Death-related gene MuRop of megthrips vulgaris and application of death-related gene MuRop

By designing dsRNA interference technology for the MuRop gene, the problem of controlling common thrips was solved, achieving efficient and environmentally friendly control.

CN121991960APending Publication Date: 2026-05-08SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SOUTH CHINA AGRICULTURAL UNIVERSITY
Filing Date
2024-11-08
Publication Date
2026-05-08

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively control common thrips, chemical control leads to pesticide resistance and ecological threats, and RNAi technology has low efficiency in thrips.

Method used

This study provides information on the lethal gene MuRop in common thrips and its application. By designing dsRNA targeting MuRop, RNA interference is performed to disrupt its gene expression, leading to insect death.

Benefits of technology

It achieved a highly effective lethal effect on common thrips, significantly outperforming dsRNA of lethal genes in other insects, and provides an environmentally friendly control method.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121991960A_ABST
    Figure CN121991960A_ABST
Patent Text Reader

Abstract

The invention discloses a lethal related gene MuRop of megthrips vulgaris and application of the lethal related gene MuRop. The nucleotide sequence of the lethal related gene MuRop is shown as SEQ ID NO: 1. According to the application disclosed by the invention, the common megthrips can be fed with the dsRNA of the MuRop gene to cause death of the common megthrips, and the dsRNA has a good lethal effect on the common megthrips at different development stages, and is obviously superior to the dsRNA of other potential insect lethal related genes. The invention further establishes a method for preventing and treating the common megthrips, which can be used for efficiently preventing and treating the common megthrips and provides a new thought and a new way for efficiently and environment-friendly preventing and treating the common megthrips.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of pest and disease control technology, specifically to a lethal gene related to the common thrips, MuRop, and its application. Background Technology

[0002] The common thrips, *Megalurothrips usitatus* (Bagnall), belongs to the order Thysanoptera, family Thripidae, and genus *Megalurothrips*. This insect causes serious damage to a variety of crops, mainly legumes such as cowpeas, green beans, and broad beans, as well as other crops such as tomatoes, loofahs, and corn. Its occurrence and damage are particularly severe in Hainan and Guangdong provinces.

[0003] Currently, field control of common thrips mainly relies on chemical control. However, the common thrips' strong camouflage capabilities lead farmers to increase pesticide dosage and frequency during control, resulting in varying degrees of resistance to commonly used pesticides. Furthermore, chemical control not only kills beneficial organisms such as natural enemies and pollinators, but some synthetic pesticides are also difficult to degrade, posing a serious threat to the ecological environment. Therefore, there is an urgent need to research environmentally friendly control methods to manage the damage caused by common thrips.

[0004] RNA interference (RNAi) is a gene silencing technology triggered by endogenous or exogenous double-stranded RNA (dsRNA). It inhibits the expression of target genes by specifically degrading intracellular mRNA. RNAi technology can control key genes involved in pest development or important behaviors, indirectly hindering normal growth and reproduction, and even directly causing pest death, thereby achieving pest control goals. It is a novel, green, and environmentally friendly control method with broad application prospects. Obtaining highly effective and safe lethal target genes is crucial for pest control using RNAi technology.

[0005] The Rop (Ras opposite) gene plays a crucial role in membrane fusion during intracellular vesicle transport. The Sec1 / Munc18 family protein encoded by this gene mediates vesicle fusion by regulating the assembly of the SNARE complex. When Rop gene expression is disrupted, various cellular functions are restricted, potentially leading to developmental arrest or death in insects. For example, in the Drosophila melanogaster, Rop gene-deficient mutant embryos exhibit accumulation of extracellular secretions, inhibited cell proliferation, abnormal cell shape, and incomplete yolk digestion in the gut, ultimately resulting in embryonic death and failure to hatch into first-instar larvae, demonstrating the importance of the Rop gene in Drosophila embryonic development. In spider mites (Tetranychus urticae), the Rop gene is essential for maintaining normal reproductive capacity but has no significant impact on survival; RNAi interference with the Rop gene causes darkening of the spider mite's body color and affects its excretory function. Furthermore, in the red flour beetle (Tribolium castaneum), the mortality rate reached 100% 11 days after injection of dsRop into pupae and larvae.

