Microfluidic biosensor for detecting citrus huanglongbing

Abstract

The invention discloses a microfluidic biosensor for detecting Candidatus Liberibacter asiaticum and a detection method thereof, and belongs to the technical field of biosensing. The sensor integrates a micro-fluidic chip of a separation area, a concentration area and an electrochemical detection area. The separation area is a spiral micro-channel; the concentration area is provided with an interdigital working electrode array, and target bacteria are captured and enriched through dielectrophoretic force; the electrochemical detection area is provided with a sensing working electrode, and the surface of the working electrode is sequentially modified with an MXene-coated AgNPs nano composite material layer, a nucleic acid aptamer layer specifically combined with outer membrane protein OmpA of the Candidatus Liberibacter asiaticum and a sealant layer. During detection, after a sample is separated and enriched, target bacteria are combined with the aptamer to cause electrochemical impedance change, and a result is output after treatment. According to the invention, sample pretreatment, target enrichment and high-sensitivity detection are integrated, rapid, simple and high-specificity on-site detection of the Candidatus Liberibacter asiaticum is realized, and the method is suitable for large-scale field screening.

Description

Technical Field

[0001] This invention relates to the field of biosensor technology, and more specifically to a microfluidic biosensor for detecting Huanglongbing (HLB) in citrus. Background Technology

[0002] Huanglongbing (HLB) is a devastating disease caused by the phloem obligate parasitic bacterium *Candidatus Liberibacter* spp., often referred to as "citrus cancer." In China, the primary variant is *Candidatus Liberibacter asiaticus* (CLas). Infected plants typically die or lose their fruit-bearing capacity within 3-5 years. The pathogen is transmitted by citrus psyllids and can rapidly spread throughout the orchard and even the entire production area, posing a serious threat to the citrus industry. Currently, there is no effective cure for this disease; therefore, early, accurate, and convenient detection is crucial for its control.

[0003] However, field diagnosis of Huanglongbing (HLB) faces numerous challenges. Its surface symptoms, such as yellowing and mottling of leaves, are remarkably similar to micronutrient deficiencies like zinc and manganese, easily leading to misdiagnosis. In laboratory testing, the pathogen cannot yet be cultured artificially, limiting the development of traditional culture-based detection methods. Historically, methods such as the iodine-starch staining method, serological detection, and electron microscopy have been used, but these methods are now rarely applied in practice due to low accuracy or complex and time-consuming procedures.

[0004] Currently, the mainstream detection technology both domestically and internationally relies on real-time quantitative polymerase chain reaction (qPCR). While this technology boasts high sensitivity, its application has limitations: primer design is complex, reaction system optimization is cumbersome, and it particularly relies on precise temperature control using sophisticated thermal cycling equipment. This places high demands on the expertise of operators, making it unsuitable for rapid on-site detection scenarios such as fields and orchards. Therefore, developing a novel detection technology that is highly sensitive, highly specific, easy to operate, and portable to meet the urgent need for rapid on-site diagnosis of Huanglongbing (HLB) has become a current research focus.

[0005] Finding stable detection targets is fundamental to developing new methods. OmpA, the outer membrane protein of CLas, exhibits highly conserved sequences across different strains and is abundant in the outer membrane, making it a highly promising specific detection target. Regarding recognition elements, nucleic acid aptamers, as "chemical antibodies" screened using SELEX technology, can fold into specific spatial structures to bind to targets with high affinity and specificity. They also possess advantages such as good stability and ease of synthesis and modification, and have been widely used in the detection and analysis of various targets.

[0006] Microfluidic chip technology integrates sample preparation, reaction, separation, and detection within a microchannel network. Its advantages, including low sample consumption, high analysis speed, high integration, and ease of automation, provide an ideal solution for building portable on-site detection platforms. Combining microfluidic chips with electrochemical sensing systems allows for the integration of a three-electrode detection unit on the chip, achieving integrated closed-loop detection from sample in to result out. The microfluidic environment enhances mass transfer efficiency, and modifying the working electrodes with nanomaterials (such as silver nanoparticles and MXene) significantly improves detection sensitivity. Furthermore, microfluidic chips can integrate sample pretreatment modules based on principles such as inertial force and magnetophoresis, directly separating and enriching target analytes from complex matrices, thus enabling direct, rapid, and quantitative analysis of practical samples such as citrus leaf extracts.

