triple agonists) and / or THR-β agonists, wherein the inhibitors described herein can be administered before, after, or simultaneously with the GLP-1 agonists and / or THR-β agonists.
[0923] In an exemplary embodiment, co-administration comprises administering the siRNA described herein and any GLP-1 agonist disclosed herein or incorporated herein by reference, including GLP-1 / GIP dual agonists, GLP-1 / FGF21 dual agonists, GLP-1 / GCGR dual agonists, and GLP-1 / GIP / GCGR triple agonists. In another exemplary embodiment, co-administration comprises administering the siRNA described herein and the GLP-1 agonist smegraglutide. In yet another exemplary embodiment, co-administration comprises administering the siRNA described herein and the GLP-1 / GIP dual agonist terzapetide.
[0924] In yet another exemplary embodiment, co-administration comprises administering the siRNA described in this application and any THR-β agonist disclosed herein or incorporated herein by reference. In yet another exemplary embodiment, co-administration comprises administering the siRNA described in this application and the THR-β agonist retimerol.
[0925] In another exemplary embodiment, co-administration includes administration of the siRNA described in this application, the GLP-1 agonist smegglutinin or terzatide, and the THR-β agonist remetidine.
[0926] The combination therapy disclosed herein comprises administering, via any route, an inhibitor as described in this application and at least one additional therapeutic agent. In some embodiments, the inhibitor as described in this application and at least one additional therapeutic agent may be delivered orally, subcutaneously, intravenously, intranasally, percutaneously, intraperitoneally, intramuscularly, intrapulmonaryly, vaginally, rectally, or intraocularly. In exemplary embodiments, the inhibitor as described in this application may be administered intravenously (IV) and / or subcutaneously, and the GLP-1 agonist may be administered subcutaneously.
[0927] In one aspect, this application may be applied to the compounds, methods, compositions, or uses described in statements 1-101 below, wherein any reference to any formula in statements 1-101 refers only to those formulas defined within statements 1-101. These formulas are... Figure 6 Reproduced in [the following text]. Specifically, the oligonucleotide moiety represented by Z in any of the following statements may include a nucleic acid for inhibiting SLC25A5 expression as defined in any subsequent claim.
[0928] 1. A compound comprising the following structure:
[0929]
[0930] in:
[0931] R1 is selected independently from hydrogen, methyl, and ethyl each time it appears;
[0932] R2 is selected from hydrogen, hydroxyl group, -OC. 1-3 Alkyl group, -C(=O)OC 1-3 Alkyl, halogen, and nitro groups;
[0933] X1 and X2 are each independently selected from methylene, oxygen, and sulfur when they appear;
[0934] m is an integer from 1 to 6;
[0935] n is an integer from 1 to 10;
[0936] q, r, s, t, v are independent integers from 0 to 4, provided that:
[0937] (i) q and r cannot both be 0; and
[0938] (ii) s, t and v cannot all be 0 at the same time;
[0939] Z is the oligonucleotide moiety.
[0940] 2. According to the compound described in statement 1, R1 is hydrogen each time it appears.
[0941] 3. The compound according to statement 1, wherein R1 is a methyl group.
[0942] 4. The compound according to statement 1, wherein R1 is an ethyl group.
[0943] 5. The compound according to any one of statements 1 to 4, wherein R2 is a hydroxyl group.
[0944] 6. The compound according to any one of statements 1 to 4, wherein R2 is a halogen.
[0945] 7. The compound according to statement 6, wherein R2 is fluorine.
[0946] 8. The compound according to statement 6, wherein R2 is chlorine.
[0947] 9. The compound according to statement 6, wherein R2 is bromine.
[0948] 10. The compound according to statement 6, wherein R2 is iodine.
[0949] 11. The compound according to statement 6, wherein R2 is a nitro group.
[0950] 12. The compound according to any one of statements 1 to 11, wherein X1 is a methylene group.
[0951] 13. The compound according to any one of statements 1 to 11, wherein X1 is oxygen.
[0952] 14. The compound according to any one of statements 1 to 11, wherein X1 is sulfur.
[0953] 15. The compound according to any one of statements 1 to 14, wherein X2 is a methylene group.
[0954] 16. The compound according to any one of statements 1 to 15, wherein X2 is oxygen.
[0955] 17. The compound according to any one of statements 1 to 16, wherein X2 is sulfur.
[0956] 18. The compound according to any one of Articles 1 to 17, wherein m = 3.
[0957] 19. The compound according to any one of statements 1 to 18, wherein n = 6.
[0958] 20. The compound according to statement 13 or 15, wherein X1 is oxygen and X2 is methylene, and preferably wherein:
[0959] q = 1,
[0960] r = 2,
[0961] s=1,
[0962] t=1,
[0963] v = 1.
[0964] 21. The compound according to statement 12 or 15, wherein X1 and X2 are both methylene groups, and preferably wherein:
[0965] q = 1,
[0966] r = 3,
[0967] s=1,
[0968] t=1,
[0969] v = 1.
[0970] 22. A compound according to any one of statements 1 to 21, wherein Z is:
[0971]
[0972] in:
[0973] Z1, Z2, Z3, and Z4 each appear independently as either oxygen or sulfur; and
[0974] One of the bonds between P and Z2, and between P and Z3, is a single bond, while the other bond is a double bond.
[0975] 23. The compound according to statement 22, wherein the oligonucleotide is an RNA compound capable of regulating, preferably, the expression of a target gene.
[0976] 24. The compound according to statement 23, wherein the RNA compound comprises an RNA duplex containing a first strand and a second strand, wherein the first strand is at least partially complementary to the RNA sequence of the target gene, the second strand is at least partially complementary to the first strand, and wherein the first strand and the second strand each have a 5' end and a 3' end.
[0977] 25. The compound according to statement 24, wherein the RNA compound is linked to an adjacent phosphate ester at the 5' end of its second strand.
[0978] 26. The compound according to statement 24, wherein the RNA compound is linked to an adjacent phosphate ester at the 3' end of its second strand.
[0979] 27. Compound of formula (II):
[0980]
[0981] 28. Compound of formula (III):
[0982]
[0983] 29. The compound according to statement 27 or 28, wherein the oligonucleotide comprises an RNA duplex containing a first strand and a second strand, wherein the first strand is at least partially complementary to the RNA sequence of the target gene, the second strand is at least partially complementary to the first strand, and wherein the first strand and the second strand each have a 5' end and a 3' end, wherein the RNA duplex is linked to an adjacent phosphate ester at the 5' end of its second strand.
[0984] 30. A composition comprising a compound of formula (II) as defined in statement 27 and a compound of formula (III) as defined in statement 28 (optionally subordinate to statement 29).
[0985] 31. The composition according to statement 30, wherein the content of the compound of formula (III) as defined in statement 28 is 10% to 15% by weight of the composition.
[0986] 32. Compounds of formula (IV):
[0987]
[0988] 33. Compound of formula (V):
[0989]
[0990] 34. The compound according to statement 32 or 33, wherein the oligonucleotide comprises an RNA duplex containing a first strand and a second strand, wherein the first strand is at least partially complementary to the RNA sequence of the target gene, the second strand is at least partially complementary to the first strand, wherein the first strand and the second strand each have a 5' end and a 3' end, and wherein the RNA duplex is linked to an adjacent phosphate ester at the 3' end of its second strand.
[0991] 35. A composition comprising a compound of formula (IV) as defined in statement 32 and a compound of formula (V) as defined in statement 33 (optionally subordinate to statement 34).
[0992] 36. The composition according to statement 35, wherein the content of the compound of formula (V) as defined in statement 33 is 10% to 15% by weight of the composition.
[0993] 37. A compound as defined in any one of statements 1 to 29 or 32 to 34, wherein the oligonucleotide comprises an RNA duplex, the RNA duplex further comprising one or more riboses modified at the 2' position, preferably multiple riboses modified at the 2' position.
[0994] 38. The compound according to statement 37, wherein the modification is selected from 2'-O-methyl, 2'-deoxy-fluorine, and 2'-deoxy.
[0995] 39. The compound according to any one of statements 1 to 29, 32 to 34, or 37 to 38, wherein the oligonucleotide further comprises one or more degradation-protecting moieties at one or more ends.
[0996] 40. The compound according to statement 39, wherein the one or more degradation protecting moieties are not present at the end of the oligonucleotide chain carrying the ligand moieties, and / or wherein the one or more degradation protecting moieties are selected from thiophosphate nucleoside inter-linked bonds, dithiophosphate nucleoside inter-linked bonds, and inverted abasic nucleosides, wherein the inverted abasic nucleosides are present at the distal end of the chain carrying the ligand moieties.
[0997] 41. The compound according to any one of statements 1 to 29 or statements 32 to 34 or statements 37 to 40, wherein the ligand portion represented by formula (I) in statement 1 comprises one or more ligands.
[0998] 42. The compound according to statement 41, wherein the ligand portion represented by formula (I) in statement 1 comprises one or more carbohydrate ligands.
[0999] 43. The compound according to statement 42, wherein the one or more carbohydrates may be monosaccharides, disaccharides, trisaccharides, tetrasaccharides, oligosaccharides, or polysaccharides.
[1000] 44. The compound according to statement 43, wherein the one or more carbohydrates comprise one or more galactose moieties, one or more lactose moieties, one or more N-acetylgalactosamine moieties, and / or one or more mannose moieties.
[1001] 45. The compound according to statement 44, wherein the one or more carbohydrates comprise one or more N-acetylgalactosamine moieties.
[1002] 46. The compound according to statement 45, comprising two or three N-acetylgalactosamine moieties.
[1003] 47. The compound according to any one of statements 41 to 46, wherein the one or more ligands are connected in a linear or branched configuration.
[1004] 48. The compound according to statement 47, wherein the one or more ligands are connected in a biantennary or triantennary branching configuration.
[1005] 49. The compound according to statements 46 to 48, wherein the portion as shown in formula (I) in statement 1:
[1006]
[1007] It can be any one of formula (VIa), formula (VIb) or formula (VIc), preferably formula (VIa):
[1008]
[1009] in:
[1010] A I It is hydrogen, or a suitable hydroxyl protecting group;
[1011] a is an integer, either 2 or 3; and
[1012] b is an integer from 2 to 5; or
[1013]
[1014] in:
[1015] A I It is hydrogen, or a suitable hydroxyl protecting group;
[1016] a is an integer, either 2 or 3; and
[1017] c and d are independent integers from 1 to 6; or
[1018]
[1019] in:
[1020] A I The protecting group is hydrogen or a suitable hydroxyl group;
[1021] a is an integer, either 2 or 3;
[1022] e is an integer from 2 to 10.
[1023] 50. The compound according to statements 46 to 48, wherein the portion as shown in formula (I) in statement 1:
[1024]
[1025] For equation (VII):
[1026]
[1027] in:
[1028] A I It is hydrogen;
[1029] a is an integer, either 2 or 3.
[1030] 51. The compound described in statement 49 or 50, wherein a = 2.
[1031] 52. The compound described in statement 49 or 50, wherein a = 3.
[1032] 53. The compound described in statement 49, wherein b = 3.
[1033] 54. Compound of formula (VIII):
[1034]
[1035] Compound of formula (IX):
[1036]
[1037] 56. The compound according to statement 54 or 55, wherein the oligonucleotide comprises an RNA duplex containing a first strand and a second strand, wherein the first strand is at least partially complementary to the RNA sequence of the target gene, the second strand is at least partially complementary to the first strand, wherein the first strand and the second strand each have a 5' segment and a 3' end, and wherein the RNA duplex is linked to an adjacent phosphate ester at the 5' end of its second strand.
[1038] 57. A composition comprising a compound of formula (VIII) as defined in statement 54 and a compound of formula (IX) as defined in statement 55 (optionally subordinate to statement 56).
[1039] 58. The composition according to statement 57, wherein the content of the compound of formula (IX) as defined in statement 55 is 10% to 15% by weight of the composition.
[1040] 59. Compound of formula (X):
[1041]
[1042] Compound of formula (XI):
[1043]
[1044] 61. The compound according to statement 59 or 60, wherein the oligonucleotide comprises an RNA duplex containing a first strand and a second strand, wherein the first strand is at least partially complementary to the RNA sequence of the target gene, the second strand is at least partially complementary to the first strand, wherein the first strand and the second strand each have a 5' end and a 3' end, and wherein the RNA duplex is linked to an adjacent phosphate ester at the 3' end of its second strand.
