Preparation method and application of dual-targeting tumor temperature-sensitive lipid nanoparticles
By designing multifunctional thermosensitive liposomes, dual-targeting and synergistic therapy of the tumor microenvironment was achieved, solving the problems of tumor immunosuppression and CRISPR-Cas9 delivery bottlenecks, activating systemic anti-tumor immune responses, and improving treatment efficacy.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- TIANJIN POLYTECHNIC UNIV
- Filing Date
- 2026-01-20
- Publication Date
- 2026-05-12
AI Technical Summary
Existing technologies struggle to effectively address the immunosuppression of the tumor microenvironment, the delivery bottleneck of the CRISPR-Cas9 system, and the limitations of photothermal therapy, resulting in poor tumor treatment outcomes and a high recurrence rate.
A multifunctional thermosensitive liposome was designed, integrating dual targeting of the tumor microenvironment, photothermal-triggered thermosensitive controlled release, CRISPR-Cas9-mediated LDHA gene editing, and photothermal ablation functions, achieving synergistic drug release and treatment through near-infrared light excitation.
It achieves precise remodeling of the tumor microenvironment, activates the systemic anti-tumor immune response, significantly enhances the therapeutic effect, and reduces the risk of tumor recurrence.
Smart Images

Figure CN122005456A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, specifically to a multifunctional nanomedicine delivery system for tumor treatment. More specifically, this paper introduces a multifunctional thermosensitive liposome nanocarrier for synergistic tumor therapy. This carrier integrates targeted delivery, gene editing, photothermal effects, and immunomodulatory functions. This strategy aims to effectively activate and enhance the body's anti-tumor immune response through the synergistic effect of photothermal therapy and metabolic intervention. This method can not only directly eliminate tumors but also fundamentally reshape the tumor immune microenvironment, providing a key tool and innovative strategy for improving the response rate and durability of existing immunotherapies. Background Technology
[0002] A major challenge in modern cancer treatment is the immunosuppressive tumor microenvironment (TME), which leads to treatment resistance. A promising strategy to break down the immunosuppression of the TME is to combine immunotherapy with tumor metabolic reprogramming. The core of this approach is targeting lactate dehydrogenase (LDHA), a key enzyme in the "Warberg effect." Excess lactate produced by LDHA catalyzes acidification of the TME, a key driver of impaired immune cell function and immunosuppression. Therefore, inhibiting LDHA holds the potential to reshape the TME and improve treatment efficacy.
[0003] Studies have shown that high concentrations of lactate and a low pH environment in the tumor microenvironment severely inhibit the function of T cells and natural killer (NK) cells, while promoting the infiltration of myeloid-derived suppressor cells (MDSCs) and regulatory T cells (Tregs), collectively forming a strong immunosuppressive barrier. Therefore, targeting the LDHA gene to reduce lactate production holds promise for improving the tumor microenvironment and enhancing anti-tumor immune responses, providing new insights for tumor immunotherapy.
[0004] CRISPR-Cas9, as a revolutionary gene-editing tool, offers unprecedented opportunities for precise regulation of LDHA gene expression and remodeling of tumor metabolism due to its high specificity and efficiency. However, despite its enormous potential, the clinical application of the CRISPR-Cas9 system is still constrained by a series of severe delivery bottlenecks. These challenges include its poor biostability in vivo, insufficient targeting efficiency to tumor tissues, and difficulty in achieving effective endosome escape after endocytosis. These factors collectively and seriously hinder its clinical translation process.
[0005] Photothermal therapy (PTT), as a spatiotemporally controllable non-invasive physical ablation technique, has shown great potential in the field of cancer treatment. Its core advantage lies in its ability to induce immunogenic cell death (ICD), effectively transforming immunologically "cold" tumors into "hot" tumors that can be recognized by the immune system by releasing tumor-associated antigens (TAAs) and damage-associated molecular patterns (DAMPs), thereby initiating an adaptive anti-tumor immune response. However, as a local therapy, PTT alone is limited by the tissue penetration depth of near-infrared light, often making it difficult to completely eliminate tumors, let alone inhibit distant metastasis, leading to a high risk of tumor recurrence.
[0006] While nanodelivery systems have been widely used in gene therapy and photothermal therapy, a smart platform that can synergistically integrate tumor metabolic reprogramming, photothermal therapy, and immune activation remains a gap in the field. Of particular note is the lack of reports on a multifunctional liposome system capable of simultaneously achieving dual targeting of the tumor microenvironment, photothermal-triggered controlled release, and the synergistic effects of gene editing and physical ablation.