[0007] In summary, to address the shortcomings of existing Huanglongbing detection technologies, especially qPCR methods, in terms of portability and field application, it is hoped that combining molecular recognition technology based on specific nucleic acid aptamers with an integrated, low-consumption microfluidic electrochemical sensing platform can lead to the development of a new integrated detection method that is easy to operate, rapid, accurate, and suitable for field applications. Summary of the Invention

[0008] The purpose of this invention is to provide a microfluidic biosensor for detecting Huanglongbing (HLB) in citrus. The microfluidic biosensor is constructed based on the screened OmpA protein aptamer of the HLB fungus and is suitable for field detection of HLB.

[0009] To achieve the above objectives, the technical solution of the present invention is as follows:

[0010] The present invention discloses a microfluidic biosensor for detecting Huanglongbing (HLB) of citrus. This biosensor primarily comprises a core recognition and signal conversion component consisting of a nucleic acid aptamer with high affinity for OmpA and an MXene@AgNPs nanocomposite material with excellent conductivity. The core component includes:

[0011] The microfluidic chip has an integrally formed separation zone, a concentration zone, and an electrochemical detection zone that are fluidly connected in sequence;

[0012] The separation zone is a spiral microchannel, which has at least one sample inlet, at least one sheath flow inlet, at least one waste liquid outlet, and at least one target liquid outlet leading to the concentration zone;

[0013] The concentration zone is equipped with an array of interdigitated working electrodes for generating dielectric force, the inlet of which is connected to the target liquid outlet of the separation zone, and the outlet of which is connected to the electrochemical detection zone.

[0014] An electrochemical sensing working electrode is provided in the electrochemical detection area. The working electrode surface of the electrochemical sensing working electrode is sequentially modified with an MXene@AgNPs nanocomposite layer, a nucleic acid aptamer layer that specifically binds to the Huanglongbing bacteria outer membrane protein OmpA, and a blocking agent layer.

[0015] The system also includes a signal processing module, which is electrically connected to the electrochemical sensing working electrode, for detecting and processing changes in electrochemical signals caused by the binding of the nucleic acid aptamer to the OmpA protein, and outputting detection results related to the presence of Huanglongbing bacteria.

[0016] The nucleic acid aptamer includes one of the following sequences:

[0017] SEQ ID NO: 1: ATCCAGAGTGACGCAGCAAAGGTTCGTAGTGTTGTGTCCCTCTCGACCTCGCCCGGTATGGACACGGTGGCTTAGT;

[0018] SEQ ID NO: 2: ATCCAGAGTGACGCAGCAGCATCCGCTGGATGGCTACGACTTATATCTTGTGCAGTACTGGACACGGTGGCTTAGT;

[0019] SEQ ID NO: 3:ATCCAGAGTGACGCAGCACGACGCAGTATCCAGAGTGACGCAGCACGAAGGCCGCCCCTGGACACGGTGGCTTAGT;

[0020] SEQ ID NO: 4: ATCCAGAGTGACGCAGCAAGAGTGACTAAGCCACCGTGTCCACTAAGCCACCGTGTCCTGGACACGGTGGCTTAGT.

[0021] Preferably, the nucleic acid aptamer is the sequence shown in SEQ ID NO: 3.

[0022] The working electrode is prepared by the following method:

[0023] (1) Preparation of MXene@AgNPs nanocomposites:

[0024] LiF was premixed with HCl and stirred; then Ti3AlC2 powder was gradually added for etching. After etching, the product was collected by centrifugation; 1M HCl was added to remove LiF until the supernatant was colorless, and then washed with ultrapure water until the pH of the supernatant was ≥6; the precipitate was ultrasonically treated with nitrogen and ice water bath, and the supernatant was collected by centrifugation and freeze-dried for 48h to obtain MXene powder for later use.

[0025] MXene powder was dispersed in water, and silver nitrate solution was added to react with it. After centrifugation, washing and drying, MXene@AgNPs nanocomposite material was obtained.

[0026] (2) Take MXene@AgNPs dispersion and drop it onto the working electrode. After drying, take thiolized aptamer solution and add it to the surface of the working electrode and incubate. Then add 6-mercapto-1-hexanol solution and incubate. After incubation, wash to obtain MXene@AgNPs / Apt / MCH modified working electrode, i.e., working electrode.

[0027] The electrochemical sensing working electrode is a screen-printed working electrode, and its working electrode is a carbon working electrode; the sealing agent is 6-mercapto-1-hexanol.

[0028] The substrate of the microfluidic chip is polydimethylsiloxane (PDMS).

[0029] The signal processing module includes a wireless transmission unit for sending the detection results to a smart terminal for display.

[0030] The present invention also provides the application of a nucleic acid aptamer in the preparation of a sensor or detection reagent for detecting Huanglongbing (HLB) of citrus, wherein the sequence of the nucleic acid aptamer is shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4.