[1045] 62. A composition comprising a compound of formula (X) as defined in statement 59 and a compound of formula (XI) as defined in statement 60 (optionally subordinate to statement 61).
[1046] 63. The composition according to statement 62, wherein the content of the compound of formula (XI) as defined in statement 60 is 10% to 15% by weight of the composition.
[1047] 64. A compound as defined in any one of statements 54 to 63, wherein the oligonucleotide comprises an RNA duplex, said RNA duplex further comprising one or more riboses modified at the 2' position, preferably a plurality of riboses modified at the 2' position.
[1048] 65. The compound according to statement 64, wherein the modification is selected from 2'-O-methyl, 2'-deoxy-fluorine, and 2'-deoxy.
[1049] 66. The compound according to any one of statements 54 to 65, wherein the oligonucleotide further comprises one or more degradation-protecting moieties at one or more ends.
[1050] 67. The compound according to statement 66, wherein the one or more degradation protecting moieties are not present at the end of the oligonucleotide chain carrying the ligand moieties, and / or wherein the one or more degradation protecting moieties are selected from thiophosphate nucleoside inter-linked bonds, dithiophosphate nucleoside inter-linked bonds, and inverted abasic nucleosides, wherein the inverted abasic nucleosides are present at the distal end of the chain carrying the ligand moieties, as shown in any one of formula (VIII), (IX), (X), or (XI) of any one of statements 54, 55, 59, or 60.
[1051] 68. A method for preparing a compound of any one of statements 1 to 29, 32 to 34, 37 to 56, 59 to 61 and 64 to 67 and / or a composition of any one of statements 30, 31, 35, 36, 57, 58, 62, and 63, the method comprising reacting a compound of formula (XII) and (XIII) with:
[1052]
[1053] in:
[1054] R1 is selected independently from hydrogen, methyl, and ethyl each time it appears;
[1055] R2 is selected from hydrogen, hydroxyl group, -OC. 1-3 Alkyl group, -C(=O)OC 1-3 Alkyl, halogen, and nitro groups;
[1056] X1 and X2 are each independently selected from methylene, oxygen, and sulfur when they appear;
[1057] m is an integer from 1 to 6;
[1058] n is an integer from 1 to 10;
[1059] q, r, s, t, v are independent integers from 0 to 4, provided that:
[1060] (i) q and r cannot both be 0; and
[1061] (ii) s, t and v cannot all be 0 at the same time;
[1062] Z represents the oligonucleotide moiety;
[1063] And, where appropriate, perform ligand deprotection and / or annealing of the second chain of the oligonucleotide moiety.
[1064] 69. The method according to statement 68, wherein compound (XII) is prepared by reacting compounds of formula (XIV) and formula (XV):
[1065]
[1066] R1 is selected independently from hydrogen, methyl, and ethyl each time it appears;
[1067] R2 is selected from hydrogen, hydroxyl group, -OC. 1-3 Alkyl group, -C(=O)OC 1-3 Alkyl, halogen, and nitro groups;
[1068] X1 and X2 are each independently selected from methylene, oxygen, and sulfur when they appear;
[1069] q, r, s, t, v are independent integers from 0 to 4, provided that:
[1070] (i) q and r cannot both be 0; and
[1071] (ii) s, t and v cannot all be 0 at the same time;
[1072] Z represents the oligonucleotide moiety.
[1073] 70. The method according to statement 68, preparing the compound according to any one of statements 20, 25, 27, 29, 54, 56 and / or the composition according to any one of statements 30, 31, 57, 58, wherein:
[1074] The compound of formula (XII) is of formula (XIIa):
[1075]
[1076] The compound of formula (XIII) is of formula (XIIIa):
[1077]
[1078] The oligonucleotide includes an RNA duplex containing a first strand and a second strand, wherein the first strand is at least partially complementary to the RNA sequence of the target gene, the second strand is at least partially complementary to the first strand, both the first strand and the second strand have a 5' end and a 3' end, and wherein the RNA duplex is linked to an adjacent phosphate ester at the 5' end of its second strand.
[1079] 71. The method according to statement 68, preparing the compound according to any one of statements 20, 25, 28, 29, 55, 56 and / or the composition according to any one of statements 30, 31, 57, 58, wherein:
[1080] The compound of formula (XII) is of formula (XIIb):
[1081]
[1082] Furthermore, the compound of formula (XIII) is of formula (XIIIa):
[1083]
[1084] The oligonucleotide comprises an RNA duplex containing a first strand and a second strand, wherein the first strand is at least partially complementary to the RNA sequence of the target gene, the second strand is at least partially complementary to the first strand, wherein the first strand and the second strand each have a 5' end and a 3' end, and wherein the RNA duplex is attached to an adjacent phosphate ester at the 5' end of its second strand.
[1085] 72. The method according to statement 68, preparing the compound according to any one of statements 21, 26, 32, 34, 59, 61 and / or the composition according to any one of statements 35, 36, 62, 63, wherein:
[1086] The compound of formula (XII) is of formula (XIIc):
[1087]
[1088] Furthermore, the compound of formula (XIII) is of formula (XIIIa):
[1089]
[1090] The oligonucleotide includes an RNA duplex containing a first strand and a second strand, wherein the first strand is at least partially complementary to the RNA sequence of the target gene, the second strand is at least partially complementary to the first strand, wherein both the first strand and the aA second strand have a 5' end and a 3' end, and wherein the RNA duplex is linked to an adjacent phosphate ester at the 3' end of its second strand.
[1091] 73. The method according to statement 68, preparing the compound according to any one of statements 21, 26, 33, 34, 60, 61 and / or the composition according to any one of statements 35, 36, 62, 63, wherein:
[1092] The compound of formula (XII) is of formula (XIId):
[1093]
[1094] The compounds of formula (XIId) and formula (XIII) are of formula (XIIIa):
[1095]
[1096] The oligonucleotide includes an RNA duplex containing a first strand and a second strand, wherein the first strand is at least partially complementary to the RNA sequence of the target gene, the second strand is at least partially complementary to the first strand, wherein both the first strand and the second strand have a 5' end and a 3' end, and wherein the RNA duplex is linked to an adjacent phosphate ester at the 3' end of its second strand.
[1097] 74. The method according to any one of statements 70 to 73, wherein:
[1098] The compound of formula (XIIIa) is of formula (XIIIb):
[1099]
[1100] 75. The method described in statement 69 is subordinate to statements 70 through 73, wherein:
[1101] Compounds of formula (XIV) are of formula (XIVa) or formula (XIVb):
[1102]
[1103] Furthermore, compounds of formula (XV) are of formula (XVa) or formula (XIVb):
[1104]
[1105] The oligonucleotide comprises an RNA duplex containing a first strand and a second strand, wherein the first strand is at least partially complementary to the RNA sequence of the target gene, and the second strand is at least partially complementary to the first strand, wherein both the first strand and the second strand have a 5' end and a 3' end, and wherein (i) the RNA duplex is linked at the 5' end of its second strand to an adjacent phosphate ester of formula (XVb), or (ii) the RNA duplex is linked at the 3' end of its second strand to an adjacent phosphate ester of formula (XVb).
[1106] 76. Compound of formula (XII):
[1107]
[1108] in:
[1109] R1 is selected independently from hydrogen, methyl, and ethyl each time it appears;
[1110] R2 is selected from hydrogen, hydroxyl group, -OC. 1-3 Alkyl group, -C(=O)OC 1-3 Alkyl, halogen, and nitro groups;
[1111] X1 and X2 are each independently selected from methylene, oxygen, and sulfur when they appear;
[1112] q, r, s, t, v are independent integers from 0 to 4, provided that:
[1113] (i) q and r cannot both be 0; and
[1114] (ii) s, t and v cannot all be 0 at the same time; Z is the oligonucleotide moiety.
[1115] 77. Compound of formula (XIIa):
[1116]
[1117] 78. Compound of formula (XIIb):
[1118]
[1119] 79. Compound of formula (XIIc):
[1120]
[1121] 80. Compounds of formula (XIId):
[1122]
[1123] 81. Compound of formula (XIII):
[1124]
[1125]
[1126] in:
[1127] R1 is independently selected from hydrogen, methyl, and ethyl in each occurrence;
[1128] m is an integer from 1 to 6;
[1129] n is an integer from 1 to 10.
[1130] 82. Compound of formula (XIIIa):
[1131]
[1132] 83. Compound of formula (XIIIb):
[1133]
[1134] 84. Compound of formula (XIV):
[1135]
[1136] in:
[1137] R1 is selected from hydrogen, methyl, and ethyl;
[1138] R2 is selected from hydrogen, hydroxyl group, -OC. 1-3 Alkyl group, -C(=O)OC 1-3 Alkyl, halogen, and nitro groups;
[1139] X2 is selected from methylene, oxygen, and sulfur;
[1140] s, t, and v are integers from 0 to 4, but s, t, and v cannot all be 0 at the same time. 85. Compound of formula (XIVa):
[1141]
[1142] 86. Compound of formula (XIVb):
[1143]
[1144] Compound of formula (XV):
[1145]
[1146] in:
[1147] R1 is selected independently from hydrogen, methyl, and ethyl each time it appears;
[1148] X1 is selected from methylene, oxygen, and sulfur;
[1149] q and r are independent integers from 0 to 4, but q and r cannot both be 0 at the same time;
[1150] Z is the oligonucleotide moiety.
[1151] 88. Compounds of formula (XVa):
[1152]
[1153] 89. Compounds of formula (XVb):
[1154]
[1155] 90. Use of the compound of any one of statements 76, 81 to 84, 87 in the preparation of the compound of any one of statements 1 to 29, 32 to 34, 37 to 56, 59 to 61 and 64 to 67 and / or the composition of any one of statements 30, 31, 35, 36, 57, 58, 62 and 63.
[1156] 91. Use of the compound described in statement 85 in the preparation of the compound described in any one of statements 1 to 29, 32 to 34, 37 to 56, 59 to 61 and 64 to 67, and / or the composition described in any one of statements 30, 31, 35, 36, 57, 58, 62 and 63, wherein R2 = F.
[1157] 92. Use of the compound described in statement 86 in the preparation of any one of the compounds described in statements 1 to 29, 32 to 34, 37 to 56, 59 to 61 and 64 to 67 and / or any one of the compositions described in statements 30, 31, 35, 36, 57, 58, 62 and 63, wherein R2 = OH.
[1158] 93. Use of the compound described in statement 77 in the preparation of the compound described in any one of statements 20, 25, 27, 29, 54, 56 and / or the composition described in any one of statements 30, 31, 57, 58.
[1159] 94. Use of the compound described in statement 78 in the preparation of the compound described in any one of statements 20, 25, 28, 29, 55, 56 and / or the composition described in any one of statements 30, 31, 57, 58.
[1160] 95. Use of the compound described in statement 79 in the preparation of the compound described in any one of statements 21, 26, 32, 34, 59, 61 and / or the composition described in any one of statements 35, 36, 62, 63.
[1161] 96. Use of the compound described in statement 80 in the preparation of the compound described in any one of statements 21, 26, 33, 34, 60, 61 and / or any one of the compositions described in statements 35, 36, 62, 63.
[1162] 97. Use of the compound described in statement 88 in the preparation of the compound described in any one of statements 20, 25, 27 to 29, 54 to 56 and / or the composition described in any one of statements 30, 31, 57, 58.
[1163] 98. Use of the compound described in statement 89 in the preparation of the compound described in any one of statements 21, 26, 32 to 34, 59 to 61 and / or the composition described in any one of statements 35, 36, 62, 63.
[1164] 99. A compound or composition that is obtained or available by any one of statements 68 to 75.
[1165] 100. A pharmaceutical composition comprising a compound as described in any one of statements 1 to 29, 32 to 34, 37 to 56, 59 to 61 and 64 to 67 and / or a composition as described in any one of statements 30, 31, 35, 36, 57, 58, 62 and 63, and a pharmaceutically acceptable carrier, diluent or excipient.
[1166] 101. Use in treatment of the compounds of any one of statements 1 to 29, 32 to 34, 37 to 56, 59 to 61 and 64 to 67 and / or the compositions of any one of statements 30, 31, 35, 36, 57, 58, 62 and 63.