[0007] This invention designs and constructs a novel multifunctional nanodelivery system capable of precisely targeting tumors, reshaping the immunosuppressive microenvironment through CRISPR-Cas9-mediated LDHA gene editing, and synergizing with photothermal therapy to potently activate systemic anti-tumor immunity. This work provides an innovative and feasible strategy for developing next-generation precision cancer immunotherapies. Summary of the Invention
[0008] To address the limitations of existing technologies, this invention provides a novel multifunctional thermosensitive liposome. This nanoplatform integrates four core functions: (1) dual-targeted delivery to the tumor microenvironment; (2) photothermal-triggered thermosensitive controlled release; (3) CRISPR-Cas9-mediated LDHA gene editing; and (4) photothermal ablation. By deeply synergizing metabolic reprogramming with photothermal immunotherapy, this system ultimately achieves a therapeutic synergy of "1+1>2," providing a novel multi-synergistic strategy for precision tumor treatment.
[0009] The purpose of this invention is to provide an intelligent, multifunctional, thermosensitive liposome. This platform, through dual modification with ginsenosides and the AS1411 nucleic acid aptamer, incorporates a precise "nano-dual-key" system, achieving hierarchical targeting of the tumor microenvironment and cancer cells. Its core design incorporates two key therapeutic payloads: a CRISPR-Cas9 gene editing system and the near-infrared photothermal agent IR-1048. Under single near-infrared light (NIR) excitation, this system performs a parallel dual task: on the one hand, the IR-1048-mediated photothermal effect not only directly ablates tumor cells, but more importantly, it induces immunogenic cell death to release antigen signals; on the other hand, the same photothermal effect triggers a liposome membrane phase transition, precisely releasing the CRISPR-Cas9 system to silence the LDHA gene, thereby dismantling the tumor's immunosuppressive barrier.
[0010] Ultimately, this design forms a synergistic closed loop of "1+1>2": LDHA gene silencing and PTT-induced ICD mutually enhance each other, jointly transforming "cold" tumors into "hot" tumors and powerfully activating a sustained systemic anti-tumor immune response. To achieve the above objectives, this invention adopts the following technical solution:
[0011] The tumor microenvironment dual-targeting thermosensitive liposome provided by the present invention comprises the following components: (1) thermosensitive lipids, used to construct the liposome framework and provide temperature-sensitive properties; (2) cationic lipids, used for nucleic acid delivery; (3) cholesterol, used to enhance the structural stability of the liposome; (4) polyethylene glycol modified lipids, used to increase the circulation time of the liposome; (5) surface-modified ginsenosides, used to target glucose transporter (GLUT) highly expressed on tumor cells; (6) surface-modified AS1411 nucleic acid aptamer, used to specifically bind to nucleolin protein overexpressed on its surface; (7) internally loaded CRISPR-Cas9 gene editing system, used to target and edit the LDHA gene; (8) internally loaded near-infrared photothermal agent IR-1048, used for photothermal therapy; and (9) internally loaded perfluoropentane (PFP), used for thermosensitive controlled release.
[0012] The mechanism of action of the tumor microenvironment dual-targeting thermosensitive liposomes provided by this invention includes: First, ginsenosides and AS1411 nucleic acid aptamers endow the liposomes with dual targeting capabilities, enhancing their accumulation at the tumor site; Second, under near-infrared light irradiation, IR-1048 generates a photothermal effect, raising the local temperature and triggering the liquid-gas phase transition of perfluoropentane, leading to the destruction of the liposome structure and the release of the CRISPR-Cas9 system and IR-1048; The released CRISPR-Cas9 system edits the LDHA gene, inhibiting lactate production and improving the tumor immunosuppressive microenvironment; Simultaneously, the photothermal effect generated by IR-1048 directly kills tumor cells and induces immunogenic cell death; Finally, the improved tumor microenvironment and the released tumor antigens synergistically activate the anti-tumor immune response.
[0013] The nanoplatform constructed in this invention realizes a paradigm shift from simple combined therapy to highly integrated synergistic therapy, specifically reflected in the following five aspects: (1) Multifunctional integration: Integrating functions such as targeted delivery, thermosensitive controlled release, gene editing, photothermal therapy and immune activation into a single nanoplatform to achieve multimodal synergistic therapy; (2) Dual-targeting strategy: Through the synergistic effect of ginsenosides and AS1411 nucleic acid aptamers, significantly improving the enrichment of liposomes at the tumor site and reducing toxic side effects on normal tissues; (3) Precise controlled release: Utilizing a thermosensitive controlled release mechanism triggered by near-infrared light to achieve spatiotemporal specific release of therapeutic drugs; (4) Metabolic reprogramming: Precisely editing the LDHA gene through the CRISPR-Cas9 system to inhibit lactate production from the source, thereby improving the tumor immune microenvironment; (5) Multiple synergistic effects: The synergistic effect of LDHA gene editing improving the tumor microenvironment and photothermal therapy can significantly enhance the anti-tumor immune response and achieve a therapeutic effect of "1+1>2". Attached Figure Description
[0014] Figure 1 Synthetic pathway and anti-tumor mechanism of Rg3 / AS1411-lipo-IR-PFP-RNP: This system mediates a synergistic therapeutic process of PFP phase transition, immunogenic cell death and gene editing through dual targeting and laser response.