[0006] The efficiency of RNAi interference varies greatly among different insect groups. dsRNA shows the highest RNAi interference efficiency in Coleoptera and Orthoptera, while RNAi is more difficult to achieve in Lepidoptera. Increasing research indicates that RNAi efficiency is also low in Thysanoptera. In palm thrips, the lethality of dsTpAPN2 and dsTpAPN3 was less than 15%, and there was no significant difference compared to the control group dsGFP. However, when dsTpAPN2 and dsTpAPN3 were loaded with star polycation (SPc) material, the lethality of palm thrips was only 23.3% and 30.0%, respectively. This indicates that RNAi efficiency for thrips pests is low. Currently, no highly efficient RNAi method for thrips has been developed. Summary of the Invention

[0007] The purpose of this invention is to overcome the above-mentioned shortcomings of the prior art and provide a lethal gene MuRop in common thrips and its application.

[0008] The first objective of this invention is to provide a lethal gene, MuRop, for common thrips.

[0009] A second objective of this invention is to provide the application of dsRNA targeting the lethality-related gene MuRop in the control of common thrips.

[0010] A third objective of this invention is to provide the application of dsRNA targeting the lethality-associated gene MuRop in the preparation of products for the prevention and control of common thrips.

[0011] The fourth objective of this invention is to provide a dsRNA for controlling common thrips.

[0012] The fifth objective of this invention is to provide a method for controlling common thrips.

[0013] The sixth objective of this invention is to provide a kit for controlling common thrips.

[0014] To achieve the above objectives, the present invention is implemented through the following solution:

[0015] This invention claims protection for a lethal gene MuRop in common thrips, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0016] This invention also claims protection for the following applications:

[0017] Application of dsRNA targeting the lethal gene MuRop in the control of common thrips.

[0018] Application of dsRNA targeting the lethal gene MuRop in the preparation of products for the prevention and control of common thrips.

[0019] Preferably, the nucleotide sequence of the dsRNA is as shown in SEQ ID NO:2.

[0020] More preferably, the 5' end and / or 3' end of the dsRNA also have a promoter sequence.

[0021] More preferably, the promoter sequence is a T7 promoter sequence, and the nucleotide sequence of the T7 promoter is shown in SEQ ID NO:4.

[0022] As a specific implementation, the nucleotide sequence of the dsRNA is shown in SEQ ID NO:5.

[0023] This invention also claims protection for a dsRNA for controlling common thrips, the nucleotide sequence of which is shown in SEQ ID NO:2.

[0024] The present invention also claims a method for controlling common thrips by feeding common thrips dsRNA targeting the lethal gene MuRop.

[0025] Preferably, the nucleotide sequence of the dsRNA is as shown in SEQ ID NO:2.

[0026] More preferably, the 5' end and / or 3' end of the dsRNA also have a promoter sequence, so that the dsRNA is prepared by in vitro transcription.

[0027] More preferably, the promoter sequence is a T7 promoter sequence, and the nucleotide sequence of the T7 promoter is shown in SEQ ID NO:4.

[0028] As a specific implementation, the nucleotide sequence of the dsRNA is shown in SEQ ID NO:5.

[0029] This invention also claims a kit for controlling common thrips, containing dsRNA targeting the lethal gene MuRop.

[0030] Preferably, the nucleotide sequence of the dsRNA is as shown in SEQ ID NO:2.

[0031] More preferably, it also contains an in vitro transcription reagent.

[0032] As a specific embodiment, the in vitro transcription reagent is the T7 in vitro transcription reagent.

[0033] Compared with the prior art, the present invention has the following beneficial effects:

[0034] This invention discovers that feeding common thrips with dsRNA targeting MuRop can induce mortality in common thrips, and this lethality is significant, even at different developmental stages, and is far superior to dsRNA targeting other insect lethal genes. Furthermore, a method for controlling common thrips has been established, which is highly effective and provides a new approach and method for efficient and environmentally friendly control of common thrips. Attached Figure Description

[0035] Figure 1 The mortality rate of common thrips adults after feeding on insect lethal gene dsRNA;

[0036] Figure 2 The mortality rate of dsMuRop against second instar nymphs of common thrips is shown in the figure; the values ​​in the figure are mean ± standard error, and different letters indicate significant differences between groups (Tukey, P<0.05).