[0031] Furthermore, this invention also provides a detection method for rapid field screening of citrus Huanglongbing pathogen, employing the aforementioned microfluidic biosensor, comprising the following steps:

[0032] (1) Prepare a suspension of the citrus tissue sample to be tested and inject it into the sample inlet as a sample liquid, while injecting the sheath flow liquid into the sheath flow inlet at the same time; the ratio of the sample liquid injection rate to the sheath flow liquid injection rate is 1:5;

[0033] (2) In the separation zone, the large particulate impurities in the sample liquid are discharged through the waste liquid outlet by using the inertial focusing effect, so that the bacterial liquid flows through the target liquid outlet into the concentration zone;

[0034] (3) In the concentration zone, by applying an AC voltage of 6 V and a frequency of 6 MHz to the interdigitated working electrode array, a dielectrophoretic force is generated, which captures and enriches the Huanglongbing bacteria flowing through it to the center line of the microchannel with the highest electric field strength, forming a concentrated bacterial solution and transporting it to the electrochemical detection zone.

[0035] (4) In the electrochemical detection area, the OmpA protein on the surface of Huanglongbing bacteria binds to the nucleic acid aptamer on the working electrode, causing a change in the interfacial electron transfer impedance;

[0036] (5) The impedance change is detected by the signal processing module, and the detection result related to the presence or concentration of Huanglongbing bacteria is output.

[0037] In addition, the present invention also provides a citrus Huanglongbing (HLB) detection system, including the aforementioned microfluidic biosensor, a micro-injection pump for driving the sample liquid, and an intelligent terminal and supporting application for receiving, displaying and / or analyzing the detection results.

[0038] The microfluidic biosensor for detecting the outer membrane protein OmpA of Huanglongbing bacteria was prepared by the following method:

[0039] (1) Fabrication of microfluidic chip mold: The microchannel pattern containing the spiral separation channel, the interdigitated working electrode area and the detection cavity was drawn using CAD software; SU-8 negative photoresist was spin-coated on a clean silicon wafer, and after pre-baking, mask alignment exposure, post-baking, development and hard baking, a positive mold with raised microstructure was obtained;

[0040] (2) Replication and processing of PDMS flow channel layer: PDMS prepolymer and curing agent are mixed at a weight ratio of 10:1, degassed, poured into a mold, cured at 85 ℃ for 2 hours, and peeled off to obtain PDMS layer with microchannel structure; holes are drilled at the corresponding positions to form fluid inlet and outlet;

[0041] (3) Modification and integration of working electrode: The MXene@AgNPs / Apt / MCH modified working electrode prepared according to the above method is precisely placed into the detection cavity on the PDMS layer; at the same time, the pre-prepared metal interdigitated working electrode sheet is aligned with the corresponding position of the flow channel placed in the concentration zone.

[0042] (4) System packaging and integration: The PDMS flow channel layer with the working electrode is bonded and sealed to another PDMS cover plate or glass substrate with flow guide holes and working electrode interface after oxygen plasma treatment; the fluid interface is connected to the external micro-injection pump through PTFE conduit; the working electrode lead is connected to the external portable electrochemical analysis module and Bluetooth transmission circuit board; finally, all components are fixed in the customized housing to complete the sensor assembly.

[0043] The beneficial effects of this invention are as follows:

[0044] 1. The probe constructed using aptamers as recognition elements and MXene@AgNPs composite material as signal amplification substrate in this invention achieves highly specific capture and highly sensitive electrical signal conversion of target proteins, laying the foundation for core detection performance.

[0045] 2. The microfluidic chip highly integrates sample pretreatment, detection and output modules, simplifying operation to "sample addition and testing", realizing full-process automation, and is suitable for non-professionals to use in the field.

[0046] 3. The entire testing process is rapid, meeting the urgent need for immediate initial screening in the field, facilitating timely detection and treatment of diseased trees, and effectively preventing the spread of the epidemic. The low cost of aptamer synthesis and microfluidic chip production makes it suitable for large-scale on-site screening and promotion at the grassroots level and in the field.

[0047] 4. Microfluidic chips provide a standardized, closed detection environment, effectively reducing matrix interference and operational errors. Combined with high-performance probes, this ensures high repeatability and reliability of detection, supporting prevention and control decisions. Attached Figure Description

[0048] Figure 1 This invention relates to the fabrication principle and detection process of a microfluidic biosensor chip for detecting the outer membrane protein OmpA of Huanglongbing bacteria.

[0049] Figure 2 It is a graph of the ultraviolet absorbance of the nucleic acid aptamer library obtained in each round of screening;

[0050] Figure 3 The affinity curves of aptamers SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4 with OmpA are shown.