[0015] Figure 2 (a) Particle size and (b) Potential distribution of thermosensitive liposomes with different compositions.
[0016] Figure 3 Transmission electron microscopy (TEM) images of thermosensitive liposomes with different compositions.
[0017] Figure 4 Optical microscopy images of liposomes undergoing phase transitions with increasing temperature after (a) external water bath heating and (b) near-infrared laser irradiation (scale bar: 100 μm).
[0018] Figure 5 Release curves of thermosensitive liposomes with and without laser (a: IR-1048; b: CRISPR-Cas9 system).
[0019] Figure 6 Temperature change curves of thermosensitive liposomes under near-infrared light irradiation (a: different concentrations; b: different powers).
[0020] Figure 7 The temperature changes of thermosensitive liposomes under five heating-cooling cycles are shown.
[0021] Figure 8 (a) Heating-cooling curve and (b) Photothermal time constant.
[0022] Figure 9 Confocal images of thermosensitive liposomes with different formulations being phagocytosed by 4T1 cells.
[0023] Figure 10 Flow cytometry analysis of phagocytosis of thermosensitive liposomes with different formulations by 4T1 cells.
[0024] Figure 11 Evaluation of the efficiency of temperature-sensitive liposome-mediated LDHA gene editing (a: qPCR; b: Western blot; c: LDH enzyme activity assay).
[0025] Figure 12 The effects of thermosensitive liposomes on (a) the inhibition of lactate production in tumor cells and (b) changes in culture medium pH.
[0026] Figure 13 Evaluation of the therapeutic effect of photothermal combined with gene editing using thermosensitive liposomes under near-infrared light irradiation (a: MTT; b: flow cytometry apoptosis analysis; c: live / dead cell staining).
[0027] Figure 14 The effect of thermosensitive liposomes on inducing immunogenic cell death in tumor cells (a: CRT surface exposure; b: extracellular ATP release; c: HMGB1 exposure level).
[0028] Figure 15 In vivo imaging of thermosensitive liposomes in mice.
[0029] Figure 16 To evaluate the in vivo antitumor effect of thermosensitive liposomes. Detailed Implementation
[0030] This invention will be described in detail below with reference to specific technical solutions to ensure clarity and completeness. It should be noted that these embodiments are for illustrative purposes only and should not be construed as limiting the scope of protection of this invention. Any modifications and variations based on the essence of this invention that can be implemented by those skilled in the art without creative effort should fall within the scope of protection of this invention.
[0031] In the following preparation examples and embodiments, the abbreviations lipo, IR, and RNP refer to the ribonucleoprotein complex formed by the pre-assembly of Cas9 protein and sgRNA.
[0032] The multifunctional thermosensitive liposome of the present invention comprises the following core components:
[0033] Thermosensitive lipids: Selected from DPPC (dispalmitoylphosphatidylcholine), DSPC (distearylphosphatidylcholine), or HSPC (hydrogenated soybean phosphatidylcholine), these lipids have a specific phase transition temperature (Tm), which causes the liposomes to undergo a phase change after local heating in tumor tissue, increasing membrane fluidity and promoting the release of contents.
[0034] Cationic lipids: selected from DOTAP (1,2-dioleoyl-3-trimethylammonium-propane, bromide) or DOTMA (1,2-di-O-octadecenyl-3-trimethylammonium-propane, chloride), used for efficient delivery of nucleic acids.
[0035] Cholesterol: Enhances the mechanical strength and stability of the lipid bilayer, reduces drug leakage caused by serum proteins, and prolongs the circulation time in the body.
[0036] Polyethylene glycol modified lipids: Selected from DSPE-PEG2000 (1,2-distearate-sn-glycerol-3-phosphoethanolamine-polyethylene glycol 2000) or DMG-PEG2000 (1,2-dimyristico-rac-glycerol-3-methoxypolyethylene glycol 2000), which form a hydration layer on the surface of liposomes, reducing the adsorption of serum proteins and the recognition by the mononuclear macrophage system, and prolonging the circulation time of liposomes in vivo.
[0037] Targeting molecules: (1) "Broad-spectrum capture" ligands based on metabolic properties: Ginsenosides (preferably Rg3 or Rh2) target GLUT. Due to the Warburg effect, most tumor cells highly express GLUT to meet their huge energy needs. Therefore, ginsenosides act as a high-abundance "anchor point", enabling nanocarriers to bind extensively and initially on the surface of tumor cells, greatly increasing the chance of contact and residence with cells. (2) "High-specificity locking" ligands based on abnormal expression: AS1411 nucleic acid aptamer targets nucleolin on the cell membrane surface. Nucleolin surface expression is a highly specific marker that distinguishes tumor cells from normal cells. AS1411 acts like a high-precision "lock". Once the nanocarrier is captured by GLUT near the cell, it can find nucleolin and bind firmly with high affinity, thereby efficiently triggering endocytosis.
