In-situ detection method for heavy metal cadmium in plants and application

Abstract

The invention provides an in-situ detection method and application of heavy metal cadmium in plants, according to the detection method, a cadmium-specific nucleic acid aptamer is used as a recognition element and is coupled with an affinity transmembrane oligomeric compound to synthesize a thiol-nucleic acid aptamer fluorescent probe, and in-situ rapid detection of the heavy metal cadmium in the plants is achieved. The fluorescent probe for detecting the heavy metal cadmium in the plant body comprises a thiol polymer and a cadmium aptamer fluorescent probe, the thiol polymer comprises a hexaethylene glycol spacer and phosphorous lipoate with 15 repetitive units, and the cadmium aptamer fluorescent probe comprises an aptamer sequence for specifically recognizing the heavy metal cadmium and a connecting sequence. Wherein a fluorophore is marked in the middle, and a quenching group is marked at the 3'end. Compared with a traditional plant body heavy metal cadmium detection technology, the detection method is more sensitive, the in-situ detection requirement of heavy metal cadmium in a plant living body can be met, the detection method is simple and easy to implement, large instruments are not needed, and the detection cost is low.

Description

Technical Field

[0001] This invention belongs to the field of heavy metal detection technology in plants, specifically relating to an in-situ detection method and application of cadmium in plants. Background Technology

[0002] Cadmium is one of the most biotoxic heavy metals, easily absorbed by plants and accumulated in the liver or kidneys through the food chain. Even trace amounts can cause health problems. Current methods for detecting cadmium, such as inductively coupled plasma mass spectrometry (ICP-MS) and atomic absorption spectrometry, suffer from interference from various substances, making their detection accuracy susceptible to the influence of other metal ions. These methods may face challenges in accuracy when analyzing complex samples. Furthermore, most methods focus on in vitro detection of cadmium and the toxic effects of free cadmium in mammalian cells; no studies have been reported on the in-situ quantitative detection of cadmium in living plants. Unlike animal and bacterial cells, plant cells have cell walls, making the efficient entry of nucleic acid aptamers into plant cells a persistent challenge in the field of functional nucleic acid live probes both domestically and internationally. Summary of the Invention

[0003] To address the aforementioned technical problems, this invention provides an in-situ quantitative detection technique for the heavy metal cadmium in plants. This method is based on cadmium-specific nucleic acid aptamers as recognition elements, synthesizing DNA strands of coupled affinity transmembrane oligomers as transmembrane elements, and combining fluorescence resonance energy transfer as signal output. This method can rapidly detect cadmium in plant samples and has good accuracy.

[0004] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides a fluorescent probe for detecting the heavy metal cadmium in plants, comprising a thiol polymer and a cadmium nucleic acid aptamer fluorescent probe. The thiol polymer comprises an 18-atom hexaethylene glycol spacer (labeled / iSp18 / ) and 15 repeating units of phosphorous lipoic acid (labeled / SS / ), and a DNA strand with the sequence SEQ ID NO.1: ACACGCTGCTT. The cadmium nucleic acid aptamer fluorescent probe comprises a complementary sequence of the DNA strand and an aptamer sequence specifically recognizing the heavy metal cadmium, wherein a fluorescent group is labeled in the middle and a quenching group is labeled at the 3' end. The sequence of the DNA strand is shown in SEQ ID NO.2: 5'-GCAGCGTGTGTGTATCTCAGGACGACGGGTTCACAGTCCGTTGTC-3', wherein the 15th base T of this sequence is labeled with a fluorescent group, and the 3' end is labeled with a quenching group. The sequence of the complementary sequence of the DNA strand is shown in 5'-ACACGCTGCTT / isp18 / / SS / 15-3'. The aptamer sequence that specifically recognizes the heavy metal cadmium is shown in SEQ ID NO.3: CTCAGGACGACGGGTTCACAGTCCGTTGTC.

[0005] Furthermore, the fluorescent group is FAM, and the quenching group is TAMRA; the fluorescent group FAM is labeled on the 15th base T in the middle.

[0006] Those skilled in the art can reasonably replace the fluorescent group FAM and the quencher group TAMRA with other fluorescent groups and quencher groups according to actual usage requirements, so as to achieve the effect of transmitting fluorescent signals.

[0007] Specifically, the thiol polymer is abbreviated as: 5'-ACACGCTGCTT / isp18 / / SS / 15-3' (SS-HS); the cadmium nucleic acid aptamer fluorescent probe is abbreviated as: 5'-GCAGCGTGTGTGTAT / i6-FAM / CTCAGGACGACGGGTTCACAGTCCGTTGTC / 36-TAMRA / -3' (CdS).

[0008] When used for the detection of the heavy metal cadmium, the thiol polymer and the cadmium nucleic acid aptamer fluorescent probe are mixed at a molar concentration ratio of 1:1.

[0009] The preparation of thiol polymers involves the synthesis and modification of precursors for endothelial transmembrane delivery mediated by a DNA synthesizer. DMT on the nucleosides linked to solid-phase CPG (controllable microporous glass beads) is removed with trichloroacetic acid to expose the 5' hydroxyl group for subsequent coupling. Prior to coupling, the monomer is mixed with tetrazolium and fed into a synthesis column to activate the monomer, forming a phosphoramidite-tetrazole intermediate. The phosphoramidite-tetrazole is then coupled to the 5' hydroxyl group of the nucleotide, and the tetrazolium is removed, resulting in an elongated oligonucleotide chain. This process is repeated to obtain the endothelial transmembrane delivery precursors required for the experiment.