[0037] Figure 3 The effect of feeding on dsMuRop on the silencing efficiency of MuRop in second instar nymphs (A) and adult females (B) of common thrips; the values ​​in the figure are mean ± standard error, and different letters indicate significant differences between groups (Tukey, P<0.05).

[0038] Figure 4The expression patterns of the MuRop gene in different developmental stages (A) and different tissues (B) of the common thrips are shown. 1st represents the first instar nymph; 2nd represents the second instar nymph; Pre-p represents the prepupa; Ps-p represents the pseudopupa; F represents the female adult; M represents the male adult; CT represents the cuticle; OV represents the ovary; MG represents the midgut; and SG represents the salivary gland. The values ​​in the figure are mean ± standard error, and different letters indicate significant differences between groups (P < 0.05). Detailed Implementation

[0039] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; the materials and reagents used, unless otherwise specified, are commercially available.

[0040] The common thrips was collected in Sanya City, Hainan Province in 2018 and reared with fresh cowpeas in an artificial incubator with a temperature of 26℃, a relative humidity of 70%, and an L:D ratio of 12:12.

[0041] In the bioassay device for common thrips: a disposable dip box is used, with a hole made at the top of the dip box (to ensure ventilation) and sealed with gauze (to prevent the insects from escaping).

[0042] Example 1: Effect of lethal gene dsRNA on the survival rate of common thrips

[0043] I. Experimental Methods

[0044] 1. Design of primers for insect lethal gene dsRNA

[0045] Nine genes reported to be lethal in the red flour beetle (Tribolium castaneum) were selected (related information is shown in Table 1 below) (Reference: Schmitt-Engel, C., Schultheis, D., Schwirz, J. et al. The iBeetle large-scale RNAi screen reveals gene functions for insect development and physiology. Nat Commun 6, 7822 (2015). https: / / doi.org / 10.1038 / ncomms8822). The sequences of their homologous genes in the common thrips were obtained by comparing and using the sequences on ibeetle-base (https: / / ibeetle-base.uni-goettingen.de / ). dsRNA primers were designed for each gene and GFP (Green fluorescent protein) (control). The relevant information for each gene and primer is shown in Table 2 below.

[0046] Table 1. Information related to lethal genes.

[0047]

[0048]

[0049] Table 2. dsRNA primers for lethal genes

[0050]

[0051] 2. In vitro synthesis of dsRNA

[0052] Using the dsRNA primers for lethal genes and GFP listed in Table 2, PCR amplification was performed on common thrips cDNA and pUC-GFP-AT plasmid containing the GFP encoding gene, respectively.

[0053] The PCR reaction system consisted of: 35 μL ddH2O, 50 μL Taq MasterMix, 5 μL template, 5 μL upstream primer (10 μM), and 5 μL downstream primer (10 μM).

[0054] PCR reaction conditions: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles; 72℃ extension for 10 min.

[0055] After the reaction was completed, the PCR products were detected by 1% agarose gel electrophoresis and then recovered using the SanPrep column DNA gel recovery kit (Shanghai Sangon Biotech) as a template for dsRNA synthesis.

[0056] Using MEGAscript TM T7 kit (Thermo Fisher Scientific, Waltham, MA, USA) for the synthesis of dsRNA.

[0057] The dsRNA synthesis system consisted of: 5 μL Reaction Buffer, 5 μL ATP Solution, 5 μL GTP Solution, 5 μL CTP Solution, 5 μL UTP Solution, 1 μg template for dsRNA synthesis, and 5 μL Enzyme Mix, with the final volume made up to 50 μL using ddH2O. After mixing thoroughly, the system was incubated at 37°C for 4 hours using a PCR instrument.

[0058] After the reaction was complete, 2.5 μL of TURBO DNase was added to remove residual template DNA, and then the reaction was performed according to MEGAscript. TM The T7 kit instructions were used to purify dsRNA. After dissolving the dsRNA in 50 μL of ddH2O, the dsRNA was stored at -80°C to obtain the lethal-related genes and GFP dsRNAs listed in Table 1.