[0038] Therapeutic components: (1) CRISPR-Cas9 system: refers to a ribonucleoprotein complex composed of Cas9 protein and sgRNA targeting the LDHA gene, used to specifically edit the LDHA gene and inhibit lactate production; (2) IR-1048: a near-infrared photothermal agent that generates a photothermal effect under near-infrared laser irradiation to achieve photothermal therapy; (3) perfluoropentane: as a phase change material, it undergoes a liquid-gas phase change when the local temperature rises, expands in volume, destroys the liposome structure, and promotes the release of contents.
[0039] In the preferred embodiment, the mass ratio of each component is: thermosensitive lipid: cationic lipid: cholesterol / ginsenoside: polyethylene glycol modified lipid = 2-7: 0.5-5: 0.5-5 / 0.5-5: 0.5-5. This ratio can be adjusted within a certain range according to specific application requirements.
[0040] The multifunctional thermosensitive liposomes of the present invention can be prepared by the following steps:
[0041] Step 1: Preparation of the liposome skeleton
[0042] Liposomes were prepared using the classic thin-film dispersion method. First, thermosensitive lipids, cationic lipids, cholesterol / ginsenosides, and polyethylene glycol-modified lipids were dissolved together in an organic solvent at a predetermined mass ratio. Then, the solution was placed in a round-bottom flask and subjected to reduced-pressure rotary evaporation. After the organic solvent had completely evaporated, a uniform, transparent lipid film was obtained on the inner wall of the flask, ready for subsequent hydration steps.
[0043] Step 2: Loading IR-1048
[0044] First, IR-1048 and all the aforementioned lipid components were co-dissolved in an organic solvent at a predetermined mass ratio. A uniform lipid film was formed by rotary evaporation under reduced pressure. Subsequently, the film was hydrated with a buffer solution and subjected to ultrasonic treatment and multiple extrusions using a micro-extruder to finally obtain liposomes with uniform particle size loaded with IR-1048 and ginsenosides.
[0045] Step 3: Loading the PFP and CRISPR-Cas9 system (RNP)
[0046] An electrostatic adsorption-assisted ultrasonic emulsification method was employed. First, the electrostatic interaction between the cationic surface of liposomes and negatively charged CRISPR-Cas9 RNPs was utilized to achieve surface pre-enrichment of RNPs. Then, PFP was added to the mixture, and pulsed sonication was performed under ice bath conditions. The ultrasound emulsified the PFP into nanodroplets while simultaneously promoting liposome membrane restructuring, thereby efficiently co-encapsulating the PFP and surface-adsorbed RNPs into the liposome core. Finally, free components were removed through purification.
[0047] Step 4: Targeted Modification
[0048] The amino-modified AS1411 nucleic acid aptamer was covalently linked to the surface of liposomes (DSPE-PEG2000-COOH) using the classic EDC / NHS chemical coupling method. In short, the carboxyl groups on the liposome surface are activated by EDC / NHS, enabling them to react efficiently with the terminal amino group of the AS1411 aptamer to form a stable amide bond. After the reaction, unreacted substances are removed by dialysis or ultrafiltration to obtain the final targeted nanoplatform.
[0049] Step 5: Purification and Characterization
[0050] First, the crude nanoformulation is purified by ultrafiltration centrifugation to effectively remove unencapsulated drugs, uncovalently linked target molecules, and EDC / NHS reaction byproducts.
[0051] Subsequently, the purified product underwent comprehensive physicochemical characterization. Dynamic light scattering was used to determine its average hydrated particle size and Zeta potential. The Zeta potential was used to assess the surface charge and colloidal stability of the nanoparticles. Simultaneously, transmission electron microscopy was used to visually observe its morphology, size uniformity, and dispersion state to verify whether it formed the expected spherical vesicle structure.
[0052] The above description of specific embodiments of the present invention is intended for illustration and exposition, and is not intended to limit the scope of protection of the present invention. Based on the essence disclosed in the specification and drawings of the present invention, any equivalent substitutions, modifications or variations that are readily conceived by those skilled in the art, or the direct or indirect application of the technical solutions of the present invention to other related technical fields, should be considered to be included within the scope of patent protection sought by the present invention. Example
[0053] Example 1: Preparation of ordinary thermosensitive liposomes
[0054] DPPC, DOTAP, cholesterol, and DSPE-PEG2000 were dissolved in an organic solvent at a predetermined mass ratio, and a uniform lipid film was formed by rotary evaporation. Subsequently, PBS was added for hydration, and the film was then exfoliated using ultrasonic-assisted water bath treatment. Finally, the film was repeatedly extruded at room temperature using a microextruder to obtain basic liposomes with uniform particle size, which were stored at 4°C for later use.