[0051] Figure 4 Here is a scanning electron microscope (SEM) characterization image of MXene, the material provided by this invention;

[0052] Figure 5 These are X-ray diffraction patterns of MXene and MXene@AgNPs;

[0053] Figure 6 These are the Zeta potentials of MXene, MXene@AgNPs, and MXene@AgNPs / Apt;

[0054] Figure 7 This is a CV test image of the fabrication process of the MXene@AgNPs / Apt / MCH working electrode;

[0055] Figure 8This is a graph showing the CV curve changes of the constructed electrochemical biosensor for the detection of OmpA protein;

[0056] Figure 9 This is a linear relationship graph of the constructed electrochemical biosensor for the detection of OmpA protein;

[0057] Figure 10 This is a schematic diagram of the focusing working electrode of the present invention;

[0058] Figure 11 This is a schematic diagram of the microfluidic device described in this invention.

[0059] The diagram is labeled as follows: Sample inlet 1, Sheath flow inlet 2, Spiral microchannel 3, Waste liquid outlet 4, Electrochemical sensing working electrode 5, Separation zone 6, Concentration zone 7, Detection zone 8, Substrate 9, Interdigitated electrode 10. Detailed Implementation

[0060] The present invention will be further described below with reference to specific embodiments. The following are examples of implementation of the present invention and are not intended to limit the invention. Any modifications, substitutions, and improvements made based on the present invention are included within the scope of protection of the present invention. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; unless otherwise specified, the experimental materials used are conventional biochemical reagents that can be purchased commercially.

[0061] Example 1

[0062] This embodiment involves the screening of nucleic acid aptamers for the outer membrane protein OmpA of Huanglongbing (HLB).

[0063] This invention is based on the BLI-SELEX aptamer screening method. The Ni-NTA sensor disk is placed on a pre-wetted plate and then placed in the instrument. Following the steps of "equilibration-curing-equilibration-binding-dissociation," the sample placement is edited: wells A1 and B1 are set to Baseline 1, and PBS buffer at pH 7.4 is added for 180 s; wells A2 and B2 are set to Loading, and OmpA protein solution (400 nmol / L) with an HIS tag is added to PBS buffer at pH 7.4 for 600 s; wells A3 and B3 are set to Baseline 2, and PBS buffer at pH 7.4 is added for 180 s; wells A4 and B4 are set to Association, and 800 nmol / L DNA library solution is added for 300 s; wells A5-A9 and B5-B9 are set to Dissociation, and PBS buffer at pH 7.4 is added for 180 s per well. The volume of liquid added to each well is 200 µL. Then place the sample plate into the instrument and close the instrument door. Run the screening program to collect the DNA dissociated from columns 6-9 and store it at 4 °C.

[0064] The selected products were subjected to PCR amplification, and the screening process was repeated for a total of 5 rounds. After each round of screening, the DNA solutions obtained from dissociation in columns 6-9 of a 96-well plate were collected, mixed, and used as templates for PCR amplification.

[0065] The PCR reaction system consisted of 1 μL template, 1 μL primer 1 (20 μmol / L), 1 μL primer 2 (20 μmol / L), 25 μL Premix Taq (LA Taq Version 2.0 plus dye), and 23 μL sterile water. The reaction program was set as follows: 98 ℃ denaturation for 10 s, 55 ℃ annealing for 30 s, and 72 ℃ extension for 30 s, for a total of 30 cycles. After amplification, the absorbance at 260 nm was measured using a UV-Vis spectrophotometer, and UV absorption curves for each round of selection were plotted. The results are shown below. Figure 2 As shown.

[0066] Take 1 μL of the PCR product from the final round of screening, mix it with 1 μL of pMD18-T vector, 5 μL of sterile water, and 5 μL of Solution I, and ligate at 16 ℃ for 30 min. Take 2 μL of the ligation product and mix it with 50 μL of E. coli DH5α competent cells, incubate on ice for 10 min, add SOC medium, and culture at 37 ℃ with shaking for 3 h. Spread the culture on LB solid medium (tryptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L, and agar 20 g / L) containing X-Gal (20 mg / mL), IPTG (24 mg / mL), and ampicillin (100 μg / mL). Select positive single clones by blue-white screening, and extract plasmids for sequencing. The following 4 nucleic acid aptamers were finally screened:

[0067] SEQ ID NO: 1: ATCCAGAGTGACGCAGCAAAGGTTCGTAGTGTTGTGTCCCTCTCGACCTCGCCCGGTATGGACACGGTGGCTTAGT;

[0068] SEQ ID NO: 2: ATCCAGAGTGACGCAGCAGCATCCGCTGGATGGCTACGACTTATATCTTGTGCAGTACTGGACACGGTGGCTTAGT;

[0069] SEQ ID NO: 3:ATCCAGAGTGACGCAGCACGACGCAGTATCCAGAGTGACGCAGCACGAAGGCCGCCCCTGGACACGGTGGCTTAGT;

[0070] SEQ ID NO: 4: ATCCAGAGTGACGCAGCAAGAGTGACTAAGCCACCGTGTCCACTAAGCCACCGTGTCCTGGACACGGTGGCTTAGT.