[0010] The cadmium nucleic acid aptamer fluorescent probe was prepared by Sangon Biotech (Shanghai) Co., Ltd. through solid-phase phosphoramidite chemical synthesis.

[0011] Secondly, the present invention provides a detection reagent for detecting the heavy metal cadmium in plants, which includes the fluorescent probe described above.

[0012] Furthermore, the detection reagent described above also includes a buffer solution containing 10 mM Tris HCl, 140 mM NaCl, and 5 mM KCl, with a pH of 7.0.

[0013] Thirdly, the present invention also provides a method for quantitative detection of heavy metal cadmium ions, comprising the following steps: S1. Prepare a series of standard solutions containing cadmium ion gradient concentrations using cadmium sulfate standard; dilute the test sample with Tris-HCl buffer (10 mM, pH 7.5, 140 mM NaCl, 5 mM KCl). S2. The solution containing the fluorescent probe as described above is incubated with the sample to be tested and the standard solution, respectively. After incubation, the fluorescence intensity F2 at the excitation wavelength of 488nm and the emission wavelength of 520nm and the fluorescence intensity F1 at the emission wavelength of 580nm are measured by an enzyme-linked immunosorbent assay (ELISA) reader. F1 / F2 is calculated. S3. Plot a standard curve based on the concentrations of standard solutions with different gradient concentrations and their corresponding F1 / F2 ratios; substitute the F1 / F2 of the sample to be tested into the standard curve to obtain its cadmium ion content.

[0014] As described above, the preferred method is to prepare the thiol polymer and cadmium nucleic acid aptamer fluorescent probe in an equimolar ratio, and incubate them at 37°C for 10 min.

[0015] Furthermore, the concentrations of the thiol polymer and the cadmium nucleic acid aptamer fluorescent probe are both 1~2 μM, and the solvents for dissolving the thiol polymer and the cadmium nucleic acid aptamer fluorescent probe are Tris-HCl buffer with a final concentration of 10 mM Tris-HCl, 140 mM NaCl and 5 mM KCl, and a pH of 7.0.

[0016] Fourthly, the present invention also provides a method for in-situ quantitative detection of cadmium, a heavy metal in living plants. This method involves injecting a solution containing the fluorescent probe as described in any one of claims 1-3 into the plant mesophyll, detecting the cadmium using a confocal imaging confocal microscope, and determining the detection results as follows: When bright green and bright red fluorescence are observed, it indicates that there is no Cd²⁺ in the plant mesophyll; When the red fluorescence is significantly weakened while the green fluorescence remains bright, it indicates the presence of Cd²⁺ in the plant mesophyll.

[0017] Furthermore, the concentrations of both the thiol polymer and the cadmium nucleic acid aptamer fluorescent probe in the solution of the fluorescent probe are 1.5 μM, and the solvent is a Tris-HCl buffer solution with a final concentration of 10 mM Tris-HCl, 140 mM NaCl, and 5 mM KCl, and a pH of 7.0.

[0018] Tobacco protoplast experiments confirmed that there was no detection interference from endogenous background fluorescence in plants, and the probe could successfully enter the protoplast. It specifically recognized the target and functioned normally in protoplasts containing Cd²⁺, as shown by a significant reduction in red fluorescence and a bright green fluorescence. The probe was mainly distributed in the plant cell nucleus, achieving efficient and specific detection of Cd²⁺ in plants.

[0019] The beneficial effects of this invention are as follows: This invention provides an in-situ detection method for cadmium (Cd) in plants. This method utilizes a cadmium-specific nucleic acid aptamer as a recognition element, coupled with an affinity transmembrane oligomer compound to synthesize a thiol-fluorescent probe. Combined with fluorescence resonance energy transfer (FRET) as the signal output, it enables rapid in-situ detection of cadmium in plant samples, achieving rapid in-situ detection of Cd in plants. Compared to traditional Cd detection techniques in plants, this method is more sensitive, meets the requirements for in-situ detection of Cd in living plants, and is simple, easy to implement, requires no large instruments, and has low cost.

[0020] This invention provides a rapid in-situ detection method for cadmium in plants. It utilizes a fluorescent probe to specifically identify cadmium from numerous biomolecules within plant cells or tissues, and then measures the distribution range and aggregation degree of cadmium at its original location within the plant cells or tissues using fluorescence visualization. This method can not only be used for the rapid identification of pollutants in living plant samples, providing a new technical means for agricultural product safety risk detection and research on the migration, transformation, and accumulation characteristics of hazardous substances in crops, but also for screening plant varieties with different cadmium absorption and accumulation characteristics, providing technical support for the development of safe production technologies for farmland soils with low levels of heavy metal pollution. Attached Figure Description

[0021] Figure 1 This is a schematic diagram of the molecular structure of the thiol polymer in the embodiments of the present invention; Figure 2 The results of the fluorescence biosensor used in this embodiment of the invention for detecting different standard samples and blank controls are shown. Figure 3 The result is the detection result of the reaction time of the fluorescent biosensor in the embodiment of the present invention; Figure 4 The results of the fluorescent biosensor in this embodiment of the invention for detecting cadmium at different reaction temperatures are shown. Figure 5 These are the results of optimizing the fluorescent biosensor for transmembrane delivery of thiol precursors in this embodiment of the invention at different concentrations. Figure 6 The results of the fluorescent biosensor linking the thiol transmembrane delivery precursor in this embodiment of the invention for detecting cadmium at different reaction pH values. Figure 7 The results of the fluorescent biosensor linking the thiol transmembrane delivery precursor in this embodiment of the invention for detecting cadmium at different reaction times are shown. Figure 8 The fluorescent biosensor for linking thiol transmembrane delivery precursors in this embodiment of the invention is used to detect Cd in plants. 2+ The response results. Detailed Implementation

[0022] This invention utilizes the disulfide bond exchange mechanism during disulfide bond conversion to deliver aptamers into cells, solving the problem of how to efficiently mediate the entry of aptamer nucleic acid live probes into plant cells with cell walls.