[0055] Example 2: Preparation of Rg3-targeted thermosensitive liposomes
[0056] In this formulation, the present invention uses ginsenoside Rg3, which has both therapeutic and membrane-stabilizing effects, to replace cholesterol in traditional formulations. In short, DPPC, DOTAP, ginsenoside Rg3, and DSPE-PEG2000 are dissolved in an organic solvent. The mixture is then processed using the same steps as before: rotary evaporation to form a membrane, PBS hydration, water bath sonication, and micro-extrusion. The final product is named Rg3-targeted thermosensitive liposomes and stored at 4°C protected from light for later use.
[0057] Example 3: Preparation of Dual-Targeted Drug-Loaded Thermosensitive Liposomes
[0058] Lipid components (DPPC, DOTAP), ginsenoside Rg3, and IR-1048 were co-dissolved in an organic solvent and rotary evaporated to form a drug-loaded lipid film. This film was hydrated with PBS and initially sonicated, then mixed with PFP and subjected to probe sonication under ice bath conditions. Subsequently, Cas9-RNP and AS1411-DSPE-PEG2000 solutions were added to achieve targeted modification. Finally, the product was purified by centrifugation and resuspended in PBS to obtain dual-targeted drug-loaded liposomes. Figure 1 Store at 4℃ away from light.
[0059] Example 4: Characterization of multifunctional thermosensitive liposomes
[0060] (1) Particle size and morphology characterization: First, the particle size and potential of the prepared nanoparticles were analyzed by dynamic light scattering method. Figure 2(a) The results showed that the average particle sizes of the conventional thermosensitive liposomes (Chol-lipo) and the final dual-targeting drug-loaded liposomes (Rg3 / AS1411-lipo-IR-PFP-RNP) were 102 nm and 125 nm, respectively. Zeta potential analysis ( Figure 2 (b) revealed a key change: Chol-lipo exhibited a positive charge (+41 mV), while the surface charge of Rg3 / AS1411-lipo-IR-PFP-RNP was successfully reversed to a negative charge (-12 mV). Furthermore, transmission electron microscopy images ( Figure 3 This visually confirms that the Rg3 / AS1411-lipo-IR-PFP-RNP formulation exhibits a spherical morphology with uniform particle size distribution.
[0061] (2) PFP phase transition capability: The parallel control method was used to observe the samples. First, the samples were heated in a water bath. When different preset temperature points were reached, samples were taken and slides were prepared and observed under a microscope. At the same time, another identical sample (Rg3 / AS1411-lipo-IR-PFP-RNP) was irradiated with near-infrared laser and its temperature change was monitored in real time using an infrared thermal imager. When the temperature rose to the same target value as the water bath group, samples were taken and slides were prepared and observed under a microscope.
[0062] like Figure 4 As shown in (a), microbubble generation began to be observed when the temperature rose to 42°C, reaching a peak at 48°C. Near-infrared laser irradiation experiments indicate that this phase transition process can be remotely triggered. Figure 4 (b) The laser raised the system temperature to 47°C and induced microbubble generation consistent with water bath heating. These results demonstrate that the liposome possesses a precise phase transition window of 42-48°C, which can be remotely activated by near-infrared laser, laying the foundation for on-demand drug release.
[0063] (3) Drug release assessment: Rg3 / AS1411-lipo-IR-PFP-RNP was packaged in a pretreated dialysis bag and then immersed in a release medium containing pH 7.4 phosphate buffer. The entire system was placed in a 37°C constant-temperature shaker and continuously shaken at 100 rpm. Samples were taken at preset time points (0, 2, 4, 8, 12, 24, 48, and 72 h), and an equal volume of fresh release medium was added simultaneously to maintain system stability. The drug concentration of the samples was determined by UV-Vis spectrophotometry and a high-sensitivity BCA kit. The cumulative release rate was calculated, and a drug release curve was plotted.
[0064] The results are as follows Figure 5As shown, the system exhibits excellent stability under non-laser stimulation conditions, with a premature drug leakage rate of less than 41% within 72 hours. However, under near-infrared laser irradiation, the liposomes are rapidly activated, exhibiting highly efficient photothermal responsive release. Within 72 hours, IR-1048 ( Figure 5 (a) and RNP system ( Figure 5 (b) The cumulative release rates were as high as 89.52% ± 0.26% and 81.48% ± 4.01%, respectively. This "release-on-demand" characteristic confirms that the design can achieve precise spatiotemporal control of drug release.