[0071] Example 2

[0072] This embodiment involves the determination of the affinity of the OmpA nucleic acid aptamer for the outer membrane protein of Huanglongbing (HLB).

[0073] After placing the SA sensor chip on a pre-wetted plate, it was loaded into the instrument. The binding kinetics assay program was set up according to the steps of "equilibration-curing-blocking-equilibration-binding-dissociation": Wells A1-F1 were Baseline 1 (180 s, adding pH 7.4 PBST buffer); A2-F2 were Loading (300 s, adding 100 nM biotinylated aptamer solution); A3-F3 were Quenching (120 s, adding 5 μg / mL biotin solution); A4-F4 were Baseline 2 (180 s, adding PBST buffer); A5-F5 were Association (600 s, adding OmpA protein solutions at concentrations of 1600 nM, 800 nM, 400 nM, 200 nM, and 100 nM, respectively); A6-F6 were Dissociation (600 s each, adding PBST buffer); the sample volume for each well was 200 μL.

[0074] After placing the sample plate into the instrument, the measurement program was run, and the reaction was carried out under oscillation conditions of 25 ℃ and 1000 rpm. After the experiment, the sensing curve was fitted using the instrument's accompanying data analysis software with a 1:1 binding model to calculate the binding kinetic parameters and equilibrium dissociation constant (KD). Figure 3 Affinity determination curves of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4 with OmpA.

[0075] Experimental results show that among the four aptamers screened, the aptamer with the sequence SEQ ID NO: 3 exhibits the highest affinity for the OmpA protein, and therefore it is the preferred recognition element for constructing a sensor.

[0076] Example 3

[0077] This embodiment involves the preparation of MXene@AgNPs, and the specific preparation process is as follows:

[0078] MXene was synthesized by etching Ti3AlC2 in an HCl / LiF solution to remove Al from the lamellar structure. 1.6 g LiF was premixed with 20 mL HCl in a PTFE container and stirred at 500 r / min for 10 min. Then, 1 g Ti3AlC2 was gradually and slowly added, and etching was performed at 50 °C for 48 h. After etching, the product was collected by centrifugation (3500 r / min, 5 min). Subsequently, 1 M HCl was added to the product to remove LiF, and this process was repeated until the supernatant was colorless. The supernatant was washed with deionized water until the pH ≥ 6, precipitated, and sonicated under nitrogen and an ice-water bath for 2 h. The supernatant was then collected by centrifugation at 3500 r / min for 30 min. Finally, the supernatant was freeze-dried under vacuum for 48 h to obtain MXene powder for later use. Scanning electron micrographs of the material are shown below. Figure 4 As shown.

[0079] 10 mg of MXene powder was sonicated in 10 mL of water for 5 min, and then 200 µL of AgNO3 aqueous solution (0.1 M) was slowly added to the MXene solution. The mixture was stirred for 30 min, sonicated for 10 min, and then centrifuged at 8000 r / min for 10 min. The mixture was washed three times with deionized water. The collected precipitate was freeze-dried under vacuum for 48 h to obtain MXene@AgNPs for further use. The XRD pattern of the MXene@AgNPs material is shown below. Figure 5 As shown.

[0080] Example 4

[0081] This embodiment relates to the fabrication of the working electrode (MXene@AgNPs / Apt / MCH working electrode):

[0082] 20 μL of 3 mg / mL MXene / AgNPs solution was dropped onto the working electrode and incubated at room temperature for 1 h. Then, 20 μL of 1 μM thiolated aptamer solution (SEQ ID NO: 3) was added to the working electrode surface and incubated at room temperature for 12 h. The electrode was washed three times with PBS. 20 μL of 2 mM 6-mercapto-1-hexanol (MCH) solution was added to block nonspecific sites, and the electrode was incubated at room temperature for 2 h to reduce nonspecific binding. The electrode was washed three times with PBS. The zeta potential of the MXene@AgNPs / Apt material is as follows: Figure 6 As shown, the CV characterization of the MXene@AgNPs / Apt / MCH electrode is as follows: Figure 7 As shown.