[0023] The activity and stability of aptamer probes in plants: Aptamers for heavy metal cadmium are obtained through in vitro screening, but their activity, efficiency, and stability in plant cells are still unclear. By studying the structural changes after aptamer binds to the target, optical probes are designed to characterize the properties of aptamers in plants, providing a reference for the study of aptamer probes in plant cells. Fluorescent biosensors simplify the operation, avoid the extraction process, and greatly shorten the detection time.

[0024] A method for in-situ quantitative detection of cadmium in vivo is disclosed. Based on a cadmium-specific nucleic acid aptamer as a recognition element, an affinity transmembrane oligomer is synthesized and coupled, and fluorescence resonance energy transfer (FRET) is used as the signal output. This method enables rapid detection of cadmium in plant samples and exhibits good accuracy. The method also involves the design of a fluorescent probe. The cadmium fluorescent probe contains a fluorescein (FAM) modified in the middle and a quencher group (TAMRA) covalently coupled to DNA, providing green fluorescence to monitor DNA delivery. The fluorescent probe described in this invention is mixed with the detection sample and incubated; the cadmium content is detected based on the ratio of fluorescence intensities.

[0025] In the fluorescent biosensor of the present invention, fluorescence signals can only be generated through nucleic acid synergy when the heavy metal cadmium is present in the plant, which can effectively improve the specificity of detecting heavy metal cadmium. The fluorescent biosensor of the present invention has good accuracy and reliability and can meet the actual needs of plant sample detection.

[0026] This invention provides the design of thiol polymers and fluorescent nucleic acid aptamers for in-situ quantitative detection of cadmium in living plants based on DNA aptamers. The detection principle of the detection method provided by this invention is as follows: the thiol polymer hybridizes with a fluorescent probe, and the two complexes together constitute a fluorescent biosensor, forming a thiol-fluorescent probe complex. The size of this oligonucleotide complex is less than 20 nm to meet the exclusion limit of the cell wall network structure. The nucleotide sequence consisting of bases 16-45 in the cadmium nucleic acid aptamer fluorescent probe CdS (5'-GCAGCGTGTGTGTAT / i6-FAM / CTCAGGACGACGGGTTCACAGTCCGTTGTC / 36-TAMRA / -3') is a nucleic acid sequence that can specifically recognize the heavy metal cadmium, as shown in SEQ ID NO.25'-GCAGCGTGTGTGTATCTCAGGACGACGGGTTCACAGTCCGTTGTC-3'. The 3' end and the 15th T base (T15) from the 5' end of this sequence are modified with a TAMRA quencher group and a FAM fluorescent group, respectively. The thiol polymer SS-SH (5'-ACACGCTGCTT / isp18 / / SS / 15-3') Among them, isp18, 18-atom hexaethylene glycol phosphate, is a spacer modification of the oligonucleotide, acting as a blocking group to prevent DNA polymerase amplification and elongation; / SS / 15 is an oligomer of 15 phosphorus lipoic acid monomers. That is, the sequence SEQ ID NO.1: ACACGCTGCTT shows a 3' oligomer of 15 phosphorus lipoic acid monomers with 18-atom hexaethylene glycol phosphate spacers. Its structural diagram is shown below. Figure 1 As shown, an efficient transmembrane delivery of a fluorescent biosensor is achieved through the uptake pathway of cellular and protein disulfide-thiol exchange activity. Based on the different responsiveness of specific DNA aptamers to different concentrations of the heavy metal cadmium, the fluorescence intensity at 520 nm emission wavelength of the FAM fluorescent group on the cadmium aptamer sensor, under an excitation wavelength of 488 nm, is recorded as F2, and the fluorescence intensity at 580 nm emission wavelength of the 3'-terminal modified TAMRA quencher group is recorded as F1. The in-situ rapid detection of the heavy metal cadmium in plants can be achieved based on the ratio of F1 to F2.

[0027] When the heavy metal cadmium is not present in the detection system, the fluorescent probe that specifically recognizes the heavy metal cadmium in the thiol-fluorescent probe complex is not activated, the fluorescent group FAM and the quenching group TAMRA are not close to each other, and the fluorescence of FAM is not quenched. At this time, the fluorescence signal in the detection system is the strongest, and the ratio of F1 to F2 is the smallest.

[0028] When cadmium is present in the detection system, the fluorescent probe that specifically recognizes cadmium in the thiol-fluorescent probe complex is activated. The fluorescent group FAM approaches the quenching group TAMRA, and the fluorescence of FAM is quenched. At this time, the fluorescence signal in the detection system weakens. The ratio of F1 to F2 gradually increases with the increase of cadmium concentration. A standard curve equation is plotted based on the F1 / F2 of different cadmium concentrations. The F1 / F2 of the test solution is then substituted into the standard curve method to achieve the purpose of detecting cadmium in plants.