[1167] In another aspect, this application can be applied to the compounds, methods, compositions, or uses described in items 1-56 below, wherein references to any formula in any item refer only to those formulas defined in items 1-56. These formulas are in Figure 7 Reproduced in [the text]. Specifically, the oligonucleotide moiety represented by Z in any of the following claims may comprise a nucleic acid for inhibiting SLC25A5 expression as defined in any subsequent claim.
[1168] 1. A compound comprising the following structure:
[1169]
[1170] in:
[1171] r and s are independent integers selected from 1 to 16; and
[1172] Z represents the oligonucleotide moiety.
[1173] 2. The compound according to item 1, wherein s is a 2-integer selected from 4 to 1.
[1174] 3. The compound according to item 2, wherein s is 6.
[1175] 4. The compound according to any one of items 1 to 3, wherein r is selected from integers 4 to 14.
[1176] 5. The compound according to item 4, wherein r is 6.
[1177] 6. The compound according to item 4, wherein r is 12.
[1178] 7. The compound described in item 5 is subordinate to item 3.
[1179] 8. The compound described in item 6 is subordinate to item 3.
[1180] 9. The compound according to any one of items 1 to 8, wherein Z is:
[1181]
[1182] in:
[1183] Z1, Z2, Z3, and Z4 each appear independently as either oxygen or sulfur; and
[1184] One of the bonds between P and Z2, and between P and Z3, is a single bond, while the other bond is a double bond.
[1185] 10. The compound according to any one of claims 1 to 9, wherein the oligonucleotide is an RNA compound capable of regulating, preferably, inhibiting, the expression of a target gene.
[1186] 11. The compound according to any one of claims 10, wherein the RNA compound comprises an RNA duplex containing a first strand and a second strand, wherein the first strand is at least partially complementary to the RNA sequence of the target gene, the second strand is at least partially complementary to the first strand, and wherein the first strand and the second strand each have a 5' end and a 3' end.
[1187] 12. The compound according to item 11, preferably also belonging to items 3 and 6, wherein the RNA compound is linked to an adjacent phosphate ester at the 5' end of its second strand.
[1188] 13. The compound according to item 11, preferably also belonging to items 3 and 5, wherein the RNA compound is linked to an adjacent phosphate ester at the 3' end of its second strand.
[1189] 14. Compounds of formula (II*), preferably belonging to item 12:
[1190]
[1191] 15. Compounds of formula (III*), preferably belonging to clause 13:
[1192]
[1193] 16. The compound as defined in any one of items 1 to 15, wherein the oligonucleotide comprises an RNA duplex, said RNA duplex further comprising one or more riboses modified at the 2' position, preferably multiple riboses modified at the 2' position.
[1194] 17. The compound according to claim 16, wherein the modification is selected from 2'-O-methyl, 2'-deoxy-fluorine, and 2'-deoxy.
[1195] 18. The compound according to any one of claims 1 to 17, wherein the oligonucleotide further comprises one or more degradation-protecting moieties at one or more ends.
[1196] 19. The compound according to claim 18, wherein the one or more degradation-protecting moieties are not present at the end of the oligonucleotide chain carrying the linker / ligand moieties, and / or wherein the one or more degradation-protecting moieties are selected from thiophosphate nucleoside inter-linked bonds, dithiophosphate nucleoside inter-linked bonds, and inverted abasic nucleosides, wherein the inverted abasic nucleosides are present at the distal end of the same chain, the end of which carries the linker / ligand moieties.
[1197] 20. The compound according to any one of items 1 to 19, wherein the ligand portion represented by formula (I*) in item 1 comprises one or more ligands.
[1198] 21. The compound according to claim 20, wherein the ligand portion represented by formula (I*) in claim 1 comprises one or more carbohydrate ligands.
[1199] 22. The compound according to claim 21, wherein the one or more carbohydrates may be monosaccharides, disaccharides, trisaccharides, tetrasaccharides, oligosaccharides or polysaccharides.
[1200] 23. The compound according to claim 22, wherein the one or more carbohydrates comprise one or more galactose moieties, one or more lactose moieties, one or more N-acetylgalactosamine moieties, and / or one or more mannose moieties.
[1201] 24. The compound according to claim 23, wherein the one or more carbohydrates comprise one or more N-acetylgalactosamine moieties.
[1202] 25 The compound according to item 24 comprises two or three N-acetylgalactosamine moieties.
[1203] 26. The compound according to any one of the preceding claims, wherein the one or more ligands are connected in a linear or branched configuration.
[1204] 27. The compound according to claim 26, wherein the one or more ligands are connected in a biantennary or triantennary branched configuration.
[1205] 28. The compound according to items 20 to 27, wherein the portion as shown in formula (I*) in item 1:
[1206]
[1207] It can be any one of formula (IV*), (V*) or (VI*), preferably formula (IV*):
[1208]
[1209] in:
[1210] A I It is hydrogen, or a suitable hydroxyl protecting group;
[1211] a is an integer, either 2 or 3; and
[1212] b is an integer from 2 to 5; or
[1213]
[1214] in:
[1215] A I It is hydrogen, or a suitable hydroxyl protecting group;
[1216] a is an integer, either 2 or 3; and
[1217] c and d are independent integers from 1 to 6; or
[1218]
[1219] in:
[1220] A I The protecting group is hydrogen or a suitable hydroxyl group;
[1221] a is an integer, either 2 or 3;
[1222] e is an integer from 2 to 10.
[1223] 29. The compound according to any one of items 1 to 28, wherein the portion as shown by formula (I*) in item 1:
[1224]
[1225] For equation (VII*):
[1226]
[1227] in:
[1228] A I It is hydrogen;
[1229] a is an integer, either 2 or 3.
[1230] 30. The compound according to item 28 or 29, wherein a = 2.
[1231] 31. The compound according to item 28 or 29, wherein a = 3.
[1232] 32. The compound according to item 28, wherein b = 3.
[1233] 33. Compound of formula (VIII*):
[1234]
[1235] 34. Compounds of formula (IX*):
[1236]
[1237] 35. The compound according to claim 33 or 34, wherein the oligonucleotide comprises an RNA duplex, the RNA duplex further comprising one or more riboses modified at the 2' position, preferably multiple riboses modified at the 2' position.
[1238] 36. The compound according to claim 35, wherein the modification is selected from 2'-O-methyl, 2'-deoxy-fluorine, and 2'-deoxy.
[1239] 37. The compound according to any one of claims 33 to 36, wherein the oligonucleotide further comprises one or more degradation-protecting moieties at one or more ends.
[1240] 38. The compound according to claim 37, wherein the one or more degradation-protecting moieties are not present at the end of the oligonucleotide chain carrying the linker / ligand moieties, and / or wherein the one or more degradation-protecting moieties are selected from thiophosphate nucleoside inter-linked bonds, dithiophosphate nucleoside inter-linked bonds, and inverted abasic nucleosides, wherein the inverted abasic nucleosides are present at the distal end of the same chain, the end of which carries the linker / ligand moieties.
[1241] 39. The compound of claim 33, wherein the oligonucleotide comprises an RNA duplex containing a first strand and a second strand, wherein the first strand is at least partially complementary to the RNA sequence of the target gene, the second strand is at least partially complementary to the first strand, wherein the first strand and the second strand each have a 5' end and a 3' end, and wherein the RNA duplex is linked to an adjacent phosphate ester at the 5' end of its second strand.
[1242] 40. The compound of claim 34, wherein the oligonucleotide comprises an RNA duplex containing a first strand and a second strand, wherein the first strand is at least partially complementary to the RNA sequence of the target gene, the second strand is at least partially complementary to the first strand, wherein the first strand and the second strand each have a 5' end and a 3' end, and wherein the RNA duplex is linked to an adjacent phosphate ester at the 3' end of its second strand.
[1243] 41. A method for preparing a compound according to any one of claims 1 to 40, the method comprising reacting a compound of formula (X*) and formula (XI*):
[1244]
[1245] in:
[1246] r and s are independent integers from 1 to 16; and
[1247] Z is the oligonucleotide moiety;
[1248] And, where appropriate, perform ligand deprotection and / or annealing of the second chain of the oligonucleotide moiety.
[1249] 42. The method according to claim 41, to prepare the compound according to any one of claims 6, 8 to 14, 16 to 33 and 35 to 40, wherein:
[1250] Compound of formula (X*) is of formula (Xa*):
[1251]
[1252] Furthermore, the compound of formula (XI*) is of formula (XIa*):
[1253]
[1254] The oligonucleotide includes an RNA duplex containing a first strand and a second strand, wherein the first strand is at least partially complementary to the RNA sequence of the target gene, the second strand is at least partially complementary to the first strand, both the first strand and the second strand have a 5' end and a 3' end, and wherein the RNA duplex is linked to an adjacent phosphate ester at the 5' end of its second strand.
[1255] 43. The method according to claim 41, preparing the compound according to any one of claims 5, 7, 9 to 13, 15 to 32 and 34 to 40, wherein:
[1256] Compound of formula (X*) is of formula (Xb*):
[1257]
[1258] Furthermore, the compound of formula (XI*) is of formula (XIa*):
[1259]
[1260] The oligonucleotide includes an RNA duplex containing a first strand and a second strand, wherein the first strand is at least partially complementary to the RNA sequence of the target gene, the second strand is at least partially complementary to the first strand, both the first strand and the second strand have a 5' end and a 3' end, and wherein the RNA duplex is linked to an adjacent phosphate ester at the 3' end of its second strand.
[1261] 44. The method according to item 42 or 43, wherein:
[1262] Compound of formula (XIa*) is of formula (XIb*):
[1263]
[1264] 45. Compound of formula (X*):
[1265]
[1266]
[1267] in:
[1268] r is an integer from 1 to 16 independently; and Z is the oligonucleotide moiety.
[1269] 46. Compound of formula (Xa*):
[1270]
[1271] 47. Compounds of formula (Xb*):
[1272]
[1273] Compound 48 (XI*):
[1274]
[1275] in:
[1276] s is an integer from 1 to 16 independently; and Z is the oligonucleotide moiety.
[1277] 49. Compounds of formula (XIa*):
[1278]
[1279] 50. Compounds of formula (XIb*):
[1280]
[1281] 51. Use of the compound of any one of items 45 and 48 to 50 in the preparation of the compound of any one of items 1 to 40.
[1282] 52. Use of the compound described in item 46 in the preparation of the compound described in any one of items 6, 8 to 14, 16 to 33 and 35 to 40.
[1283] 53. Use of the compound described in item 47 in the preparation of the compound described in any one of items 5, 7, 9 to 13, 15 to 32 and 34 to 40.
[1284] 54. A compound or composition that is obtained or available by any one of items 41 to 44.
[1285] 55. A pharmaceutical composition comprising any one of claims 1 to 40, and a pharmaceutically acceptable carrier, diluent, or excipient.
[1286] Use of the compound according to any one of items 1 to 40 in treatment. Example
[1287] This application can be more fully understood by referring to the following embodiments. However, they should not be construed as limiting the scope of this application. It should be understood that the embodiments and implementations described herein are for illustrative purposes only, and those skilled in the art can make various modifications or changes based on them, and all such modifications or changes should be included within the spirit and scope of this application and the appended claims.
[1288] Example 1 - Target Identification
[1289] background
[1290] All biological functions originate from the cooperative interactions of hundreds of interacting molecules (mainly proteins) and can be considered as the emergent functional outcome of a protein-protein interaction network, where each node in the network is a protein and each edge connecting proteins can represent a range of possible interaction types, from complex formation to catalytic activation.
[1291] Historically, these functions have been described as simple linear pathways. However, with the growth of knowledge, it has become clear that pathways are more complex, and networks represent the minimum level of complexity that can adequately represent the functional characteristics of biological processes and capture features of resilience to disturbances and robustness to random damage to individual components.
[1292] Networks serving biological functions may consist of several interacting typical pathways and additional proteins that primarily participate when typical functions are disrupted. Therefore, it is crucial to develop methods that can model this complexity in a meaningful and tractable manner, and to generate target hypotheses that take into account the inherent resistance to denaturation of the network.
[1293] Oversimplification in biology and the failure to make reasonable drug target selections based on realistic biological process models contribute to low drug discovery success rates. Furthermore, there is a lack of rigorous, objective methods for building network models of processes and prioritizing protein targets within these models. Therefore, target selection decisions are often made ad hoc based on preferences or evidence unrelated to functional models.