[0065] (4) Photothermal Performance Evaluation: The photothermal performance of this liposome was systematically evaluated in this invention. Rg3 / AS1411-lipo-IR-PFP-RNP aqueous solutions loaded with different concentrations of IR-1048 (0, 3.125, 6.25, 12.5, 25, 50 μg / mL) were subjected to different power densities (0.5, 0.75, 1, 1.25, 1.5, 2 W / cm³). 2 The temperature changes of Rg3 / AS1411-lipo-IR-PFP-RNP (12.5 μg / mL) were monitored and recorded using an infrared thermal imager under 1064 nm laser irradiation. Five cycles of heating and cooling were conducted to evaluate the performance of Rg3 / AS1411-lipo-IR-PFP-RNP at 1 W / cm². 2 Photothermal stability under laser irradiation.
[0066] The study found that its heating effect exhibited a significant dependence on concentration and laser power. Within the test range, increasing the concentration and power allowed the system to reach a maximum temperature of 51.8℃. Figure 6 (a)) and 66.8℃ ( Figure 6 (b) Furthermore, no significant attenuation was observed in the photothermal conversion capacity of the liposomes during five consecutive laser heating-cooling cycles. Figure 7 These results collectively demonstrate that the nanoparticles possess highly efficient photothermal conversion capabilities and excellent photothermal stability. Furthermore, Figure 8 (a) The results show that the temperature of the system rapidly increased from 22.5℃ to 47.1℃ (ΔT=24.6℃) within 10 minutes. Based on this temperature rise curve and... Figure 8 (b) Calculations show that its photothermal conversion efficiency is as high as 63.28%, demonstrating its potential as a highly efficient photothermal agent.
[0067] Example 5: In vitro targeting verification
[0068] To evaluate the cellular uptake efficiency of multifunctional thermosensitive liposomes, mouse breast cancer 4T1 cells were selected for the study. 4T1 cells were co-incubated with lipo-IR-PFP-RNP and Rg3 / AS1411-lipo-IR-PFP-RNP (100 μg / mL, 1 mL) for 3, 6, and 9 h. Finally, the cell internalization was qualitatively visualized using confocal laser scanning microscopy (CLSM), and quantitatively analyzed by flow cytometry.
[0069] Qualitative observation results of CLSM ( Figure 9 The results showed that the 4T1 cells treated with dual-targeted liposomes (Rg3 / AS1411-lipo-IR-PFP-RNP) exhibited the strongest intracellular fluorescence signal, significantly higher than the untargeted (lipo-IR-PFP-RNP) control group. Furthermore, the intracellular fluorescence intensity in all groups increased with prolonged incubation time.
[0070] The flow cytometry quantification results were highly consistent with the CLSM observations. Figure 10 The dual-targeted Rg3 / AS1411-lipo-IR-PFP-RNP group exhibited the highest cellular uptake efficiency, with a significantly higher mean fluorescence intensity than the non-targeted control group, and all groups showed time-dependent uptake. These results collectively demonstrate that the dual-targeting strategy can effectively enhance the specific uptake of nanocarriers by cancer cells.
[0071] Example 6: Evaluation of in vitro LDHA gene editing efficiency
[0072] (1) LDHA Expression Inhibition: The LDHA gene editing efficiency of the CRISPR-Cas9 system was evaluated using 4T1 cells. Cells were co-incubated with Rg3 / AS1411-lipo-IR-PFP-RNP for 4 hours, then replaced with fresh medium, and specific groups were irradiated with near-infrared light for an additional 24 hours. Cells were then collected and washed twice with PBS. Total RNA was extracted using the Aidlab RNeasy centrifugation column method. The obtained RNA was treated with DNase I, and cDNA was synthesized using the TRUEscript reverse transcription premix kit. Finally, real-time quantitative PCR (qPCR) analysis was performed using SYBR Green dye. The relative expression level of the target gene was determined using a 22 -ΔΔCt The calculation is performed using the following method. The primer sequences are as follows:
[0073] LDHA forward primer: CTGGGGGTTCACGCGCTGA
[0074] LDHA reverse primer: ATCTCACTCCCCACAGCTCT
[0075] β-actin forward primer: GGACTCCTATGTGGGTGACG
[0076] β-actin reverse primer: CTTCTCCATGTCGTCCCAGT
[0077] qPCR analysis showed that ( Figure 11 (a) After near-infrared irradiation, the mRNA level of LDHA decreased by 45% in Rg3 / AS1411-lipo-IR-PFP-RNP. Consistent with this result, Western blot analysis ( Figure 11 (b) also confirmed that its protein expression level was significantly downregulated compared to the control group.
[0078] (2) LDH activity detection: When using the LDH activity detection kit to detect the intracellular LDH content, the specific operating steps are as follows: First, collect and lyse the cells, centrifuge them, and take the supernatant to obtain the total cell lysate as the sample to be tested. Then, establish a reaction system in a 96-well plate, mix the sample with the LDH detection working solution, incubate at room temperature in the dark for an appropriate time, add the stop solution, and immediately measure the absorbance at a wavelength of 450 nm.