[0029] The following embodiments are used to further illustrate the present invention, but should not be construed as limiting the present invention. Any modifications or substitutions made to the present invention without departing from its spirit and essence are within the scope of the present invention.

[0030] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. Unless otherwise specified, all reagents used in the examples are of analytical grade or higher. The reagents used can be commercially available products, such as 3-dimethoxytrimethoxy-2-(3-((R)-a-aliphatic)propane)propane-1-o-(2-cyanoethyl)-(N,N-diisopropyl)amidinephosphine, which can be purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0031] Example 1 Synthesis of transmembrane precursors The transmembrane oligomers were synthesized from the monomer 3-dimethoxytrimethoxy-2-(3-((R)-a-amino)propane)propane-1-o-(2-cyanoethyl)-(N,N-diisopropyl)-amidite (DAP). Before use, all solutions were placed in round-bottom flasks with rubber stoppers and bubbled with nitrogen to remove oxygen. To avoid the influence of oxygen on the experimental process, all experiments were conducted in an anaerobic environment. First, a 100 mM phosphate buffer solution was added to a low-adsorption centrifuge tube, followed by the addition of the DAP monomer solution, dissolving it completely in the 100 mM phosphate buffer solution to achieve a DAP monomer concentration of 30 pM in the centrifuge tube. The reaction solution was then removed after a specified time, and the reaction was stopped by adding 10% metaphosphoric acid solution. The solution was then stored in liquid form. After sampling, each sample was analyzed by HPLC. The peak areas of the product at different reaction time points were recorded to calculate the SS polymer content. A method for preparing a thiol polymer fluorescent probe containing a hexaethylene glycol spacer with 18 main chain atoms and 15 repeating units of phosphorous lipoic acid includes the following steps: S1, Synthesis-mediated transmembrane delivery precursor of aptamer: 1) First, the phosphorous lipoic acid monomer in the precursor mediated by the aptamer for transmembrane delivery was synthesized. Specifically, 10 g of lipoic acid, 20.2 g of HATU (2-(7-azabenzotriazol-1-yl)-N,N,N′,N′-tetramethylurea hexafluorophosphate), and 18.75 g of DIPEA (N,N-diisopropylethylamine) were mixed in DCM and DMF [143 mL, 1:1 (v / v)] and activated in an ice bath for 15 min. 4.85 g of 2-amino-1,3-propanediol was slowly added. The mixture was stirred at room temperature for 3 h. The reaction mixture was extracted and washed with saturated sodium chloride. The crude product was purified by gradient silica gel chromatography with ethyl acetate / methanol (0%-30%) to obtain compound 1.

[0032] 1 g of compound 1 was dissolved in 5 mL of pyridine. A mixture of approximately 25 mL of pyridine and DMT (4,4'-dimethoxytriphenylmethyl, 1.5 g) was slowly added dropwise to the mixture at -18 °C. The mixture was stirred at 0 °C for at least 24 h under TLC monitoring until the starting material was completely removed. The reaction mixture was then evaporated to dryness. The residue was redissolved in ethyl acetate, washed twice with saturated sodium bicarbonate solution, and once with saturated brine. The organic layer was separated using a funnel and dried over Na₂SO₄. After filtration through cotton, the solution was concentrated to obtain the crude product. The crude mixture was purified by passing it through a neutral column using DCM / MeOH (0%–4%, with 1% TEA (triethylamine)) as eluent, followed by evaporation and vacuum drying to give compound 2.

[0033] In a round-bottom flask, 0.7 g of compound 2 and 0.14 g of tetrazolium were added. After purging the air from the flask, 10 mL of redistilled dichloromethane was added under nitrogen protection. The mixture was stirred until dissolved, and then 0.72 g of (diisopropylamino)(2-nitro-ethoxy)phosphine was added. The reaction was carried out at room temperature. A 1:1 (v / v) mixture of petroleum ether and ethyl acetate was used as the developing solvent. The reaction progress was monitored by TLC. After approximately 3.5 h, the reactants were almost completely reacted. The concentrated reaction solution was purified by silica gel column chromatography under nitrogen protection. A gradient elution mode was used to gradually change the polarity of the eluent, thereby eluting components of different polarities in the mixture according to their retention strength. The eluent was petroleum ether:ethyl acetate (0%-50%, containing a final concentration of 0.5% TEA, where 0%-50% indicates that the proportion of ethyl acetate increased uniformly from 0% to 50%), both redistilled solutions. The final product was phosphorous thioate monomer.

[0034] 2) The precursor for endothelial transmembrane delivery was synthesized and modified using a DNA synthesizer. The 5'-DMT (dimethoxytriphenylmethyl) protecting group on the nucleotide linked to the solid-phase CPG (controllable microporous glass beads) was removed by acid hydrolysis with trichloroacetic acid, releasing free 5'-OH groups for subsequent coupling. Before coupling, phosphorus lipoic acid monomer and tetrazolium were mixed at a mass ratio of 1:2 and fed into the synthesis column to activate the monomer, forming the phosphorus lipoic acid tetrazolium intermediate. The phosphorus lipoic acid tetrazolium intermediate was coupled to the 5' hydroxyl group of the nucleotide shown in (SEQ ID NO.1) ACACGCTGCTT and the tetrazolium was removed, resulting in an elongation of the synthesized oligonucleotide chain by one base until the desired endothelial transmembrane delivery precursor thiol polymer SS-SH was obtained.