[0083] Example 5

[0084] This embodiment relates to the detection and anti-interference capability test of OmpA using the MXene@AgNPs / Apt / MCH working electrode prepared in Example 4.

[0085] Different concentrations of OmpA were added dropwise to the surface of the MXene@AgNPs / Apt / MCH working electrode. After reacting for 30 minutes, the electrode was washed three times with PBS. Cyclic voltammetry was performed using an electrochemical workstation with the following parameters: scan rate 100 mV / s, measurement range -0.2 to 0.4 V. The electrochemical responses of different protein concentrations were detected, and the results are shown below. Figure 8 , Figure 9 As shown. Figure 9 The standard curve for detecting the outer membrane protein OmpA of Huanglongbing bacteria using the electrochemical biosensor developed in this invention is shown. The equation is y = -1E-06x + 0.0009, and the correlation coefficient is R. 2 =0.9947. 1.0 g of healthy citrus leaves were added to 10 mL of pre-chilled PBS extraction buffer (pH 7.4), thoroughly ground in an ice bath, and centrifuged at 8000 rpm for 10 minutes. The supernatant was collected and filtered through a microporous membrane to obtain the healthy leaf matrix solution. This solution was serially diluted to prepare spiked samples of different concentrations. Five replicates were set up for each concentration, and the same apparatus was used for testing to calculate the recovery rate and relative standard deviation (RSD). The results are shown in Table 1.

[0086] Table 1. Results of spiked recovery experiment of OmpA protein in healthy citrus leaf matrix (n=5)

[0087]

[0088] Experimental results show that, despite the complex plant matrix background, the microfluidic biosensor constructed in this invention still has high accuracy and high repeatability (RSD<10%) in detecting the target protein OmpA.

[0089] Example 6

[0090] This embodiment relates to a method for fabricating the microfluidic biosensor described in this invention. The fabrication process is as follows:

[0091] (1) Fabrication of microfluidic chip mold: The microchannel pattern containing the spiral separation channel, the interdigitated working electrode area and the detection cavity was drawn using CAD software; SU-8 negative photoresist was spin-coated on a clean silicon wafer, and after pre-baking, mask alignment exposure, post-baking, development and hard baking, a positive mold with raised microstructure was obtained;

[0092] (2) Replication and processing of PDMS flow channel layer: PDMS prepolymer and curing agent are mixed at a weight ratio of 10:1, degassed, poured into a mold, cured at 85 ℃ for 2 hours, and peeled off to obtain PDMS layer with microchannel structure; holes are drilled at the corresponding positions to form sample inlet, sheath flow inlet and waste liquid outlet;

[0093] (3) Modification and integration of working electrode: The MXene@AgNPs / Apt / MCH modified working electrode prepared according to the method in Example 4 above is precisely placed into the detection cavity on the PDMS layer; at the same time, the pre-prepared interdigitated working electrode sheet is aligned with the corresponding position of the flow channel placed in the concentration zone. The schematic diagram of the focused working electrode is shown in Figure 4. Figure 10 As shown in the figure, the interdigitated electrode array in the concentration zone illustrates the dielectrophoretic focusing principle of bacteria. The parallel diagonal lines in the figure represent interdigital pairs, indicating that the non-uniform electric field they generate focuses the dispersed target bacteria (as shown by the arrow trajectory) in the channel to the central streamline and guides them to flow towards the detection zone. The microfluidic device structure diagram is shown below. Figure 11 As shown.

[0094] (4) System packaging and integration: Align the PDMS flow channel layer with the working electrode with the PMMA fixture at the inlet and outlet, and tighten the screws to seal it tightly; connect the fluid interface to the external micro-injection pump through a polytetrafluoroethylene (PTFE) conduit; connect the working electrode lead to the external portable electrochemical analysis module and Bluetooth transmission module; finally, fix all components in the customized housing to complete the sensor assembly.

[0095] Example 7

[0096] This embodiment relates to the application of the microfluidic biosensor for detecting the outer membrane protein OmpA of Huanglongbing bacteria.

[0097] Inject the plant tissue extract through the sample inlet, and at the same time inject the sheath fluid through the sheath flow inlet at a higher flow rate. The two converge and flow in the spiral separation zone. Based on the synergistic effect of Dean flow and inertial focusing, large particle impurities such as plant tissue fragments in the sample are migrated and discharged to the outer waste liquid outlet, while the fluid containing the target bacteria is restricted to the inner flow channel and transported to the concentration zone. In the concentration zone, by applying an alternating current voltage with specific parameters to the interdigitated working electrodes, a positive dielectrophoretic force (p-DEP) is generated to efficiently capture and enrich the Xanthomonas citri subsp. citri bacterial cells flowing through to the center line of the microchannel, forming a concentrated bacterial liquid flow. This concentrated liquid flow is then transported to the detection zone. In the detection zone, the OmpA protein on the surface of the bacteria binds to the specific aptamer immobilized on the MXene@Ag / Apt / MCH modified working electrode, resulting in an increase in the electron transfer impedance at the working electrode interface. This impedance change is measured by an integrated three-working electrode system, and the generated electrochemical signal is preliminarily processed and digitally converted by an external circuit board, and then wirelessly transmitted to the smartphone terminal through the Bluetooth module.