[1294] Methods for identifying processes and targets
[1295] The identification of the target SLC25A5 / ANT2 began with HepNet, a proprietary computational platform for drug target identification and validation in hepatocytes. Two independent approaches were used to identify SLC25A5 / ANT2. The first approach utilized omics data to identify the target for non-alcoholic fatty liver disease (NAFLD) from experimental data through a genome-wide association study (GWAS) meta-analysis. The second approach utilized the HepNet knowledge graph, a semantic network that describes the interactions between entities such as genes, drugs, diseases, and / or biological processes in the context of hepatocytes.
[1296] For GWAS-based methods, meta-analysis requires quality control based on sample size, target population, and the quality of statistical analysis. More specifically, a sample size exceeding 1,000 was used as a cutoff, and SNPs were continued if the p-value reflected multiple test correction. Ultimately, sex-linked and all-ancestry SNPs (Continental Europe, UK, others) were selected; SNPs with sex-specific significance were excluded.
[1297] The selected GWAS is used to extract SNPs that are strongly associated with the features of interest, in which case this application is for the pathophysiology of NAFLD and related metabolic disorders (e.g., NAFLD and cardiovascular metabolic disease or steatosis and NAFLD risk).
[1298] Subsequently, SNPs were mapped to genes using Variant-to-Gene (V2G) pipeline data from Open Targets Genetics (https: / / genetics.opentargets.org / ). More specifically, for each SNP of interest, the gene with the highest score based on the V2G pipeline (or multiple genes, if the highest score is shared) and genes with scores higher than 0.2 were selected.
[1299] This generates a genome that can be used as input, which utilizes a proprietary algorithm (Algorithm A) to construct a protein-protein interaction network. The resulting network is then subjected to influence analysis (Algorithm B) to identify enriched biological processes within the network. These processes are then manually evaluated by an internal team to identify the biological processes most relevant to NAFLD target identification.
[1300] A protein-protein interaction network was then built around the selected processes, and nodes were scored using a proprietary algorithm (Algorithm C) to assess their importance to the network. The internal team then manually evaluated the highest-scoring nodes in Algorithm C to identify target therapies for NAFLD metabolic diseases.
[1301] For knowledge graph-based approaches, machine learning algorithms are used to predict interactions between genes and diseases based on the structure of the knowledge graph; this task is often referred to as "link prediction." This generates genomes that can be used for network-based target identification using the proprietary algorithm AC described above. The networks and other outputs derived from these algorithms differ from those generated based on GWAS analysis and are evaluated by different internal teams.
[1302] Both analyses independently identified ANT2 / SLC25A5 as an important node involved in the biological process of "adipogenesis / non-alcoholic fatty liver" (referred to as supercluster 574 in Algorithm B).
[1303] Therefore, the inventors analyzed these network models using proprietary analytical methods. These methods use directional information to capture key “target” attributes, such as whether a protein is an integrator of information, a key conduit for information to other parts of the network, an influencer of key proteins, and the degree to which influencers are influenced by or influence other proteins (based on the absolute and relative quantities of inputs and outputs, and direction). Directional information can also infer hierarchical relationships between proteins. Proteins at higher levels and possessing certain attributes may be more favored than proteins with similar attributes in other aspects. The relative specificity and magnitude of each attribute relative to others allows the inventors to score and rank them from the perspective of protein target suitability.
[1304] The ability to characterize the properties of these targets through network relationships can determine the selectivity and magnitude of effects in the selected environment, thereby determining the applicability of each target to a given instruction.
[1305] Proprietary analysis techniques are then applied to the network model to identify pharmacologically viable targets from within the network. Knockdown of these targets will have a significant impact on the network and, consequently, on the biological function being modeled. The algorithm extensively utilizes directional information and hierarchical relationships to identify targets with a range of specific attributes that make them promising siRNA targets. Targets are then further screened based on protein class and hepatocyte-specific properties, according to therapeutic needs.
[1306] The above workflow makes full use of proprietary data resources and network node metrics to identify the specific uses of the targets provided.
[1307] The results of the network approach are shown in Table 6. Surprisingly, ANT2 was identified as a drug target for NAFLD, along with various other targets previously associated with metabolic disorders, such as NAFLD-related targets (APOA5, HMDH, APOC3, NR1H3, MTP, PCSK9, SOAT1, and ABCA1).
[1308] Table 6
[1309] Protein name Login ID NAFLD Predicted Score Ranking of Hepatocyte Expression Abundance APOA5 Q6Q788 93.6 0.46 HMDH P04035 91.3 0.54 APOC3 P02656 91.2 0.95 NR1H3 Q13133 91.1 0.22 MTP P55157 88.1 0.96 ANT2 P05141 80 0.98 PCSK9 Q8NBP7 79.3 0.21 SOAT1 P35610 77.7 0.27 ABCA1 O095477 77.0 0.46
[1310] Example 2: Synthetic chain 1
[1311] General experimental conditions:
[1312] Thin-layer chromatography (TLC) was performed on silica-coated aluminum plates using a 254 nm fluorescent indicator from Macherey-Nagel. The compounds were visualized by spraying with methanol (MeOH) or ninhydrin containing 5% H₂SO₄ according to the Stahl method (from Sigma-Aldrich), followed by heating. The Biotage Isolera One rapid chromatograph equipped with a bivariate UV wavelength detector (200–400 nm) was used. Rapid chromatography was performed using Silica 10, 25, 50 or 100 g columns (Uppsala, Sweden).
[1313] All humidity-sensitive reactions were performed under anhydrous conditions using dry glassware, anhydrous solvents, and an argon atmosphere. All commercially available reagents were purchased from Sigma-Aldrich, and solvents from Carl Roth GmbH+Co.KG. D-galactosamine pentaacetate was purchased from AK Scientific.
[1314] The mass spectrometer was operated on a Dionex UltiMate 3000RS UHPLC system and a Thermo Scientific MSQ Plus Mass spectrometer, using a Waters Acquity UPLC Protein BEH C4 column. HPLC / ESI-MS was performed at 60 °C using a 1.7 μm, 2.1 x 100 mm lens. The solvent system consisted of solvent A (H₂O containing 0.1% formic acid) and solvent B (acetonitrile (ACN) containing 0.1% formic acid). A flow rate of 0.4 mL / min was used, with solvent B gradients from 5% to 100% over 15 min. Detector and conditions: Corona overcharged electrosol detector (from ESA). Nebulizer temperature: 25 °C. N₂ pressure: 35.1 psi. Filter: Corona.
[1315] Using a Varian spectrometer at room temperature at 500 MHz (¹H NMR) and 125 MHz (¹H NMR) 13 (C NMR) records 1H and 13CNMR spectra. Chemical shifts are in ppm, with reference to solvent residue peaks (CDCl3–1H NMR:δ at 7.26 ppm and at 77.2 ppm). 13 C NMR δ; DMSO-d6–1H NMR δ at 2.50 ppm, and at 39.5 ppm 13 C NMR (δ). The coupling constant is in Hertz. The signal splitting mode is described as a single peak (s), double peak (d), triple peak (t), or multiple peak (m).
[1316] Synthetic route of the conjugated building block TriGalNAc_system 1:
[1317]
[1318] Preparation of Compound 2: D-galactosamine pentaacetate (3.00 g, 7.71 mmol, 1.0 eq.) was dissolved in anhydrous dichloromethane (DCM) (30 mL) under an argon atmosphere, and trimethylsilyl trifluoromethanesulfonate (TMSOTf, 4.28 g, 19.27 mmol, 2.5 eq.) was added. The reaction was stirred at room temperature for 3 h. The reaction mixture was diluted with DCM (50 mL) and washed with cold saturated aqueous solution of NaHCO3 (100 mL) and water (100 mL). The organic layer was separated, dried over Na2SO4, and concentrated to give a yellow oily title compound, which was purified by rapid chromatography (gradient elution: 0-10% MeOH in DCM within 10 CV). A colorless oily product (2.5 g, 98%, rf = 0.45 (2% MeOH in DCM)) was given.
[1319]
[1320] Preparation of compound 4: Compound 2 (2.30 g, 6.98 mmol, 1.0 eq.) and azide-PEG3-OH (1.83 g, 10.5 mmol, 1.5 eq.) were dissolved in anhydrous DCM (40 mL) under an argon atmosphere, and molecular sieves were added to the solution. (5 g). The mixture was stirred at room temperature for 1 h. Then TMSOTf (0.77 g, 3.49 mmol, 0.5 eq.) was added to the mixture and the reaction was stirred overnight. The mixture was filtered through a molecular sieve, and the filtrate was diluted with DCM (100 mL) and washed with cold saturated aqueous solution of NaHCO3 (100 mL) and water (100 mL). The organic layer was separated, dried over Na2SO4, and the solvent was removed under reduced pressure. The crude product was purified by rapid chromatography (gradient elution: 0-3% MeOH in DCM within 10 CV) to give the title product (3.10 g, 88%, rf = 0.25 (2% MeOH in DCM)) as a pale yellow oil. MS: C 20 H 32 N4O 11 The calculated value is 504.21. The measured value is 505. 4.1H NMR (500MHz, CDCl3) δ 6.21-6.14 (m, 1H), 5.30 (dd, J=3.4, 1.1Hz, 1H), 5.04 (dd, J=11.2, 3.4Hz, 1H), 4.76 (d, J=8.6Hz, 1H), 4.23-4.08 (m, 3H), 3.91-3.80 (m, 3H), 3.74-3.59 (m, 9H), 3.49-3.41 (m, 2H), 2.14 (s, 3H), 2.02 (s, 3H), 1.97 (d, J=4.2Hz, 6H). 13C NMR(125MHz, CDCl3)δ170.6(C),170.5(C),170.4(C),170.3(C),102.1(CH),71.6(CH),70.8(CH),70.6 (CH),70.5(CH),70.3(CH2),69.7(CH2),68.5(CH2),66.6(CH2),61.5(CH2),23.1(CH3),20.7(3xCH3).
[1321]
[1322] Preparation of Compound 5: Compound 4 (1.00 g, 1.98 mmol, 1.0 eq.) was dissolved in a mixture of ethyl acetate (EtOAc) and MeOH (30 mL, 1:1 v / v), and Pd / C (100 mg) was added. The reaction mixture was degassed using a vacuum / argon circulation (3x) and hydrogenated overnight under balloon pressure. The reaction mixture was filtered through diatomaceous earth and washed with EtOAc (30 mL). The solvent was removed under reduced pressure to give the title compound (0.95 g, quantitative yield, rf = 0.25 (10% MeOH in DCM)). This compound was ready for use without further purification. MS: C 20 H 34N2O 11 The calculated value is 478.2. The measured value is 479.4.
[1323]
[1324] Preparation of Compound 7: Tris{[2-(tert-butoxycarbonyl)ethoxy]methyl}-methylamine 6 (3.37 g, 6.67 mmol, 1.0 eq.) was dissolved in a DCM / water mixture (40 mL, 1:1 v / v), and Na₂CO₃ (0.18 g, 1.7 mmol, 0.25 eq.) was added under vigorous stirring. Benzyl chloroformate (2.94 mL, 20.7 mmol, 3.10 eq.) was added dropwise to the previous mixture, and the reaction was stirred at room temperature for 24 h. The reaction mixture was diluted with CH₂Cl₂ (100 mL) and washed with water (100 mL). The organic layer was separated and dried over Na₂SO₄. The solvent was removed under reduced pressure, and the crude product was purified by rapid chromatography (gradient elution: 0-10% EtOAc in cyclohexane within 12 CV) to give the title compound (3.9 g, 91%, rf = 0.56 (10% EtOAc in cyclohexane)). MS: C 33 H 53 NO 11 The calculated value is 639.3. The measured value is 640. 9.1H NMR (500MHz, DMSO-d6) δ 7.38-7.26 (m, 5H), 4.97 (s, 2H), 3.54 (t, 6H), 3.50 (s, 6H), 2.38 (t, 6H), 1.39 (s, 27H). 13C NMR (125MHz, DMSO-d6) δ 170.3 (3xC), 154.5 (C), 137.1 (C), 128.2 (2xCH), 127.7 (CH), 127.6 (2xCH), 79.7 (3xC), 68.4 (3xCH2), 66.8 (3xCH2), 64.9 (C), 58.7 (CH2), 35.8 (3xCH2), 27.7 (9xCH3).