[0035] S2. Construct a cadmium-specific nucleic acid aptamer fluorescent probe that connects to the thiol transmembrane delivery precursor. Based on the cadmium-specific nucleic acid aptamer as the recognition element, the probe utilizes a disulfide-mediated membrane entry pathway combined with fluorescence resonance energy transfer as the signal output. In step S2, the method for constructing the fluorescent probe for the transmembrane delivery precursor of thiol is that the thiol DNA probe contains a transmembrane oligomer and a complementary sequence 1. The fluorescent nucleic acid aptamer includes a complementary sequence 2 and an aptamer sequence 3 that specifically recognizes the heavy metal cadmium; The complementary sequence 1 and the complementary sequence 2 have complementary base pairing.

[0036] The method for constructing the fluorescent probe connecting the thiol transmembrane delivery precursor involves the following nucleotide sequences for the thiol polymer and the cadmium nucleic acid aptamer fluorescent probe: thiol polymer: 5'-ACACGCTGCTT / isp18 / / SS / 15-3' (the thiol polymer contains an 18-atom hexaethylene glycol spacer and 15 repeating units of phosphorous thioclate), and its structural diagram is shown below. Figure 1 As shown; Cadmium aptamer fluorescent probe: 5'-GCAGCGTGTGTGTAT / i6-FAM / CTCAGGACGACGGGTTCACAGTCCGTTGTC / 36-TAMRA / -3', where / i6-FAM / indicates that the 15th T base contains a 6-carboxyfluorescein (6-FAM) fluorescent dye; / 3'-TAMRA / indicates that the 3' end of the sequence contains a tetramethylrhodamine (TAMRA) fluorescent dye. Specifically, the fluorescent group in the nucleotide sequence of the cadmium aptamer fluorescent probe is modified on the 15th T base in the middle, and the quenching group is modified on the 3' end of the probe nucleotide sequence.

[0037] S3. Cellular imaging and quantitative detection of cadmium in living plants: The aptamer fluorescent probe enters plant cells through a thiol-disulfide bond exchange reaction. The cell activity, stability and fluorescence efficiency of the probe in different tissues of the plant are studied. Imaging and quantitative analysis of fluorescence signals of cadmium in living plants are performed, and the results are used to locate and detect cadmium in tobacco with different cadmium accumulation levels.

[0038] The stability of the constructed fluorescent probe linking the thiol transmembrane delivery precursor in cells was studied by diluting 100 μM thiol polymer and fluorescent nucleic acid aptamer with buffer to 5, 10, 15, 20, 25, and 30 μM, respectively. The corresponding concentrations of aptamer were then reacted with blank, 10 μL of 10 μM Cd, and [other reagents]. 2+ Incubate at 37℃ for 30 min. Determine the optimal aptamer concentration by measuring fluorescence using a microplate reader. Since the maximum excitation / emission wavelength of FAM is approximately 480 nm / 520 nm, and that of TAMRA is approximately 488 nm / 580 nm, when excited at 480 nm, the emission peak of FAM is at 520 nm, while TAMRA is hardly directly excited. However, when the distance between the two dyes is ≤10 nm, the energy of FAM can be transferred to TAMRA via FRET, resulting in a decrease in the 520 nm signal and an increase in the 580 nm signal. Therefore, comparing the 580 nm / 520 nm values ​​determines whether the aptamer conformation has changed. The buffer solution was formulated with 10 mM Tris HCl, 10 mM NaCl, 5 mM MgCl2, and 0.01% Tween-20 (v / v), at a pH of 7.0.

[0039] Example 2: Characterization of fluorescent probe response to heavy metal cadmium concentration To test the sensitivity of the above-mentioned fluorescence biosensor detection method, different concentrations (0 nM, 20 nM, 100 nM) of Cd were used. 2+ The standard solution was used as the sample for detection. The specific procedure was as follows: The thiol polymer and fluorescent nucleic acid aptamer were dissolved in the appropriate volume of buffer solution (the buffer solution contained 10 mM Tris HCl, 10 mM NaCl, 5 mM MgCl2, and 0.01% Tween-20, pH 7.3) to a final concentration of 6 μM. The solution was then incubated at 95°C for 5 min and cooled to room temperature. 50 μL of the total 6 μM thiol polymer and fluorescent nucleic acid aptamer solution (molar ratio 1:1) was taken and 50 μL of different concentrations of Cd were added. 2+The standard solution (cadmium sulfate) was incubated with shaking at room temperature for 30 min. The above mixture was then transferred to a 96-well microplate. Fluorescence values ​​were measured once at an excitation wavelength of 488 nm and an emission wavelength of 580 nm, recording the fluorescence value F1; and once at an excitation wavelength of 488 nm and an emission wavelength of 520 nm, recording the fluorescence value F2. The F1 / F2 ratio was calculated. By comparing the F1 / F2 ratios, it was determined whether the fluorescent probe responded to different concentrations of cadmium sulfate.

[0040] The test results of standard samples at different concentrations and blank controls are as follows: Figure 2 As shown, the results indicate that for different gradient concentrations of Cd 2+ The response values ​​of the F1 / F2 numerical gradient obtained from the standard solution can be used to detect Cd in the test sample. 2+ .