[0098] Example 8

[0099] This example relates to the accuracy and applicability of the microfluidic biosensor for detecting the outer membrane protein OmpA of Xanthomonas citri subsp. citri in the detection of actual field samples, and is compared with the gold standard qPCR. The biosensor prepared in Example 6 was used.

[0100] Randomly collect 40 field samples from citrus production areas, covering two varieties of Shatangju and Wogan, 20 samples each. The samples include various phenotypes from asymptomatic to typical yellowing and mottling. Take some sample tissues and detect them by the standard real-time fluorescence quantitative PCR method (primer pair: CLas-4G / HLBr, 5’-AGTCGAGCGCGTATGCGAAT-3’ / 5’-GCGTTATCCCGTAGAAAAAGGTAG-3’). According to the Ct values detected by qPCR, all samples were pre-divided into three groups: strongly positive group (Ct value ≤ 28), weakly positive group (28 < Ct value ≤ 35), negative group (Ct value > 35 or not detected).

[0101] Table 2. Comparison of the detection results of the sensors of the present invention for different varieties of citrus field samples (n = 20 each) with the qPCR method

[0102]

[0103] The principle of the present invention is as follows:

[0104] This invention utilizes high-affinity, high-specificity nucleic acid aptamers obtained through screening as molecular recognition elements, which are covalently immobilized on the surface of a working electrode modified with MXene@AgNPs nanocomposite material via thiol-gold bonds. MXene provides high conductivity and a large specific surface area, while Ag nanoparticles further enhance electron transport capabilities, together constructing a highly sensitive signal conversion interface.

[0105] The microfluidic biosensor consists of three parts connected in series: a separation zone, a concentration zone, and a detection zone. The separation zone has two inlets and utilizes the synergistic effect of Dean flow and inertial focusing to achieve size-dependent separation. Large particles are focused by strong inertial force to a specific equilibrium position on the outer wall of the channel and are precisely guided to the waste liquid outlet along the spiral channel. Small particles containing bacteria flow along the channel to the next zone. The second zone is the concentration zone, where positive mesoelectrophoresis (p-DEP) is generated by applying an AC voltage to the interdigitated working electrode. The p-DEP force pushes the bacteria towards the center line of the microchannel, achieving efficient concentration. Fluid without bacteria flows to the waste liquid outlet through the outer microchannel. The last zone is the detection zone, which holds the modified MXene@AgNPs / Apt / MCH working electrode.

[0106] When a sample containing the target Huanglongbing bacteria flows through the detection area, the OmpA protein on the bacterial outer membrane specifically binds to the aptamer, forming a steric hindrance and charge repulsion layer on the working electrode surface. This hinders electron transfer, leading to a significant increase in electrochemical impedance. The increase in impedance is positively correlated with bacterial concentration within a certain range. The integrated microfluidic chip achieves automatic sample purification through the inertial hydrodynamic field within the helical channel and efficient in-situ enrichment of bacteria through a dielectrophoretic force field, greatly improving detection sensitivity and anti-interference capability. Finally, the impedance signal is measured by a portable device and wirelessly transmitted, enabling integrated, rapid, on-site detection from sample processing to result reporting.

[0107] Matters not covered in this invention are common knowledge.

[0108] The above embodiments are only for illustrating the technical concept and features of the present invention, and are intended to enable those skilled in the art to understand the content of the present invention and implement it accordingly. They should not be construed as limiting the scope of protection of the present invention. All equivalent changes or modifications made in accordance with the spirit and essence of the present invention should be covered within the scope of protection of the present invention.