[1325]
[1326] Preparation of Compound 8: Cbz-NH-tri-Boc-ester 7 (0.20 g, 0.39 mmol, 1.0 eq.) was dissolved in CH2Cl2 (1 mL) under an argon atmosphere, and trifluoroacetic acid (TFA, 1 mL) was added. The reaction was stirred at room temperature for 1 h. The solvent was removed under reduced pressure, and the residue was co-evaporated three times with toluene (5 mL) and dried under high vacuum to obtain the TFA salt of the compound (0.183 g, 98%). This compound can be used without further purification. MS: C21 H 29 NO 11 The calculated value is 471.6. The measured value is 472.4.
[1327]
[1328] Preparation of compound 9: CbzNH-tris-COOH 8 (0.72 g, 1.49 mmol, 1.0 eq.) and GalNAc-PEG3-NH25 (3.56 g, 7.44 mmol, 5.0 eq.) were dissolved in N,N-dimethylformamide (DMF) (25 mL). Then, N,N,N′,N′-tetramethyl-O-(1H-benzotriazol-1-yl)urea hexafluorophosphate (HBTU) (2.78 g, 7.44 mmol, 5.0 eq.), 1-hydroxybenzotriazole hydrate (HOBt) (1.05 g, 7.44 mmol, 5.0 eq.) and N,N-diisopropylethylamine (DIPEA) (2.07 mL, 11.9 mmol, 8.0 eq.) were added, and the reaction was stirred for 72 h. The solvent was removed under reduced pressure, and the residue was dissolved in DCM (100 mL) and washed with a saturated aqueous solution of NaHCO3 (100 mL). The organic layer was dried over Na2SO4, the solvent was evaporated, and the crude product was purified by rapid chromatography (gradient elution: 0-5% MeOH in DCM within 14 CV). A pale yellow oily product was obtained (1.2 g, 43%, rf = 0.20 (5% MeOH in DCM)). MS: C 81 H 125 N7O 41The calculated value is 1852.9. The measured value is 1854. 7.1H NMR (500MHz, DMSO-d6) δ 7.90-7.80 (m, 10H), 7.65-7.62 (m, 4H), 7.47-7.43 (m, 3H), 7.38-7.32 (m, 8H), 5.24-5.22 (m, 3H), 5.02-4.97 (m, 4H), 4.60-4.57 (m, 3H), 4.07-3.90 (m 10H), 3.67-3.36 (m, 70H), 3.23-3.07 (m, 25H), 2.18 (s, 10H), 2.00 (s, 13H), 1.89 (s, 11H), 1.80-1.78 (m, 17H). 13C NMR(125MHz,DMSO-d6)δ170.1(C),169.8(C),169.7(C),169.4(C),169.2(C), 169.1(C),142.7(C),126.3(CH),123.9(CH),118.7(CH),109.7(CH),100.8(CH ),70.5(CH),69.8(CH),69.6(CH),69.5(CH),69.3(CH2),69.0(CH2),68.2(CH2 ),67.2(CH2),66.7(CH2),61.4(CH2),22.6(CH2),22.4(3xCH3),20.7(9xCH3).
[1329]
[1330] Preparation of Compound 10: Trianthopteran GalNAc compound 9 (0.27 g, 0.14 mmol, 1.0 eq.) was dissolved in MeOH (15 mL), and 3 drops of acetic acid (AcOH) and Pd / C (30 mg) were added. The reaction mixture was degassed using a vacuum / argon cycle (3x) and hydrogenated overnight under balloon pressure. The completion of the reaction was monitored by mass spectrometry, and the resulting mixture was filtered through a thin diatomaceous earth pad. The solvent was evaporated, and the residue was dried under high vacuum. The residue was ready for use in the next step without further purification. A pale yellow oily product (0.24 g, quantitative yield) was obtained. MS: C 73 H 119 N7O 39 The calculated value is 1718.8. The measured value is 1719.3.
[1331]
[1332] Preparation of Compound 11: Commercially available bis(N-hydroxysuccinimide) octanoic acid (3.67 g, 9.9 mmol, 1.0 eq.) was dissolved in DMF (5 mL), and triethylamine (1.2 mL) was added. A solution of 3-azido-1-propylamine (1.0 g, 9.9 mmol, 1.0 eq) in DMF (5 mL) was added dropwise to this solution. The reaction mixture was stirred at room temperature for 3 h. The reaction mixture was diluted with EtOAc (100 mL) and washed with water (50 mL). The organic layer was separated, dried over Na2SO4, and the solvent was removed under reduced pressure. The crude product was purified by rapid chromatography (gradient elution: 0-5% MeOH in DCM within 16 CV). A white solid product (1.54 g, 43%, rf = 0.71 (5% MeOH in DCM)) was given. MS: C 15 H 23 The calculated value of N5O5 is 353.4. The measured value is 354.3.
[1333]
[1334] Preparation of TriGalNAc(12): Compound 10 (0.35 g, 0.24 mmol, 1.0 eq.) and compound 11 (0.11 g, 0.31 mmol, 1.5 eq.) of TriGalNAc were dissolved in DCM (5 mL) under an argon atmosphere, and triethylamine (0.1 mL, 0.61 mmol, 3.0 eq.) was added. The reaction was stirred overnight at room temperature. The solvent was removed under reduced pressure, and the residue was dissolved in EtOAc (100 mL) and washed with water (100 mL). The organic layer was separated and dried over Na2SO4. The solvent was evaporated, and the crude product was purified by rapid chromatography (elution gradient: 0-10% MeOH in DCM within 20 CV) to give the title compound as a white, fluffy solid (0.27 g, 67%, rf = 0.5 (10% MeOH in DCM)). MS: C 84 H 137 N 11 O 41 The calculated value is 1957.1. The measured value is 1959.6.
[1335] Conjugation of siRNA strand 1: Monofluorocyclooctene (MFCO) conjugated at the 5' or 3' end.
[1336] 5' end MFCO conjugation
[1337]
[1338] 3' end MFCO concatenation
[1339]
[1340] General conditions for MFCO conjugation: Dissolve the amine-modified single chain at 700 OD / mL in 50 mM carbonate / bicarbonate buffer pH 9.6 / dimethyl sulfoxide (DMSO) 4:6 (v / v), and add one molar equivalent of 35 mM MFCO-C6-NHS ester (Berry & Associates, Cat.#LK 4300) in DMF solution. Initiate the reaction at room temperature, and after 1 h, add another molar equivalent of MFCO solution. Continue the reaction for 1 h, monitoring by LC / MS. An excess of at least two molar equivalents of MFCO NHS ester relative to the amine-modified oligonucleotide is required for quantitative consumption of the starting material. Dilute the reaction mixture 15-fold with water, filter through a Sartorius 1.2 μm filter membrane, and then… Purification was performed using a retention phase (RP HPLC) on a Pure instrument (GE Healthcare).
[1341] Purification was performed using a Waters XBridge C18 Prep 19x50 mm column. Buffer A was 100 mM TEAAc pH 7, and buffer B was buffer A containing 95% acetonitrile. The flow rate was 10 mL / min, and the temperature was 60 °C. The UV trajectory at 280 nm was recorded. The gradient was applied from 0 to 100% of buffer B over 60 column volumes.
[1342] The fractions containing full-length conjugated oligonucleotides were collected and precipitated in a refrigerator using 3M NaOAc (pH 5.2) and 85% ethanol. The collected precipitate was then dissolved in water. The sample was desalted by size exclusion chromatography and concentrated using a vacuum centrifuge to obtain conjugated oligonucleotides with a separation yield of 40-80%.
[1343] 5'-GalNAc-T1 conjugate
[1344]
[1345] 3'-GalNAc-T1 conjugate
[1346]
[1347] A general method for TriGalNAc conjugation: The MFCO-modified single chain was dissolved in water at a concentration of 2000 OD / mL, and then a 1-molar equivalent (10 mM) solution of compound 12 in DMF was added to this solution. The reaction was carried out at room temperature, and after 3 hours, a 0.7-molar equivalent solution of compound 12 was added. The reaction was allowed to proceed overnight, and the completion was monitored by LCMS. The conjugate was diluted 15-fold with water, filtered through a Sartorius 1.2 μm filter membrane, and then... Purification was performed by RP HPLC on a Pure instrument (GE Healthcare).
[1348] RP HPLC purification was performed using a Waters XBridge C18 Prep 19x50 mm column. Buffer A was 100 mM triethylamine acetate at pH 7, and buffer B was buffer A containing 95% acetonitrile. The flow rate was 10 mL / min, and the temperature was 60 °C. The UV trajectory at 280 nm was recorded. The gradient was 0 to 100% of B over 60 column volumes.
[1349] The fraction containing the full-length conjugated oligonucleotides was collected and precipitated in a refrigerator with 3M NaOAc (pH 5.2) and 85% ethanol. The collected precipitate was dissolved in water to obtain an oligonucleotide solution with a concentration of approximately 1000 OD / mL. O-acetate was removed by adding 20% ammonia solution. The quantitative removal of these protecting groups was verified by LC-MS.
[1350] exist On a Pure (GE Healthcare) instrument, the conjugates were desalted using size exclusion chromatography with Sephadex G25 Fine resin (GE Healthcare) to obtain conjugated oligonucleotides with a separation yield of 50-70%.
[1351] The following scheme further elaborates on the synthetic route:
[1352] Option 1:
[1353]
[1354] Option 2:
[1355] Option 3:
[1356]
[1357] Option 4:
[1358] Option 5:
[1359]
[1360] Example 3: Double-chain annealing
[1361] The two complementary strands were annealed by mixing equimolar aqueous solutions of the two strands to generate the desired siRNA double strands. The mixture was placed in a water bath at 70°C for 5 min, and then cooled to ambient temperature over 2 h. The double strands were lyophilized for 2 days and stored at -20°C.
[1362] In the Dionex Ultimate 3000 (Thermo Fisher Scientific) HPLC system, analytical SEC HPLC was performed via Superdex. TM Double strands were analyzed using a 75 Increase 5 / 150GL column (5x 153-158 mm, Cytiva). The mobile phase consisted of 1x PBS containing 10% acetonitrile. The flow rate was 1.5 mL / min at room temperature with an isocratic gradient over 10 min. UV trajectories at 260 nm and 280 nm were recorded. Water (LC-MS grade) was purchased from Sigma-Aldrich, and phosphate-buffered saline (PBS; 10x, pH 7.4) was purchased from GIBCO (Thermo Fisher Scientific).
[1363] Example 4: Synthetic chain 2
[1364] General experimental conditions:
[1365] Thin-layer chromatography (TLC) was performed on silica-coated aluminum plates using a 254 nm fluorescent indicator from Macherey-Nagel. The compounds were visualized by spraying with methanol (MeOH) or ninhydrin containing 5% H₂SO₄ according to the Stahl method (from Sigma-Aldrich), followed by heating. The Biotage Isolera One rapid chromatograph equipped with a bivariate UV wavelength detector (200–400 nm) was used. Rapid chromatography was performed using Silica 10, 25, 50 or 100 g columns (Uppsala, Sweden).
[1366] All humidity-sensitive reactions were performed under anhydrous conditions using dry glassware, anhydrous solvents, and an argon atmosphere. All commercially available reagents were purchased from Sigma-Aldrich, and solvents from Carl Roth GmbH+Co.KG. D-galactosamine pentaacetate was purchased from AK Scientific.
[1367] The mass spectrometer was operated on a Dionex UltiMate 3000RS UHPLC system and a Thermo Scientific MSQ Plus Mass spectrometer, using a Waters Acquity UPLC Protein BEH C4 column. HPLC / ESI-MS was performed at 60 °C using a 1.7 μm, 2.1 x 100 mm lens. The solvent system consisted of solvent A (H₂O containing 0.1% formic acid) and solvent B (acetonitrile (ACN) containing 0.1% formic acid). A flow rate of 0.4 mL / min was used, with solvent B gradients from 5% to 100% over 15 min. Detector and conditions: Corona overcharged electrosol detector (from ESA). Nebulizer temperature: 25 °C. N₂ pressure: 35.1 psi. Filter: Corona.