[0041] Example 3: Characterization of the reaction time of fluorescent probe in response to heavy metal cadmium To determine the optimal reaction time for the above-mentioned fluorescent biosensor detection method, 50 μL of a solution containing 6 μM total 6 μM thiol polymer and fluorescent nucleic acid aptamer (molar ratio 1:1) was mixed with 50 μL of Cd at different concentrations. 2+ Sample solutions (0 nM, 100 nM) were reacted with shaking at room temperature for different times (10 min, 20 min, 30 min, 40 min, 50 min, 60 min). 90 μL of the above mixture was taken into a 96-well microplate. The excitation wavelength was 488 nm and the emission wavelength was 580 nm, and the fluorescence value was recorded as F1. The excitation wavelength was 488 nm and the emission wavelength was 520 nm, and the fluorescence value was recorded as F2. The F1 / F2 ratio was calculated.

[0042] The procedure is the same as above, with shaking times of 10 min, 20 min, 30 min, 40 min, 50 min, and 60 min, respectively, followed by measurement using an ELISA reader. The results are as follows: Figure 3 As shown, by comparing the values ​​of F1 / F2, the F1 / F2 value is the largest at 10 min, and the optimal reaction time is determined to be 10 min.

[0043] Example 4: Temperature Characterization of Fluorescent Probe Response to Heavy Metal Cadmium To determine the optimal reaction temperature for the above-mentioned fluorescent biosensor detection method, reactions were conducted at different temperatures. The thiol polymer and fluorescent nucleic acid aptamer (molar ratio 1:1) were dissolved in the appropriate volume of buffer solution (the buffer solution contained 10 mM Tris HCl, 10 mM NaCl, 5 mM MgCl2, and 0.01% Tween-20, pH 7.3) to a final concentration of 6 μM. The solution was then incubated at 95°C for 5 min and cooled to room temperature. 50 μL of the 6 μM thiol polymer and fluorescent nucleic acid aptamer (molar ratio 1:1) solution was mixed with 50 μL of 200 nM Cd... 2+ Several samples were incubated at 15℃, 25℃, 37℃, and 45℃ for 10 min with shaking. The mixture was then transferred to a 96-well microplate. The fluorescence value was measured once at an excitation wavelength of 488nm and an emission wavelength of 580nm, and recorded as F1. The fluorescence value was measured once at an excitation wavelength of 488nm and an emission wavelength of 520nm, and recorded as F2. The F1 / F2 ratio was then calculated.

[0044] The results are as follows Figure 4 As shown, when examining the temperature gradient using F1 / F2 as an indicator, it was found that the fluorescence ratio monotonically increased with increasing temperature, suggesting that the FRET-aptamer probe has better activity in the high-temperature region. Considering the feasibility of in vivo manipulation in plants and physiological tolerance, subsequent experiments uniformly adopted 37℃ as the reaction temperature. Therefore, the optimal reaction temperature of the aptamer probe was determined to be 37℃.

[0045] Example 5: Optimization of Different Concentrations of Fluorescent Probes To determine the optimal final concentration for the above-mentioned fluorescent biosensor detection method, reactions were conducted under different final concentrations of the fluorescent probe. The specific steps were as follows: The thiol polymer and fluorescent nucleic acid aptamer were dissolved in buffer solutions of the appropriate volume ratio (1:1) containing 10 mM Tris HCl, 10 mM NaCl, 5 mM MgCl2, and 0.01% Tween-20 (pH 7.0). The solutions were then dissolved at concentrations of 2 μM, 4 μM, 6 μM, 8 μM, 10 μM, and 12 μM, respectively. The solutions were incubated at 95°C for 5 min and then cooled to room temperature. 50 μL of each concentration of aptamer probe was then added to 50 μL of 200 nM Cd... 2+ The standard solution (cadmium sulfate) was incubated with shaking at room temperature for 10 min. The above mixture was then transferred to a 96-well microplate. Fluorescence was measured once at an excitation wavelength of 488 nm and an emission wavelength of 580 nm using a microplate reader, recording the fluorescence value F1; and once at an excitation wavelength of 488 nm and an emission wavelength of 520 nm, recording the fluorescence value F2. The F1 / F2 ratio was calculated. The results are as follows: Figure 5 As shown in the table, the results indicate that the fluorescent probe exhibits optimal activity when the final concentration is 1.5 μM, determined by comparing the F1 / F2 ratios.

[0046] Example 6: pH characterization of fluorescent probe response to heavy metal cadmium To determine the optimal reaction pH for the above-mentioned fluorescence biosensor detection method, reactions were conducted under different pH conditions. The aptamer was dissolved in appropriate volumes of buffer solution (the buffer solution contained 10 mM Tris HCl, 10 mM NaCl, 5 mM MgCl2, and 0.01% Tween-20 at a final concentration) to a final concentration of 6 μM, with pH values ​​of 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, and 9.0, respectively. The solutions were then incubated at 95°C for 5 min and cooled to room temperature. 50 μL of the 3 μM aptamer solution was mixed with 50 μL of 200 nM Cd... 2+ Several samples were incubated at 37℃ with shaking for 10 min. The resulting mixture was then transferred to a 96-well microplate. Fluorescence values ​​were measured once at an excitation wavelength of 488 nm and an emission wavelength of 580 nm, recording the fluorescence value F1. Fluorescence values ​​were also measured once at an excitation wavelength of 488 nm and an emission wavelength of 520 nm, recording the fluorescence value F2. The F1 / F2 ratio was calculated. The results are as follows: Figure 6 As shown, when the pH gradient was examined using F1 / F2 as an indicator, the fluorescence ratio decreased as the pH increased, indicating that the fluorescent biosensor was more active under acidic conditions. Considering the feasibility of operation in plants and physiological tolerance, pH 7.0 was used as the reaction pH for subsequent experiments. Therefore, the optimal reaction pH for the aptamer probe was determined to be 7.0.