[0079] Consistent with the downregulation of LDHA protein expression levels, its enzyme activity analysis ( Figure 11 (c) also shows that the LDH activity of Rg3 / AS1411-lipo-IR-PFP-RNP under laser irradiation decreased significantly by 63.4% compared with the control group.
[0080] (3) Lactic acid content: After collecting the cell culture supernatant, centrifuge to obtain the clarified solution, which is the supernatant sample. For intracellular samples, the culture medium should be discarded quickly, the cells should be washed with pre-cooled PBS, and then lysis buffer should be added immediately for lysis on ice. After centrifugation, the supernatant is collected to obtain the deproteinized cell lysate. Finally, the absorbance value is measured at a wavelength of 450 nm using a lactate detection kit.
[0081] The results of lactic acid determination showed that ( Figure 12 (a) Compared with the control group, the intracellular lactate concentration in the Rg3 / AS1411-lipo-IR-PFP-RNP+NIR group was significantly decreased, and the pH of the culture medium was correspondingly increased. Figure 12 (b) This indicates that the downregulation of LDHA effectively inhibits lactic acid production during glycolysis and improves the acidity of the local environment.
[0082] Example 7: Evaluation of the efficacy of in vitro cell therapy
[0083] The therapeutic effect of combined therapy with multifunctional thermosensitive liposomes was evaluated using a 4T1 cell model. The experiment included the following groups: a PBS control group, an Rg3 / AS1411-lipo-IR-PFP-RNP group, and corresponding laser treatment groups. The specific experimental procedure was as follows: after co-incubating Rg3 / AS1411-lipo-IR-PFP-RNP with cells for a certain period, the laser treatment groups were irradiated and cultured further. Cell viability was then evaluated using the MTT assay, Annexin V-FITC apoptosis detection kit, and Calcein-AM / PI live / dead cell staining method.
[0084] (1) MTT assay for cell viability: Figure 13 (a) The results showed that, under near-infrared light irradiation, the Rg3 / AS1411-lipo-IR-PFP-RNP formulation exhibited significant cytotoxicity against 4T1 cells, and the survival rate of 4T1 cells decreased to 15%.
[0085] (2) Apoptosis: Quantitative analysis by flow cytometry Figure 13 (b) clearly revealed the synergistic pro-apoptotic effect of each functional component. Under near-infrared light irradiation, Rg3 / AS1411-lipo-IR-PFP-RNP exhibited the strongest killing effect, resulting in a total apoptosis rate as high as 83.44%.
[0086] (3) Live / dead cell staining: Results of Calcein-AM / PI live / dead cell staining ( Figure 13 (c) indicates that photothermal therapy and gene editing have a synergistic killing effect. Compared with the control group, in cells treated with dual-targeting nanoparticles and near-infrared light, the red fluorescence signal of PI, representing dead cells, was dominant, while the green fluorescence of Calcein, representing living cells, was significantly reduced.
[0087] Example 8: Evaluation of immunogenic cell death in vitro
[0088] To assess the level of immunogenic cell death, 4T1 cells were co-incubated with Rg3 / AS1411-lipo-IR-PFP-RNP (100 μg / mL, 1 mL) for 4 h, followed by laser irradiation of the group with 1064 nm laser light for 5 min. Subsequently, immunofluorescence staining was used to detect the exposure of CRT on the cell surface and the release of HMGB1 from the cell nucleus; simultaneously, the amount of ATP released from the cell culture supernatant was measured using appropriate assay kits.
[0089] (1) Exposure to calreticulin: Figure 14(a) Staining results showed that after treatment with Rg3 / AS1411-lipo-IR-PFP-RNP in combination with laser, a significantly enhanced CRT green fluorescence signal appeared on the cell surface. In contrast, this signal was almost undetectable in the control group, which strongly demonstrates that the combined strategy of the present invention can efficiently trigger immunogenic cell death in tumor cells.
[0090] (2) ATP release: In addition to CRT exposure, the combination therapy also triggered a large release of ATP, a key damage-related molecular pattern. Figure 14 (b) The results showed that the ATP concentration in the supernatant of cells treated with Rg3 / AS1411-lipo-IR-PFP-RNP and laser reached 114.6 nM, which was about 4.2 times higher than that of the control group (27.52 nM), a typical characteristic of immunogenic cell death.
[0091] (3) HMGB1 release: Subcellular localization of HMGB1 was detected by immunofluorescence. Figure 14 (c)). The results showed that the combination therapy triggered a significant translocation of HMGB1 from the nucleus to the cytoplasm and extracellular space, while in the control group, HMGB1 was mainly enriched in the nucleus. Extranuclear release of HMGB1 is a classic late marker of ICD and provides a key signal for activating downstream antitumor immune responses.