[1368] Using a Varian spectrometer at room temperature at 500 MHz (¹H NMR) and 125 MHz (¹H NMR) 13 (C NMR) records 1H and 13 CNMR spectra. Chemical shifts are in ppm, with reference to solvent residue peaks (CDCl3–1H NMR:δ at 7.26 ppm and at 77.2 ppm). 13 C NMR δ; DMSO-d6–1H NMR δ at 2.50 ppm, and at 39.5 ppm 13 C NMR (δ). The coupling constant is in Hertz. The signal splitting mode is described as a single peak (s), double peak (d), triple peak (t), or multiple peak (m).
[1369] Synthetic route of the conjugated building block TriGalNAc_system 2:
[1370]
[1371] Preparation of Compound 2: D-galactosamine pentaacetate (3.00 g, 7.71 mmol, 1.0 eq.) was dissolved in anhydrous dichloromethane (DCM) (30 mL) under an argon atmosphere, and trimethylsilyl trifluoromethanesulfonate (TMSOTf, 4.28 g, 19.27 mmol, 2.5 eq.) was added. The reaction was stirred at room temperature for 3 h. The reaction mixture was diluted with DCM (50 mL) and washed with cold saturated aqueous solution of NaHCO3 (100 mL) and water (100 mL). The organic layer was separated, dried over Na2SO4, and concentrated to give a yellow oily title compound, which was purified by rapid chromatography (gradient elution: 0-10% MeOH in DCM within 10 CV). A colorless oily product (2.5 g, 98%, rf = 0.45 (2% MeOH in DCM)) was given.
[1372]
[1373] Preparation of compound 4: Compound 2 (2.30 g, 6.98 mmol, 1.0 eq.) and azide-PEG3-OH (1.83 g, 10.5 mmol, 1.5 eq.) were dissolved in anhydrous DCM (40 mL) under an argon atmosphere, and molecular sieves were added to the solution. (5 g). The mixture was stirred at room temperature for 1 h. Then TMSOTf (0.77 g, 3.49 mmol, 0.5 eq.) was added to the mixture and the reaction was stirred overnight. The mixture was filtered through a molecular sieve, and the filtrate was diluted with DCM (100 mL) and washed with cold saturated aqueous solution of NaHCO3 (100 mL) and water (100 mL). The organic layer was separated, dried over Na2SO4, and the solvent was removed under reduced pressure. The crude product was purified by rapid chromatography (gradient elution: 0-3% MeOH in DCM within 10 CV) to give the title product (3.10 g, 88%, rf = 0.25 (2% MeOH in DCM)) as a pale yellow oil. MS: C 20 H 32 N4O 11 The calculated value is 504.21. The measured value is 505. 4.1H NMR (500MHz, CDCl3) δ 6.21-6.14 (m, 1H), 5.30 (dd, J=3.4, 1.1Hz, 1H), 5.04 (dd, J=11.2, 3.4Hz, 1H), 4.76 (d, J=8.6Hz, 1H), 4.23-4.08 (m, 3H), 3.91-3.80 (m, 3H), 3.74-3.59 (m, 9H), 3.49-3.41 (m, 2H), 2.14 (s, 3H), 2.02 (s, 3H), 1.97 (d, J=4.2Hz, 6H). 13C NMR(125MHz, CDCl3)δ170.6(C),170.5(C),170.4(C),170.3(C),102.1(CH),71.6(CH),70.8(CH),70.6 (CH),70.5(CH),70.3(CH2),69.7(CH2),68.5(CH2),66.6(CH2),61.5(CH2),23.1(CH3),20.7(3xCH3).
[1374]
[1375] Preparation of Compound 5: Compound 4 (1.00 g, 1.98 mmol, 1.0 eq.) was dissolved in a mixture of ethyl acetate (EtOAc) and MeOH (30 mL, 1:1 v / v), and Pd / C (100 mg) was added. The reaction mixture was degassed using a vacuum / argon circulation (3x) and hydrogenated overnight under balloon pressure. The reaction mixture was filtered through diatomaceous earth and washed with EtOAc (30 mL). The solvent was removed under reduced pressure to give the colorless oily title compound (0.95 g, quantitative yield, rf = 0.25 (10% MeOH in DCM)). This compound was ready for use without further purification. MS: C 20 H 34 N2O 11 The calculated value is 478.2. The measured value is 479.4.
[1376]
[1377] Preparation of Compound 7: Tris{[2-(tert-butoxycarbonyl)ethoxy]methyl}-methylamine 6 (3.37 g, 6.67 mmol, 1.0 eq.) was dissolved in a mixture of DCM / water (40 mL, 1:1 v / v), and Na₂CO₃ (0.18 g, 1.7 mmol, 0.25 eq.) was added under vigorous stirring. Benzyl chloroformate (2.94 mL, 20.7 mmol, 3.10 eq.) was added dropwise to the previous mixture, and the reaction was stirred at room temperature for 24 h. The reaction mixture was diluted with CH₂Cl₂ (100 mL) and washed with water (100 mL). The organic layer was separated and dried over Na₂SO₄. The solvent was removed under reduced pressure, and the crude product was purified by rapid chromatography (gradient elution: 0-10% EtOAc in cyclohexane within 12 CV) to give the title compound (3.9 g, 91%, rf = 0.56 (10% EtOAc in cyclohexane)). MS: C 33 H 53 NO 11The calculated value is 639.3. The measured value is 640. 9.1H NMR (500MHz, DMSO-d6) δ 7.38-7.26 (m, 5H), 4.97 (s, 2H), 3.54 (t, 6H), 3.50 (s, 6H), 2.38 (t, 6H), 1.39 (s, 27H). 13C NMR (125MHz, DMSO-d6) δ 170.3 (3xC), 154.5 (C), 137.1 (C), 128.2 (2xCH), 127.7 (CH), 127.6 (2xCH), 79.7 (3xC), 68.4 (3xCH2), 66.8 (3xCH2), 64.9 (C), 58.7 (CH2), 35.8 (3xCH2), 27.7 (9xCH3).
[1378]
[1379] Preparation of Compound 8: Cbz-NH-tri-Boc-ester 7 (0.20 g, 0.39 mmol, 1.0 eq.) was dissolved in CH2Cl2 (1 mL) under an argon atmosphere, and trifluoroacetic acid (TFA, 1 mL) was added. The reaction was stirred at room temperature for 1 h. The solvent was removed under reduced pressure, and the residue was co-evaporated three times with toluene (5 mL) and dried under high vacuum to obtain the TFA salt of the compound (0.183 g, 98%). This compound can be used without further purification. MS: C 21 H 29 NO 11 The calculated value is 471.6. The measured value is 472.4.
[1380]
[1381] Preparation of compound 9: CbzNH-tris-COOH 8 (0.72 g, 1.49 mmol, 1.0 eq.) and GalNAc-PEG3-NH25 (3.56 g, 7.44 mmol, 5.0 eq.) were dissolved in N,N-dimethylformamide (DMF) (25 mL). Then, N,N,N′,N′-tetramethyl-O-(1H-benzotriazol-1-yl)urea hexafluorophosphate (HBTU) (2.78 g, 7.44 mmol, 5.0 eq.), 1-hydroxybenzotriazole hydrate (HOBt) (1.05 g, 7.44 mmol, 5.0 eq.) and N,N-diisopropylethylamine (DIPEA) (2.07 mL, 11.9 mmol, 8.0 eq.) were added, and the reaction was stirred for 72 h. The solvent was removed under reduced pressure, and the residue was dissolved in DCM (100 mL) and washed with a saturated aqueous solution of NaHCO3 (100 mL). The organic layer was dried over Na2SO4, the solvent was evaporated, and the crude product was purified by rapid chromatography (gradient elution: 0-5% MeOH in DCM within 14 CV). A pale yellow oily product was obtained (1.2 g, 43%, rf = 0.20 (5% MeOH in DCM)). MS: C 81 H 125 N7O 41 The calculated value is 1852.9. The measured value is 1854. 7.1H NMR (500MHz, DMSO-d6) δ 7.90-7.80 (m, 10H), 7.65-7.62 (m, 4H), 7.47-7.43 (m, 3H), 7.38-7.32 (m, 8H), 5.24-5.22 (m, 3H), 5.02-4.97 (m, 4H), 4.60-4.57 (m, 3H), 4.07-3.90 (m 10H), 3.67-3.36 (m, 70H), 3.23-3.07 (m, 25H), 2.18 (s, 10H), 2.00 (s, 13H), 1.89 (s, 11H), 1.80-1.78 (m, 17H). 13C NMR (125MHz, DMSO-d6)δ
[1382] 170.1(C),169.8(C),169.7(C),169.4(C),169.2(C),169.1(C),142.7(C),126.3(CH),123.9(CH),118.7(CH),109.7(CH),100.8(CH),70.5(CH) ,69.8(CH),69.6(CH),69.5(CH),69.3(CH2),69.0(CH2),68.2(CH2),67.2(CH2),66.7(CH2),61.4(CH2),22.6(CH2),22.4(3xCH3),20.7(9xCH3).
[1383]
[1384] Preparation of Compound 10: Trianthopteran GalNAc compound 9 (0.27 g, 0.14 mmol, 1.0 eq.) was dissolved in MeOH (15 mL), and 3 drops of acetic acid (AcOH) and Pd / C (30 mg) were added. The reaction mixture was degassed using a vacuum / argon cycle (3x) and hydrogenated overnight under balloon pressure. The completion of the reaction was monitored by mass spectrometry, and the resulting mixture was filtered through a thin diatomaceous earth pad. The solvent was evaporated, and the residue was dried under high vacuum. The residue was ready for use in the next step without further purification. A pale yellow oily product (0.24 g, quantitative yield) was obtained. MS: C 73 H 119 N7O 39 The calculated value is 1718.8. The measured value is 1719.3.
[1385]
[1386] Preparation of Compound 14: Under an argon atmosphere, compound 10 (0.45 g, 0.26 mmol, 1.0 eq.) of the tritendon GalNAc, HBTU (0.19 g, 0.53 mmol, 2.0 eq.), and DIPEA (0.23 mL, 1.3 mmol, 5.0 eq.) were dissolved in DCM (10 mL). A solution of compound 13 (0.14 g, 0.53 mmol, 2.0 eq.) in DCM (5 mL) was added dropwise to this mixture. The reaction was stirred overnight at room temperature. The solvent was removed, and the residue was dissolved in EtOAc (50 mL), washed with water (50 mL), and dried over Na2SO4. The solvent was evaporated, and the crude product was purified by rapid chromatography (gradient elution: 0-5% MeOH in DCM within 20 CV). A white, fluffy solid product (0.25 g, 48%, rf = 0.4 (10% MeOH in DCM)) was obtained. MS:C 88 H137 N7O 42 The calculated value is 1965.1. The measured value is 1965.6.
[1387]
[1388] Preparation of TriGalNAc(15): TriGalNAc compound 14 (0.31 g, 0.15 mmol, 1.0 eq.) was dissolved in EtOAc (100 mL) under an argon atmosphere, and Pd / C (40 mg) was added. The reaction mixture was degassed using a vacuum / argon cycle (3x) and hydrogenated overnight under balloon pressure. The completion of the reaction was tracked by mass spectrometry, and the resulting mixture was filtered through a thin diatomaceous earth pad. The solvent was evaporated and the resulting residue was dried overnight under high vacuum. The residue was ready for conjugation with oligonucleotides without further purification (0.28 g, quantitative yield). MS: C 81 H 131 N7O 42 The calculated value is 1874.9. The measured value is 1875.3.
[1389] Conjugation of lineage 2 to the siRNA strand: TriGalNAc lineage 2 (GalNAc-T2) conjugation at the 5' or 3' end.
[1390] 5'-GalNAc-T2 conjugate
[1391]
[1392] 3'-GalNAc-T2 conjugate
[1393]
[1394] Preparation of TriGalNAc-based 2NHS esters: N-hydroxysuccinimide (NHS) (15.3 mg, 133 μmol) and N,N'-diisopropylcarbodiimide (DIC) (19.7 μL, 127 μmol) were added to a 2.1 mL DMF solution of carboxylic acid chain 2 (compound 15, 227 mg, 121 μmol). The solution was stirred at room temperature for 18 h and could be used for subsequent conjugation reactions without purification.