[0059] dsRNA quality was assessed using 1.5% agarose gel electrophoresis with the NanoDrop One instrument. C dsRNA concentration was determined using a spectrophotometer.

[0060] 3. Effect of dsRNA on the survival rate of common thrips

[0061] Lethality of candidate target genes was determined using common female thrips:

[0062] RNAi treatment was performed using dsRNAs of lethal genes and GFP via a feeding method. The feeding soaking method was used to soak cowpea grains. Three biological replicates were set for each dsRNA, and 20 animals were per biological replicate.

[0063] The specific method was as follows: Cowpea seeds were soaked on ice for 30 minutes with 500 ng / μL of candidate target gene and GFP dsRNA. After soaking, the seeds were dried and fed to a bioassay device for common thrips. Cowpea seeds soaked in dsRNA were fed continuously for 48 hours (the soaked seeds were replaced every 24 hours). After 48 hours, cowpea pods without dsRNA soaking were fed (the pods were replaced every 24 hours). The plants were then placed in an artificial climate chamber (temperature 26℃, relative humidity 70%, L:D = 12:12), and the survival rate of common thrips was observed and recorded for 7 consecutive days, and the mortality rate was calculated.

[0064] II. Experimental Results

[0065] Survival rates of common large thrips were determined using RNAi treatment via feeding. All dsRNAs showed lethality rates below 32%, with the highest being the MuRop gene, which had a mortality rate as high as 31.67%, significantly different from the control group dsGFP. Except for the MuRop gene, the other lethal genes showed no significant differences compared to the control group dsGFP. Figure 1 (F) 9,20 =3.694, P<0.01). The nucleotide sequence of MuRop is shown in SEQ ID NO:1, the nucleotide sequence of the designed MuRop dsRNA is shown in SEQ ID NO:2, the nucleotide sequence of GFP dsRNA (dsGFP) is shown in SEQ ID NO:3, and the 5' and 3' ends of the designed dsMuRop and dsGFP are also equipped with T7 promoter sequences for in vitro transcription (the nucleotide sequence of which is shown in SEQ ID NO:4); that is, the nucleotide sequence of dsMuRop dsRNA (dsMuRop) used to feed common thrips is shown in SEQ ID NO:5, and the nucleotide sequence of dsGFP used to feed common thrips is shown in SEQ ID NO:6.

[0066] SEQ ID NO:1:

[0067] ATGGCGCTCAAGGCACTCGTCGGTCAAAAGATTATGAATGAGGTGGTTCGCTCAAA

[0068] TAAAAACAAAAAGAGTAAGGAGGTAGAATGGCGTGTGCTAGTTGTTGACCAGCTTG

[0069] CAATGCGCATGGTGTCTTCCTGCTGCAAAATGCACGACATCACTGCTGAAGGCGTC

[0070] ACCATTGTTGAAGATATTCATAAGAAGAGGGAGCCTCTTCCTACTATGGAATCAGT

[0071] GTATCTCATTACTCCATCAGAAAGGTCGGTGCATGCGCTCATGCAAGATTTCAGCAG

[0072] TCCGAACAGAACAATGTACCGAGGTGCTCATGTTTATTTCACGGAAGTGTGTCCAG

[0073] AAGAACTCTTCAATGAACTGTGCAAATCTTGTGCTGCTAAAAAGATTAAGACACTG

[0074] AGGGAAATCAACATTGCTTTTCTCCCTTATGAGTGTCAGGTTTTCTCTCTCGATGCTC

[0075] CGGAGACATTCCAATGTATGTACAATCCCTCATTCCTCAGTACCCGCAGTGCCAACA

[0076] TGGAACGCATTGCTGAACAGATTGCAACACTTTGCGCCACTCTTGGAGAATACCCA

[0077] TCTGTTCGTTACAGGAGTGACTTCGACAAAAATGTTGAGTTAGCTCAGATGGTGCA

[0078] ACAAAAACTCGATGCCTATAAAGCTGATGAGCCAACTATGGGTGAGGGTCCGGAGA

[0079] AAGCTCGCTCCCAGCTGCTGATTTTGGATCGTGGCTTTGATTGTGTGTCTCCTCTTCT

[0080] GCATGAGTTGACATTCCAGGCCATGGCTTATGATCTCCTCCCTATTGAGAATGATGT

[0081] GTACAAGTATGAAGCCACACAGGGTCAGCCTTTGAAGGAAGTTCTGTTAGATGAAA

[0082] ATGATGAGTTGTGGGTTGAGCTGCGCCATCAACACATTGCTACTGTTTCACAGAATG

[0083] TTACAAAGAATTTGAAGAAGTTCATTGATTCAAAGCAACGTATGCCAACTGGTGAC

[0084] AAGCAGTCCATGCGCGATCTGTCTCAAATGATCAAAAAGATGCCTCAGTACCAGAA

[0085] AGAACTAAGCAAATACTCTACCCACTTGCATCTTGCTGAGGATTGTATGAAGATGT

[0086] ATCAAGGAAGTGTGGATAAATTGTGCCGTGTTGAACAAGATTTGGCAATGGGCACA

[0087] GATGCTGAAGGAGAACGCATCAAGGATCACATGCGCAGCATTGTACCCATCCTTCT

[0088] CGACCAAAGTGTTTCCAACTACGATAAGTTGCGCGTGATCCTTCTGTACGTCATTGC

[0089] CAAGAATGGTATCACTGAAGAAAACCTTACCAAGTTAATGCAACATGCCCAAATAT

[0090] CCAGTACGGAAAAGCAGGCTATTGTAAATCTGGCTAATCTTGGGCTCAATGCTGTT

[0091] GTTGATGGAACAAGAAAAAAGATCTACAATGTTCCCCGCAAGGAACGCATAACTGA

[0092] GCAAACCTACCAGATGTCCCGTTGGACTCCTGTCGTGAAGGATATCATGGAGGACT

[0093] GTATTGAGGACAAACTTGACATGAAACATTTCCCTTACCTTGCTGGTCGCGCTGCCA

[0094] CTGGAAACTACCATGCACCAACGACAAGTGCACGATATGGCCAGTGGCACCGTGAC

[0095] AAGGGTCAGCAGGCTGTCAAGAATGTGCCTCGTCTGATTGTCTTCATCATTGGAGG

[0096] GTGCAGCTTCTCCGAAATTCGCTGTGCCTATGAAGTCACCAACCAAGTGAAAAATT

[0097] GGGAAGTGATTATTGGCTCCTCACACATTCTTACACCAGAGGACTTCCTTACCAACCTTCAAAACCTCAGCGGCTGA;

[0098] SEQ ID NO:2:

[0099] ACAGATTGCAACACTTTGCGCCACTCTTGGAGAATACCCATCTGTTCGTTACAGGAG

[0100] TGACTTCGACAAAAATGTTGAGTTAGCTCAGATGGTGCAACAAAAACTCGATGCCT

[0101] ATAAAGCTGATGAGCCAACTATGGGTGAGGGTCCGGAGAAAGCTCGCTCCCAGCTG

[0102] CTGATTTTGGATCGTGGCTTTGATTGTGTGTCTCCTCTTCTGCATGAGTTGACATTCC

[0103] AGGCCATGGCTTATGATCTCCTCCCTATTGAGAATGATGTGTACAAGTATGAAGCCACACAGGGTCA;

[0104] SEQ ID NO:3:

[0105] AAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCT

[0106] GAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCA

[0107] CCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCAC

[0108] GACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTC

[0109] AAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCC

[0110] TGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTG

[0111] GGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAA;

[0112] SEQ ID NO:4:

[0113] taatacgactcactataggg;

[0114] SEQ ID NO:5:

[0115] taatacgactcactatagggACAGATTGCAACACTTTGCGCCACTCTTGGAGAATACCCATCTGT

[0116] TCGTTACAGGAGTGACTTCGACAAAAATGTTGAGTTAGCTCAGATGGTGCAACAAA

[0117] AACTCGATGCCTATAAAGCTGATGAGCCAACTATGGGTGAGGGTCCGGAGAAAGCT

[0118] CGCTCCCAGCTGCTGATTTTGGATCGTGGCTTTGATTGTGTGTCTCCTCTTCTGCATG

[0119] AGTTGACATTCCAGGCCATGGCTTATGATCTCCTCCCTATTGAGAATGATGTGTACAAGTATGAAGCCACACAGGGTCAccctatagtgagtcgtatta;

[0120] SEQ ID NO:6:

[0121] taatacgactcactatagggAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGG

[0122] CAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCA

[0123] CCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCGACCACA

[0124] TGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGC

[0125] ACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGA

[0126] GGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGAC

[0127] GGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAAccctatagtgagtcgtatta.

[0128] Example 2: Effect of dsMuRop on the survival rate of second instar nymphs of common thrips

[0129] I. Experimental Methods

[0130] RNAi treatment was performed on second-instar nymphs of the common large thrips using MuRop and GFP dsRNA, respectively, via feeding. All treatments were performed in 5 biological replicates, with 10 nymphs per replicate. The specific methods were as follows:

[0131] Cowpea seeds were soaked in 500 ng / μL dsMuRop and dsGFP on ice for 30 min. After soaking, they were dried and fed into a bioassay device for common thrips. Cowpea seeds soaked in dsRNA were fed continuously for 48 h (the soaked seeds were replaced every 24 h). After 48 h, unsoaked cowpea pods were fed (the pods were replaced every 24 h). The treated plants were then placed in an artificial climate chamber (temperature 26℃, relative humidity 70%, L:D = 12:12) and the survival of second instar nymphs of common thrips was observed and recorded for 7 consecutive days, and the mortality rate was calculated.

[0132] II. Experimental Results

[0133] The results are as follows Figure 2 Survival rate determination of second-instar nymphs of common thrips revealed that the lethality of dsRNA ingested with MuRop was 40%, which was significantly higher than that of the control group dsGFP. Furthermore, dsMuRop had a higher lethality on second-instar nymphs than on adult females.

[0134] That is, feeding with dsMuRop resulted in the death of 40% of second-instar nymphs of the common thrips, demonstrating a significant lethal effect. Figure 2 (t(8)=-8.552,P<0.001).

[0135] Example 3: Effects of dsMuRop on MuRop gene expression in second-instar nymphs and adult females of the common thrips. I. Experimental Methods

[0136] RNAi treatment was performed on second-instar nymphs and adult females of the common thrips using MuRop and GFP dsRNA, respectively, via feeding. The specific methods were as follows:

[0137] Cowpea seeds were soaked in 500 ng / μL MuRop and GFP dsRNA on ice for 30 min each. After soaking, the seeds were air-dried and fed to cowpeas in a bioassay apparatus made from a feed container used for dipping. Cowpeas soaked in both dsRNAs were fed continuously for 48 h (the soaked seeds were replaced every 24 h). After 48 h of feeding, 40 second-instar nymphs and 40 adult females were collected in 1.5 mL RNase-free centrifuge tubes as one biological replicate. After flash freezing in liquid nitrogen, the replicates were stored at -80°C.

[0138] Total RNA was extracted from the collected samples and reverse transcribed into cDNA. The expression level of dsMuRop was examined by RT-qPCR to reflect its silencing efficiency against second-instar and female adult common thrips. Primers for RT-qPCR are shown in Table 3 below.

[0139] Table 3: RT-qPCR primers used in this experiment

[0140]

[0141] II. Experimental Results

[0142] The results are as follows Figure 3 As shown, RT-qPCR results indicated that feeding second-instar nymphs of the common thrips with dsMuRop significantly suppressed the expression level of the MuRop gene. Compared with the control group, the MuRop gene expression was downregulated by 2.126 times after feeding with dsMuRop. Figure 3 A)(t(4)=16.443,P<0.001); After feeding common female thrips with dsMuRop, the expression level of the MuRop gene was significantly suppressed, downregulated by 1.186 times compared with the control group. Figure 3 B)(F 1,6 =11.201, P<0.05).