[0047] Example 7 Preparation and Characterization of Thiol-Fluorescent Probe The thiol polymer with the best transmembrane efficiency obtained in Example 1 was ligated to the aptamer probe and characterized by chromatography and denaturing agarose gel electrophoresis. Then, fluorescently labeled aptamer sequences were ligated by hybridization.

[0048] Given the high fluorescence quantum yield and relatively stable properties of FAM, an aptamer 5'-GCAGCGTGTGTGTAT / i6-FAM / CTCAGGACGACGGGTTCACAGTCCGTTGTC-3', which is linked to FAM fluorescence, was attached to thiol polymers of different lengths (low polymer probes containing 15 phosphorus lipoic acid monomers and low polymer probes containing 10 phosphorus lipoic acid monomers). The nucleic acid solution was diluted to 100 nM with DPBS. The excitation wavelength was 490 nm, the excitation and emission slit width was 10 nm, the scan rate was 1200 nm / min, and the voltage was 400 V. Simultaneously, comparisons were made between probes with only aptamers, a control group with aptamer-labeled FAM, and probes with disulfide-bonded polymers linked to aptamer-labeled FAM. The transmembrane activity of the probes was evaluated by applying them to plant cells.

[0049] FRET (Fluorescent Resonance Energy Transfer) fluorescent labeling was performed on both ends of DNA using aptamer sequences synthesized by Shanghai Sangon Biotech. FAM was used as the fluorescent donor molecule, and TAMRA was selected as the candidate acceptor molecule. The aptamer linked to FAM fluorescence was diluted to 1.5 μM with thiol polymers of different lengths using buffer. Scans were performed in the wavelength range of 200-800 nm, and the maximum absorption wavelength was measured to compare the FRET efficacy of different acceptors in plants.

[0050] The aptamer fluorescent probe, with a final concentration of 1.5 μM, was dissolved in 1.5 μM of thiol polymer in Tris-HCl buffer (10 mM Tris-HCl, pH 7.0, 140 mM NaCl, 5 mM KCl). The solution was injected into the mesophyll of plant leaves using a syringe, and fluorescence spectroscopy was measured 10 min later. The emission wavelength was 490 nm, the excitation and emission slit widths were 10 nm, the scan rate was 1200 nm / min, and the voltage was 400 V. Three replicates were prepared for each sample solution. The fluorescence signal in plant cells was observed using a fluorescence confocal microscope. The results are as follows: Figure 7 The results showed that, under confocal microscopy, within the same time frame, the oligomer probe containing 15 phosphorus lipoic acid monomers exhibited stronger green fluorescence than the oligomer probe containing 10 phosphorus lipoic acid monomers, indicating that the oligomer probe containing 15 phosphorus lipoic acid monomers had superior transmembrane activity.

[0051] Example 8: Detection of cadmium in living plants Tobacco was selected as the test plant. Tobacco samples with different cadmium contents were obtained through pot cultivation, and the cadmium content in different plant tissues was detected by ICP-MS. Plant tissues were infiltrated with the same concentrations of Cd-S and SS-HS. Taking leaves as an example, 1.5 μM of the aptamer fluorescent probe (Cd-S) and 1.5 μM of the thiol polymer (SS-HS) were dissolved in Tris-HCl buffer (10 mM, pH 7.0, 140 mM NaCl, 5 mM KCl). The Tris-HCl buffer containing the aptamer fluorescent probe and thiol polymer was injected into the plant mesophyll using a syringe on the underside of the leaf. The mesophyll slides were then collected for confocal imaging microscopy with an excitation wavelength of 488 nm, an emission wavelength of 48-558 nm, and a gain of 600. The probe activity and stability were studied by comparing the fluorescence ratios at different infection times and probe concentrations. The results are as follows: Figure 8As shown, under a confocal microscope, in the absence of cadmium ions, the green color is dark (FAM group) and the red color is bright (TAMRA group), indicating that the aptamer is in an unbound state. In the presence of cadmium ions, the green color brightens (FAM group) and the red color brightens (TAMRA group), indicating that the aptamer is in a bound state. The fluorescence ratio changes were observed using the FRET method described above. When there was no fluorescent nucleic acid probe in the tobacco protoplasts, the background fluorescence of the plant showed a weak green; after PEG treatment and the introduction of the fluorescent nucleic acid probe, the protoplasts showed bright green and red fluorescence; however, when the fluorescent nucleic acid probe was introduced into cadmium-containing protoplasts, the red fluorescence of the protoplasts was significantly weakened, indicating that the fluorescent nucleic acid probe showed a weak green background fluorescence in the presence of cadmium. 2+ It can function normally in tobacco cells, and most of it is distributed on the nucleus of plant cells.