[1395] A general method for triGalNAc chain 2 conjugation: Dissolve the amine-modified single chain at 700 OD / mL in 50 mM carbonate / bicarbonate buffer, pH 9.6 / DMSO 4:6 (v / v), and add a one molar equivalent of the chain 2 NHS ester (57 mM) in DMF solution. The reaction is carried out at room temperature, and after 1 h, another molar equivalent of the NHS ester solution is added. The reaction is continued for 1 h and monitored by LCMS. An NHS ester reagent in excess of at least two molar equivalents relative to the amino-modified oligonucleotide is required to achieve quantitative consumption of the starting material. Dilute the reaction mixture 15-fold with water, filter once through a Sartorius 1.2 μm filter membrane, and then… Purification was performed using a retention phase (RP HPLC) on the Pure (GE Healthcare) instrument.
[1396] Purification was performed using a Waters XBridge C18 Prep 19x50 mm column. Buffer A was 100 mM TEAA pH 7, and buffer B was buffer A containing 95% acetonitrile. The flow rate was 10 mL / min, and the temperature was 60 °C. The UV trajectory at 280 nm was recorded. The gradient was applied from 0 to 100% of buffer B over 60 column volumes.
[1397] The fraction containing the full-length conjugated oligonucleotide was collected and precipitated in a refrigerator using 3M NaOAc (pH 5.2) and 85% ethanol. The collected precipitate was dissolved in water to a concentration of 1000 OD / mL. The sample was desalted by size exclusion chromatography and concentrated using a vacuum centrifuge to obtain conjugated oligonucleotides in 40-80% yield. O-acetate was removed by adding 20% ammonia solution until the reaction was complete (monitored by LC-MS).
[1398] exist On a Pure (GE Healthcare) instrument, the conjugates were desalted using size exclusion chromatography with Sephadex G25 Fine resin (GE Healthcare) to obtain conjugated oligonucleotides with a separation yield of 60-80%.
[1399] The conjugates were characterized by HPLC-MS analysis using a Dionex Ultimate3000 (Thermo Fisher Scientific) HPLC system equipped with a Compact ESI-Qq-TOF mass spectrometer (Bruker Daltonics) and a 2.1x50mm XBridge C18 column (Waters).
[1400] Buffer A consisted of 16.3 mM triethylamine and 100 mM HFIP (dissolved in 1% MeOH in H₂O solution), while buffer B consisted of buffer A containing 95% MeOH. The flow rate was 250 μL / min, and the temperature was 60 °C. UV trajectories at 260 nm and 280 nm were recorded. The gradient was applied from 0 to 100% in buffer B over 31 min.
[1401] The following scheme further elaborates on the synthetic route: Scheme 6:
[1402] Option 7:
[1403] Option 8:
[1404] Option 9:
[1405]
[1406] Example 5: Double-chain annealing
[1407] The two complementary strands were annealed by mixing equimolar aqueous solutions of the two strands to generate the desired siRNA double strands. The mixture was placed in a water bath at 70°C for 5 min, and then cooled to ambient temperature over 2 h. The double strands were lyophilized for 2 days and stored at -20°C.
[1408] On a Dionex Ultimate 3000 (Thermo Fisher Scientific) HPLC system, analytical SEC HPLC was performed via Superdex. TM Double strands were analyzed using a 75 Increase 5 / 150GL column (5x 153-158 mm, Cytiva). The mobile phase consisted of 1x PBS containing 10% acetonitrile. The flow rate was 1.5 mL / min at room temperature with an isocratic gradient over 10 min. UV trajectories at 260 nm and 280 nm were recorded. Water (LC-MS grade) was purchased from Sigma-Aldrich, and phosphate-buffered saline (PBS; 10x, pH 7.4) was purchased from GIBCO (Thermo Fisher Scientific).
[1409] Example 6: Conjugate building block TriGalNAc_ Chain 2 Alternative synthetic routes
[1410]
[1411]
[1412] Conjugation of lineage 2 to siRNA: TriGalNAc lineage 2 (GalNAc-T2) is conjugated at the 5' or 3' end.
[1413] Adhesion conditions
[1414]
[1415] Pre-activation TFA-O-PFP (15 μl, 21 eq.) and DIPEA (23 μl, 32 eq.) were added sequentially to a DMF solution (160 μL) of compound 15 (16 μol, 4 eq.) at 25 °C. The reaction tube was shaken at 25 °C for 2 h. The reaction was quenched with water (10 μL).
[1416] Couplet The resulting mixture was diluted with DMF (400 μl), and then an oligoamine solution (4.0 μmol in 10×PBS, pH 7.4, 500 μL; final oligonucleotide concentration in organic and aqueous solutions: 4 μmol / ml = 4 mM) was added. The reaction tube was shaken at 25 °C for 16 h, and the reaction was analyzed by LCMS. The resulting mixture was treated with 28% NH4OH (4.5 ml) and shaken at 25 °C for 2 h. The mixture was analyzed by LCMS, concentrated, and purified by IP-RP HPLC to obtain oligonucleotides conjugated to the 2-GalNAc chain.
[1417] 5'-GalNAc-T2 conjugate
[1418]
[1419] 3'-GalNAc-T2 conjugate
[1420]
[1421] Example 7: Solid-phase synthesis method: scale ≤ 1 μmol
[1422] The synthesis of the siRNA sense and antisense strands was performed on a MerMade 192X synthesizer with a commercially available solid-phase support made of glass with controllable aperture and equipped with universal adapters (Universal CPG, loading 40 μmol / g; LGCBiosearch or Glen Research).
[1423] RNA phosphoramide was purchased from ChemGenes or Hongene.
[1424] The 2'-O-methylphosphoramides used are as follows: 5'-(4,4'-dimethoxytriphenylmethyl)-N-benzoyl-adenosine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramide, 5'-(4,4'-dimethoxytriphenylmethyl)-N-acetyl-cytidine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramide, 5'-(4,4'-dimethoxytriphenylmethyl)-N-isobutyryl-guanosine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramide, 5'-(4,4'-dimethoxytriphenylmethyl)-uridine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramide.
[1425] The 2'-F phosphoramids used are as follows: 5'-dimethoxytriphenylmethyl-N-benzoyl-deoxyadenosine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramid, 5'-dimethoxytriphenylmethyl-N-acetyl-deoxycytidine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramid, 5'-dimethoxytriphenylmethyl-N-isobutyryl-deoxyguanosine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramid and 5'-dimethoxytriphenylmethyl-deoxyuridine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramid.
[1426] All phosphorusamides were soluble in anhydrous acetonitrile (Honeywell Research Chemicals) at a concentration of 0.05 M, except for 2'-O-methyl-uridine phosphorusamide, which was soluble in DMF / MeCN (1:4, v / v). A 0.02 M iodine solution in acetonitrile / pyridine / H₂O (DNAchem) was used as the oxidant. Thiophosphate bonds were thiolated (TCI) using a 1:1 v / v acetonitrile / pyridine solution at 0.2 MPaDS. A 0.25 M mM 5-ethylthiotetrazole (ETT) solution in acetonitrile was used as the activator.
[1427] Inverted non-alkaline phosphoramidite and 3-O-dimethoxytriphenylmethyl-2-deoxyribose-5-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite were purchased from Chemgenes (ANP-1422) or Hongene (OP-040).
[1428] In each cycle, DMT was removed with a deblocking solution (3% TCA (DNAchem) in DCM solution).
[1429] The coupling time is 180 seconds. The oxidant contact time is set to 80 seconds, and the thiolation time is 2 * 100 seconds.
[1430] At the end of the synthesis, the oligonucleotides were cleaved from the solid support using a 4:1 (v / v) NH4OH:EtOH solution at 45°C for 20 hours (TCI). The solid support was then filtered off, the filter was thoroughly washed with H2O, and the volume of the combined solutions was reduced by vacuum evaporation.
[1431] Oligonucleotides were treated with an Amicon Ultra-2 Centrifugal Filter Unit to form sodium salts by ultracentrifugation (PBS buffer 10x, Teknova, pH 7.4, sterile) or by precipitation with 1M sodium acetate using EtOH to form sodium salts.
[1432] The identity of the single strands was assessed by MS ESI, and then annealed in water to form the final double-stranded siRNA. The purity of the double strands was assessed by size exclusion chromatography.
[1433] Example 8: Solid-phase synthesis method: scale ≥ 5 μmol
[1434] Synthesis of the siRNA sense and antisense strands was performed at a scale of 5 μmol on a MerMade12 synthesizer with a commercially available solid-phase support made of glass with controllable aperture and equipped with universal adapters (Universal CPG, loading 40 μmol / g; LGCBiosearch or Glen Research). The siRNA was synthesized using a 3'-PT-amino-modifying agent C6 CPG. 12 μmol of positive chain for 3' conjugation was synthesized on a solid support with a loading of 86 μmol / g (LGC).
[1435] RNA phosphoramide was purchased from ChemGenes or Hongene.
[1436] The 2'-O-methylphosphoramides used are as follows: 5'-(4,4'-dimethoxytriphenylmethyl)-N-benzoyl-adenosine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramide, 5'-(4,4'-dimethoxytriphenylmethyl)-N-acetyl-cytidine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramide, 5'-(4,4'-dimethoxytriphenylmethyl)-N-isobutyryl-guanosine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramide, 5'-(4,4'-dimethoxytriphenylmethyl)-uridine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramide.
[1437] The 2'-F phosphoramids used are as follows: 5'-dimethoxytriphenylmethyl-N-benzoyl-deoxyadenosine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramid, 5'-dimethoxytriphenylmethyl-N-acetyl-deoxycytidine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramid, 5'-dimethoxytriphenylmethyl-N-isobutyryl-deoxyguanosine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramid and 5'-dimethoxytriphenylmethyl-deoxyuridine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramid.
[1438] All phosphorusamides were soluble in anhydr...
Claims
1. An inhibitor of SLC25A5 / ANT2 expression and / or function, wherein, The inhibitor is conjugated to one or more ligand moieties, preferably wherein the ligand moieties allow targeting of hepatocytes.
2. The inhibitor according to claim 1, wherein, The inhibitor is an siRNA oligomer.
3. An inhibitor of SLC25A5 / ANT2 expression and / or function, wherein, The inhibitor is an siRNA oligomer.
4. The inhibitor according to claim 3, wherein, The inhibitor comprises an siRNA oligomer conjugated to one or more ligand moieties, preferably wherein the ligand moieties allow targeting of hepatocytes.
5. The inhibitor according to claim 1, 2 or 4, wherein, The one or more ligand portions contain one or more GalNAc ligands or one or more GalNAc ligand derivatives.
6. The inhibitor according to claim 1, 2 or 4, wherein, The one or more ligand portions comprise one or more GalNAc ligand derivatives.
7. The inhibitor according to any one or more of the preceding claims, wherein, The inhibitor targets SLC25A5 / ANT2.
8. The inhibitor according to any one or more of the preceding claims, wherein, The inhibitor is a nucleic acid used to inhibit SLC25A5 expression, the nucleic acid comprising a double-stranded region, the double-stranded region comprising a first strand and a second strand at least partially complementary to the first strand, wherein... (i) at least partially complementary to a portion of the RNA transcribed from the SLC25A5 gene, and (ii) Contains at least 17 consecutive nucleosides, which differ from any of the first-strand sequences listed in Table 2 by 0 or 1 nucleoside.
9. The inhibitor according to any one or more of the preceding claims, wherein, The inhibitor is a nucleic acid for inhibiting SLC25A5 expression, the nucleic acid comprising a double-stranded region, the double-stranded region comprising a first strand and a second strand at least partially complementary to the first strand, wherein the first strand: (i) at least partially complementary to a portion of the RNA transcribed from the SLC25A5 gene, and (ii) Contains at least 17 consecutive nucleosides, wherein the consecutive nucleosides differ from any of the first-strand modification sequences listed in Table 3 by 0 or 1 nucleoside.
10. The inhibitor according to claim 8 or 9, wherein, The first chain comprises nucleoside 2-18 of any sequence as defined in claim 8 or 9, particularly wherein the first chain comprises nucleoside 2-18 of any sequence as defined in Table 2 or Table 3.