[0143] Example 4: Expression of the MuRop gene in different developmental stages and tissues of common thrips

[0144] I. Experimental Methods

[0145] 1. Sample collection

[0146] The number of individuals sampled per replicate for different developmental stages of common thrips was as follows: 50 1st instar nymphs, 50 2nd instar nymphs, 30 prepupae, 30 pseudopupae, 20 female adults, and 20 male adults. Three biological replicates were collected for each sample.

[0147] Simultaneously, when collecting different tissue samples, the midgut, ovary, salivary gland, and epidermal tissues of female adult common thrips were dissected in centrifuge tubes containing Trizol, and three biological replicates were collected for each tissue sample. All samples were placed in 1.5 mL RNase-free centrifuge tubes, rapidly frozen in liquid nitrogen, and stored at -80°C before RNA extraction.

[0148] 2. Extraction and synthesis of the first strand of RNA and cDNA

[0149] RNA was extracted from the above samples using the Trizol method. RNA quality was assessed using 1% agarose gel electrophoresis with the NanoDrop One instrument. C RNA concentration was measured using a spectrophotometer; OD values ​​of RNA in all samples were also measured. 260 / OD 230 The pH was between 1.8 and 2.2. Using the PrimeScript™ RT reagent Kit with gDNAEraser, total RNA was reverse transcribed into cDNA according to the instructions. All cDNA was diluted 10-fold for subsequent experiments.

[0150] 3. RT-qPCR detection of MuRop gene expression

[0151] Using MuGAPDH as an internal reference gene, the expression pattern of the MuRop gene in different developmental stages and tissues of common thrips was detected by RT-qPCR (primers are shown in Table 3).

[0152] RT-qPCR reaction system: 2.5 μL cDNA template, 2.5 μL each of primers F and R (10 μM), 25 μL TBGreen, and 17.5 μL ddH2O.

[0153] The RT-qPCR reaction program is as follows: initial denaturation stage: 95℃ denaturation for 30s; quantitative analysis stage: 95℃ denaturation for 5s, 60℃ annealing for 30s, 40 cycles; melting curve: 95℃: 5s (4.4℃ / s), 60℃ (2.2℃ / s), 95℃ (0.11℃ / s, 5 photos taken for every 1℃ increase).

[0154] The results were adopted using 2 -△△Ct The calculation is performed using the method (Ct represents the cycle number).

[0155] II. Experimental Results

[0156] The MuRop gene expression level was highest in the pseudopupa of the common thrips, followed by the prepupa. There was no difference in expression levels between the first instar and female adults. The expression level was lowest in the second instar nymphs, and the expression level was higher in male adults than in female adults. Figure 4 A)(F 5,12 =2611.298, P<0.001). The highest expression level of the MuRop gene in different tissues of the common thrips was in the salivary gland, followed by the midgut, ovary, and epidermis. Figure 4 B)(F 3,8 =387.028, P<0.001).

[0157] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description and ideas, and it is neither necessary nor possible to exhaustively describe all implementation methods here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. A lethal gene MuRop from the common thrips, characterized in that, Its nucleotide sequence is shown in SEQ ID NO:

1.

2. The application of the dsRNA of the lethal gene MuRop as described in claim 1 in the control of common thrips.

3. The application of the dsRNA of the lethal gene MuRop as described in claim 1 in the preparation of products for the prevention and control of common thrips.

4. The application according to claim 2 or 3, characterized in that, The nucleotide sequence of the dsRNA is shown in SEQ ID NO:

2.

5. A dsRNA for controlling common thrips, characterized in that, Its nucleotide sequence is shown in SEQ ID NO:

2.

6. A method for controlling common thrips, characterized in that, Feeding common thrips with dsRNA targeting the lethal gene MuRop as described in claim 1.

7. The method according to claim 6, characterized in that, The nucleotide sequence of the dsRNA is shown in SEQ ID NO:

2.

8. A kit for controlling common thrips, characterized in that, Contains dsRNA targeting the lethal gene MuRop as described in claim 1.

9. The reagent kit according to claim 8, characterized in that, The nucleotide sequence of the dsRNA is shown in SEQ ID NO:

2.

10. The reagent kit according to claim 9, characterized in that, It also contains in vitro transcription reagents.