Claims

1. A microfluidic biosensor for detecting Huanglongbing (HLB) of citrus, characterized in that, include: The microfluidic chip has an integrally formed separation zone, a concentration zone, and an electrochemical detection zone that are fluidly connected in sequence; The separation zone is a spiral microchannel, which has at least one sample inlet, at least one sheath flow inlet, at least one waste liquid outlet, and at least one target liquid outlet leading to the concentration zone; The concentration zone is equipped with an array of interdigitated working electrodes for generating dielectric force, the inlet of which is connected to the target liquid outlet of the separation zone, and the outlet of which is connected to the electrochemical detection zone. An electrochemical sensing working electrode is provided in the electrochemical detection area. The working electrode surface of the electrochemical sensing working electrode is sequentially modified with an MXene@AgNPs nanocomposite layer, a nucleic acid aptamer layer that specifically binds to the Huanglongbing bacteria outer membrane protein OmpA, and a blocking agent layer. The system also includes a signal processing module, which is electrically connected to the electrochemical sensing working electrode, for detecting and processing changes in electrochemical signals caused by the binding of the nucleic acid aptamer to the OmpA protein, and outputting detection results related to the presence of Huanglongbing bacteria.

2. The microfluidic biosensor according to claim 1, characterized in that, The nucleic acid aptamer is a sequence capable of specifically binding to the outer membrane protein OmpA of Huanglongbing bacteria, and is selected from one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4 sequences.

3. The microfluidic biosensor according to claim 2, characterized in that, The nucleic acid aptamer is the sequence shown in SEQ ID NO:

3.

4. The microfluidic biosensor according to claim 1, characterized in that, The working electrode is prepared by the following method: (1) Preparation of MXene@AgNPs nanocomposites: LiF was premixed with HCl and stirred; then Ti3AlC2 powder was gradually added for etching. After etching, the product was collected by centrifugation; 1M HCl was added to remove LiF until the supernatant was colorless, and then washed with ultrapure water until the pH of the supernatant was ≥6; the precipitate was ultrasonically treated with nitrogen and ice water bath, and the supernatant was collected by centrifugation and freeze-dried for 48h to obtain MXene powder for later use. MXene powder was dispersed in water, and silver nitrate solution was added to react with it. After centrifugation, washing and drying, MXene@AgNPs nanocomposite material was obtained. (2) Take MXene@AgNPs dispersion and drop it onto the working electrode. After drying, take thiolized aptamer solution and add it to the surface of the working electrode and incubate. Then add 6-mercapto-1-hexanol solution and incubate. After incubation, wash to obtain the working electrode.

5. The microfluidic biosensor according to claim 1, characterized in that, The electrochemical sensing working electrode is a screen-printed working electrode, and its working electrode is a carbon working electrode; the sealing agent is 6-mercapto-1-hexanol.

6. The microfluidic biosensor according to claim 1, characterized in that, The substrate of the microfluidic chip is polydimethylsiloxane.

7. The microfluidic biosensor according to claim 1, characterized in that, The signal processing module includes a wireless transmission unit for sending the detection results to a smart terminal for display.

8. The application of a nucleic acid aptamer in the preparation of a sensor or detection reagent for detecting Huanglongbing (HLB) of citrus, characterized in that, The sequences of the nucleic acid aptamers are shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO:

4.

9. A method for rapid field screening of citrus Huanglongbing pathogen, characterized in that, The microfluidic biosensor according to any one of claims 1 to 7 comprises the following steps: (1) Take the leaves or petioles of citrus, grind them and mix them with buffer solution, filter to obtain the sample solution to be tested, inject the sample solution to be tested into the sample inlet, and at the same time inject the sheath fluid at a higher flow rate. The sample solution to be tested and the sheath fluid flow in the spiral separation zone; the ratio of the injection rate of the sample solution to the injection rate of the sheath fluid is 1:

5. (2) In the separation zone, large particulate impurities in the sample solution are discharged to the outer waste liquid outlet by using the inertial focusing effect, and the bacterial solution flows through the target liquid outlet into the concentration zone; (3) In the concentration zone, by applying an AC voltage of 6 V and a frequency of 6 MHz to the interdigitated working electrode array, a dielectrophoretic force is generated, which captures and enriches the flowing bacterial solution to the center line of the microchannel, forming a concentrated bacterial solution and transporting it to the electrochemical detection zone. (4) In the electrochemical detection zone, the concentrated bacterial solution enters the detection zone. If the concentrated bacterial solution contains Huanglongbing bacteria, the OmpA protein on the surface of Huanglongbing bacteria binds to the nucleic acid aptamer on the working electrode, causing an increase in the interfacial electron transfer impedance. (5) The impedance change is detected by the signal processing module and compared with the pre-established standard curve or threshold to give qualitative judgment and semi-quantitative analysis results.

10. A detection system for Huanglongbing (HLB) of citrus, characterized in that, include: The microfluidic biosensor according to any one of claims 1 to 7; A micro-injection pump used to drive sample solutions; In addition, a smart terminal and supporting application for receiving, displaying and / or analyzing the detection results.

Images