11. The inhibitor according to claim 8, wherein, The second chain comprises a nucleoside sequence of at least 17 consecutive nucleosides, which differ from any second chain sequence listed in Table 2 by 0 or 1 nucleoside, and wherein the second chain has at least 85% complementary regions to the first chain on the 17 consecutive nucleosides.
12. The inhibitor according to claim 9, wherein, The second chain comprises a nucleoside sequence of at least 17 consecutive nucleosides, which differs from any of the second chain modification sequences listed in Table 4 by 0 or 1 nucleoside, and wherein the second chain has at least 85% complementary regions to the first chain on the 17 consecutive nucleosides.
13. The inhibitor according to claim 8, wherein, The first chain comprises any of the first chain sequences listed in Table 2.
14. The inhibitor according to claim 9, wherein, The first chain contains any of the first chain modification sequences listed in Table 3.
15. The inhibitor according to claim 11, wherein, The second chain comprises any of the second chain sequences listed in Table 2.
16. The inhibitor according to claim 12, wherein, The second chain contains any of the first chain modification sequences listed in Table 4.
17. The inhibitor of claim 13, wherein, The first chain contains any of the following sequences: SEQ ID NO:304, SEQ ID NO:323, SEQ ID NO:439, SEQ ID NO:453 and SEQ ID NO:
496.
18. The inhibitor according to claim 14, wherein, The first chain contains any of the following sequences: SEQ ID NO:856, SEQ ID NO:875, SEQ ID NO:991, SEQ ID NO:1005 and SEQ ID NO:1048.
19. The inhibitor according to claim 15, wherein, The second chain contains any of the following sequences: SEQ ID NO:580, SEQ ID NO:599, SEQ ID NO:715, SEQ ID NO:729 and SEQ ID NO:
772.
20. The inhibitor according to claim 16, wherein, The second chain contains any of the following sequences: SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281, and SEQ ID NO:1324.
21. The inhibitor according to any one of claims 8 or 11, comprising a first chain and a second chain, the first chain and the second chain comprising a nucleoside sequence differing from any combination of the following first and second sequences by 0 or 1 nucleoside, or consisting of or substantially consisting of a nucleoside sequence differing from any combination of the following first and second sequences by 0 or 1 nucleoside:
22. The inhibitor according to claim 9 or 12, comprising a first chain and a second chain, the first chain and the second chain comprising a nucleoside sequence differing from any combination of the following first and second sequences by 0 or 1 nucleoside, or consisting of or substantially consisting of a nucleoside sequence differing from any combination of the following first and second sequences by 0 or 1 nucleoside:
23. The inhibitor according to any one of claims 8 to 22, wherein, The length of the first chain is 17 to 30 nucleosides, preferably 19 to 25 nucleosides, and more preferably 19 or 23 nucleosides.
24. The inhibitor according to any one of claims 8 to 23, wherein, The length of the second chain is 17 to 30 nucleosides, preferably 19 to 25 nucleosides, and more preferably 19, 21 or 23 nucleosides.
25. The inhibitor according to any one of claims 8 to 24, wherein, The length of the double-stranded region of the nucleic acid is 17 to 30 nucleotides, more preferably 19, 21 or 23 nucleotides.
26. The inhibitor according to any one of claims 8 to 25, wherein, The length of the complementary region between the first strand and a portion of the RNA transcribed from the SLC25A5 gene is 17 to 30 nucleotides.
27. The inhibitor according to any one of claims 8 to 26, wherein, The nucleic acid also includes one or more single-stranded nucleoside overhangs, optionally wherein the overhang is on a first or second strand, preferably at the 3' end of the first or second strand, and / or wherein the overhang contains 1 to 4 nucleosides, more preferably 2 nucleosides.
28. The inhibitor according to any one of claims 8 to 27, wherein, The nucleic acid is an siRNA oligonucleotide.
29. The inhibitor according to any one of claims 8 to 28, wherein, The second positive chain further includes one or more base-free nucleosides in the terminal region of the second chain, wherein the base-free nucleosides are connected to adjacent nucleosides via reverse nucleoside internucleotide bonds.
30. The inhibitor according to any one of claims 8 to 29, wherein, The second chain contains two consecutive abasic nucleosides in its 5' terminal region, one of which is the terminal nucleoside in the 5' terminal region of the second chain, and the other abasic nucleoside is the penultimate nucleoside in the 5' terminal region of the second chain, wherein: (a) The penultimate abase-free nucleoside is connected to the first basic nucleoside in the adjacent 5' proximal region via a reverse nucleoside bond; (b) The reverse key is a 5-5' reverse key; and (c) When read along the direction of the end containing the terminal and penultimate anucleotide, the bond between the terminal and the penultimate anucleotide is 3'5'.
12. The inhibitor of claim 10 or 11, or the inhibitor used therein, wherein the reverse nucleoside bond is located at the terminal region distal to the 5' terminal region of the second strand, or at the terminal region distal to the 3' terminal region of the second strand.
31. The inhibitor according to claim 30, wherein, (i) The first and second chains each have a length of 23 nucleotides; (ii) There are two thiophosphate nucleoside bonds between three consecutive positions in the 5' proximal region of the second chain, wherein the first thiophosphate nucleoside bond is present between the adjacent first basic nucleoside of (a) and the adjacent second basic nucleoside in the 5' proximal region of the second chain, and the second thiophosphate nucleoside bond is present between the adjacent second basic nucleoside and the adjacent third basic nucleoside in the 5' proximal region of the second chain. (iii) There are two thiophosphate nucleoside bonds between three consecutive positions in the 5' and 3' end regions of the first chain, thereby connecting the terminal nucleosides of the 5' and 3' end regions of the first chain to their respective penultimate 5' and 3' adjacent nucleosides via thiophosphate nucleoside bonds, and connecting each of the first penultimate 5' and 3' nucleosides to its respective penultimate 5' and 3' adjacent nucleosides via thiophosphate nucleoside bonds; and (iv) The second strand of the nucleic acid is directly or indirectly conjugated to one or more ligand portions in the 3' end region of the second strand.
32. The inhibitor according to claim 30 or 31, wherein, The two consecutive inverted anucleotides in the 5' terminal region of the second strand exhibit the following 5' terminal motif. in: T represents 2'Me ribose modification. B represents the first two basic nucleoside bases of the 5' terminal region of the second strand, and Z represents the remaining 19 consecutive basic nucleosides of the second chain.
33. The inhibitor according to any one of claims 8 to 32, wherein, The nucleic acid is directly or indirectly conjugated to one or more ligand moieties, optionally wherein the ligand moieties are located in the terminal region of the second strand, preferably in its 3' terminal region.
34. The inhibitor according to claim 33, wherein, The ligand portion comprises: (i) one or more N-acetylgalactosamine (GalNAc) ligands, and / or (ii) One or more N-acetylgalactosamine (GalNAc) ligand derivatives.
35. The inhibitor according to claim 34, wherein, The one or more GalNAc ligands and / or GalNAc ligand derivatives are directly or indirectly conjugated to the 5' or 3' end region of the second strand of the nucleic acid, preferably to its 3' end region.
36. The inhibitor according to any one of claims 33 to 35, comprising the following structure: in: R1 is selected independently from hydrogen, methyl, and ethyl each time it appears; R2 is selected from hydrogen, hydroxyl group, -OC. 1-3 Alkyl group, -C(=O)OC 1-3 Alkyl, halogen, and nitro groups; X1 and X2 are each independently selected from methylene, oxygen, and sulfur when they appear; m is an integer from 1 to 6; n is an integer from 1 to 10; q, r, s, t, v are independent integers from 0 to 4, provided that: (i) q and r cannot both be 0; and (ii) s, t and v cannot all be 0 at the same time; Z represents the oligonucleotide moiety.
37. The inhibitor of claim 36, comprising the following structure: Oligonucleotides represent consecutive nucleosides in the second chain.
38. The inhibitor according to any one of claims 37 to 35, comprising the following structure: in: r and s are independently selected from integers from 1 to 16; and Z represents the oligonucleotide moiety.
39. The inhibitor according to claim 33, comprising the following structure: Oligonucleotides represent consecutive nucleosides in the second chain.
40. The inhibitor according to claim 37 or 39, wherein, The structure is attached to the 3' end region of the second chain.
41. The inhibitor according to any one of claims 22, 32, 37 and 40.
42. The inhibitor according to any one of claims 22, 32, 39 and 40.
43. The inhibitor according to one or more of the preceding claims, formulated with excipients and / or a carrier into a pharmaceutical composition.
44. A pharmaceutical composition comprising an inhibitor as described in one or more of the preceding claims, and a pharmaceutically acceptable excipient or carrier.
45. Use of the inhibitor of any one of claims 1 to 43 or the pharmaceutical composition of claim 44 in treatment.
46. The inhibitor of any one of claims 1 to 43 or the pharmaceutical composition of claim 44, for use in the prevention and / or treatment of metabolic diseases or disorders, such as metabolic diseases or disorders associated with non-alcoholic fatty liver disease (NAFLD), and / or obesity, and / or diseases or disorders associated with lipogenesis, and / or for use in reducing lipogenesis.
47. Use of SLC25A5 / ANT2 as a target in the identification of one or more therapeutic agents for the treatment or prevention of metabolic diseases or disorders, such as metabolic diseases or disorders associated with non-alcoholic fatty liver disease (NAFLD), and / or obesity, and / or diseases or disorders associated with lipogenesis, and / or for the reduction of lipogenesis.
48. A method for treating or preventing metabolic diseases or disorders, such as metabolic diseases or disorders associated with non-alcoholic fatty liver disease (NAFLD), and / or obesity, and / or diseases or disorders associated with lipogenesis, and / or a method for reducing lipogenesis, said method comprising administering to a patient an inhibitor of SLC25A5 / ANT2, such as an inhibitor as defined in any one of claims 1 to 43, or a pharmaceutical composition comprising an inhibitor of SLC25A5 / ANT2, such as the composition of claim 44.
49. The use of the inhibitor of any one of claims 1 to 43 or the pharmaceutical composition of claim 44 in the preparation of a medicament for treating metabolic diseases or disorders, such as metabolic diseases or disorders associated with non-alcoholic fatty liver disease (NAFLD), and / or obesity, and / or diseases or disorders associated with lipogenesis, and / or for reducing lipogenesis.
50. Use of SLC25A5 / ANT2 as a biomarker for metabolic diseases or disorders, such as metabolic diseases or disorders associated with non-alcoholic fatty liver disease (NAFLD), and / or obesity, and / or diseases or disorders associated with lipogenesis.
51. The use of SLC25A5 / ANT2 in in vivo methods for predicting the sensitivity of metabolic diseases or disorders, such as metabolic diseases or disorders associated with non-alcoholic fatty liver disease (NAFLD), and / or obesity, and / or diseases or disorders associated with lipogenesis, is generally performed by monitoring the sequence and / or expression level and / or function of SLC25A5 / ANT2 in samples obtained from patients.
52. A method for predicting a patient's susceptibility to metabolic diseases or disorders, such as those associated with non-alcoholic fatty liver disease (NAFLD), and / or obesity, and / or diseases or disorders related to lipogenesis, and optionally for treating said metabolic diseases or disorders, the method comprising: (a) Obtaining samples from patients, (b) Detect the sequence and / or expression and / or function of SLC25A5 / ANT2 in the samples obtained from the patient. (c) Based on the sequence and / or expression and / or function of SLC25A5 / ANT2 in the samples obtained from the patient, predict sensitivity to metabolic diseases or disorders, such as metabolic diseases or disorders associated with non-alcoholic fatty liver disease (NAFLD), and / or obesity, and / or diseases or disorders associated with adipogenesis. (d) Preferably, an effective amount of an inhibitor of SLC25A5 / ANT2 is administered to a confirmed patient, preferably an inhibitor of SLC25A5 / ANT2 as described in any one of claims 1 to 43, or a pharmaceutical composition containing an inhibitor of SLC25A5 / ANT2, such as the composition described in claim 44.
Citation Information
Patent Citations
Sirnas with vinylphosphonate at the 5' end of the antisense strand
EP3775207A1
Glucose dependent insulinotropic polypeptide analogs, pharmaceutical compositions and use thereof
US20140162945A1
Peptide compound
US20140357552A1
Methods of treating liver disorders or lipid disorders with a THR-beta agonist
US20200230146A1
Method of synthesizing thyroid hormone analogs and polymorphs thereof
US9266861B2