[0052] Fluorescence detection results of tobacco protoplasts showed that blank protoplasts without fluorescent nucleic acid probes only exhibited weak endogenous green fluorescence and no specific red fluorescence, thus eliminating interference from endogenous plant fluorescence on the detection signal. After introducing the fluorescent nucleic acid probe into Cd²⁺-free tobacco protoplasts, the protoplasts displayed bright green and red dual fluorescence signals, indicating that the probe successfully entered the protoplasts and maintained its inherent FRET conformation in a Cd²⁺-free environment, allowing for stable detection. When the fluorescent nucleic acid probe was introduced into Cd²⁺-containing tobacco protoplasts, the red fluorescence signal significantly decreased, while the green fluorescence signal remained bright, confirming that the fluorescent nucleic acid probe could specifically recognize and bind to Cd²⁺ within the tobacco protoplasts, and the FRET detection mechanism functioned normally, achieving effective detection of Cd²⁺ within the plant. Furthermore, the fluorescence signal was mainly concentrated in the plant cell nucleus region, indicating that the distribution site of the fluorescent nucleic acid probe within the tobacco protoplasts was primarily in the cell nucleus. When there is no Cd²⁺ in the plant mesophyll, it exhibits bright green and bright red fluorescence; when there is Cd²⁺, the red fluorescence is significantly weakened, while the green fluorescence remains bright.

[0053] The detection method of this invention achieves, for the first time, rapid, non-destructive, and qualitative screening of cadmium ions in the tobacco growing field. Its technical positioning is as a highly efficient tool for pollution early warning and preliminary field screening, complementing quantitative detection methods that require complex laboratory pretreatment and sophisticated instruments (such as ICP-MS and AAS) in application scenarios. Considering detection time and cost, the in-situ quantitative detection of cadmium in living plants described in the above embodiments has greater technical advantages and practical usability compared to existing cadmium detection technologies in plants.

Claims

1. A fluorescent probe for detecting the heavy metal cadmium in plants, characterized in that, It comprises a thiol polymer and a cadmium nucleic acid aptamer fluorescent probe. The thiol polymer contains an 18-atom hexaethylene glycol spacer and 15 repeating units of phosphorus lipoic acid and a DNA strand. The sequence of the DNA strand is shown in SEQ ID NO.

1. The repeating units are oligomers of phosphorus lipoic acid monomers. The cadmium nucleic acid aptamer fluorescent probe contains a complementary sequence of the DNA strand and an aptamer sequence that specifically recognizes the heavy metal cadmium. The specific sequence is shown in SEQ ID NO.

2. The 15th base T of this sequence is labeled with a fluorescent group, and the 3' end is labeled with a quenching group.

2. The fluorescent probe as described in claim 1, characterized in that, The fluorescent group is FAM, and the quenching group is TAMRA.

3. The fluorescent probe as described in claim 1, characterized in that, When used for the detection of the heavy metal cadmium, the thiol polymer and the fluorescent probe are mixed at a molar concentration ratio of 1:

1.

4. A detection reagent for detecting the heavy metal cadmium in plants, characterized in that, It includes the fluorescent probe as described in any one of claims 1-3.

5. The detection reagent as described in claim 4, characterized in that, It also includes a buffer solution containing 10 mM Tris HCl, 140 mM NaCl, and 5 mM KCl at a final concentration of 7.

0.

6. A method for quantitative detection of heavy metal cadmium ions, characterized in that, It includes the following steps: S1. Prepare a series of standard solutions containing cadmium ion gradient concentrations by stepwise dilution of cadmium sulfate standard; S2. The solution containing the fluorescent probe according to any one of claims 1-3 is incubated with the sample solution to be tested and the standard solution, respectively. After incubation, the fluorescence intensity of the incubated solution at an excitation wavelength of 488 nm and an emission wavelength of 520 nm is measured using an ELISA reader and recorded as F2; ​​the fluorescence intensity at an emission wavelength of 580 nm is recorded as F1, and the F1 / F2 ratio is calculated. S3. Plot a standard curve based on the concentrations of standard solutions with different gradient concentrations and their corresponding F1 / F2 ratios. Substitute the F1 / F2 of the sample to be tested into the standard curve to obtain the cadmium ion content in the solution to be tested.

7. The method for in-situ quantitative detection of cadmium, a heavy metal in living plants, as described in claim 6, is characterized in that... The thiol polymer and cadmium nucleic acid aptamer fluorescent probe were prepared in an equimolar ratio and incubated at 37°C for 10 min.

8. The method for in-situ quantitative detection of cadmium, a heavy metal in living plants, as described in claim 7, is characterized in that... The concentrations of the thiol polymer and the cadmium nucleic acid aptamer fluorescent probe are both 1-2 μM. The solvent used to dissolve the thiol polymer and the cadmium nucleic acid aptamer fluorescent probe is a Tris-HCl buffer with a final concentration of 10 mM, pH 7.0, containing 140 mM NaCl and 5 mM KCl.

9. A method for in-situ detection of cadmium, a heavy metal in living plants, characterized in that, A solution containing the fluorescent probe according to any one of claims 1-3 is injected into the plant mesophyll, and the results are detected by confocal imaging confocal microscopy. The detection results are determined as follows: When bright green and bright red fluorescence are observed, it indicates that there is no Cd²⁺ in the plant mesophyll; When the red fluorescence is significantly weakened while the green fluorescence remains bright, it indicates the presence of Cd²⁺ in the plant mesophyll.

10. The method for in-situ detection of cadmium in living plants as described in claim 9, characterized in that, The concentrations of the fluorescent probe solution, thiol polymer and cadmium nucleic acid aptamer fluorescent probe, were both 1.5 μM. The solvents were Tris-HCl buffer with a final concentration of 10 mM Tris-HCl, 140 mM NaCl and 5 mM KCl, and a pH of 7.0.

Images