[0092] Example 9: Animal in vivo imaging. First, a 4T1 tumor-bearing mouse model was established. Specifically, 4T1 cells (1×10⁻⁶) were used to create a tumor-bearing mouse model. 6 Inoculated into the right mammary fat pad of female Balb / c mice. The tumor was allowed to grow to approximately 80 mm in size. 3 Different formulations of multifunctional thermosensitive liposomes were injected into mice via the tail vein. In vivo imaging was performed at 2, 4, 8, 24, and 36 hours post-injection to assess their distribution within the body.
[0093] In vivo imaging results ( Figure 15 The results showed that at all observation time points, the fluorescence intensity of liposomes co-modified with Rg3 and AS1411 (Rg3 / AS1411-lipo-IR-PFP-RNP) at the tumor site was significantly higher than that of the unmodified control group (lipo-IR-PFP-RNP). This result indicates that the introduction of Rg3 / AS1411 endows liposomes with excellent active tumor targeting capabilities. Simultaneously, this enhanced tumor enrichment effect also suggests that this modification may help liposomes evade clearance by the reticuloendothelial system, thereby prolonging their circulation time in vivo and ultimately achieving more efficient tumor-targeted delivery.
[0094] Example 10: Animal Treatment
[0095] Log-phase murine 4T1 breast cancer cells were collected and hydrated with physiological saline at a concentration of 1 × 10⁻⁶ cells / mL. 6 The concentration was diluted and injected into the right mammary fat pad of Balb / c mice in a 1 mL syringe at a volume of 100 μL, thus forming an in situ tumor (l). st Tumor). After the first treatment, a suspension of breast cancer cells of the same density and volume was injected into the fat pad of the left mammary gland of mice, which became metastatic tumors (2). nd Tumor). The experiment was set up with 4 groups: Saline group (A), Saline+NIR group (B), Rg3 / AS1411-lipo-IR-PFP-RNP group (C), and Rg3 / AS1411-lipo-IR-PFP-RNP+NIR group (D) (2 mg / mL, 1.5 W / cm2, 10 min). During the treatment period, the tumor volume of mice was measured every two days and the weight change was recorded. Bilateral tumor growth curves and weight change curves were plotted.
[0096] Periodic measurements showed that, compared with the control group, the growth of both in situ and metastatic tumors in mice treated with a combination of Rg3 / AS1411-lipo-IR-PFP-RNP and near-infrared light was significantly inhibited. Mice were sacrificed 18 days after treatment, and tumors were dissected and photographed for analysis. Results ( Figure 16 The results clearly showed that this combination therapy also had a significant growth-inhibiting effect on metastatic tumors. Furthermore, no abnormal decrease in body weight was observed in any group of mice throughout the treatment process, indicating that the Rg3 / AS1411-lipo-IR-PFP-RNP nanoparticles have good biocompatibility.
[0097] In vitro and in vivo experimental data jointly demonstrate that combined phototherapy mediated by multifunctional liposomes can transform dying tumor cells into an "in situ vaccine." By triggering the release of multiple DAMPs such as CRT, ATP, and HMGB1, this strategy successfully links cytotoxic events with immune activation, paving the way for the initiation of downstream adaptive immune responses.
[0098] In summary, this invention provides a smart, responsive, dual-targeting nanoplatform. Through dual-targeting, thermosensitive liposomes, this invention achieves synergistic delivery and spatiotemporally controlled release of photothermal ablation and LDHA gene editing. This strategy combines physical ablation with metabolic intervention, effectively reshaping the tumor immune microenvironment and stimulating a sustained anti-tumor immune response while directly killing tumor cells. This synergistic therapeutic modality, which induces ICD formation of an "in situ vaccine," provides a novel strategy for developing next-generation cancer immunotherapies.
[0099] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations, modifications, or equivalent substitutions that can be easily conceived by those skilled in the art within the scope of the technical essence and principles disclosed in the present invention should be included within the scope of protection of the present invention.
Claims
1. A tumor microenvironment dual-targeting thermosensitive liposome, characterized in that, The liposome contains the following components: (1) thermosensitive lipids; (2) cationic lipids; (3) cholesterol; (4) polyethylene glycol modified lipids; (5) surface-modified ginsenosides; (6) surface-modified AS1411 nucleic acid aptamers; (7) internally encapsulated CRISPR-Cas9 system for specifically editing the lactate dehydrogenase A (LDHA) gene; (8) internally loaded with near-infrared photothermal agent IR-1048; and (9) internally loaded with perfluoropentane (PFP).
2. The liposomes according to claim 1, characterized in that, The thermosensitive lipids are selected from DPPC, DSPC, HSPC, or combinations thereof; the cationic lipids are selected from DOTAP, DOTMA, or combinations thereof; the polyethylene glycol-modified lipids are selected from DSPE-PEG2000, DMG-PEG2000, or combinations thereof; the mass ratio of each component is: thermosensitive lipids: cationic lipids: cholesterol / ginsenosides: polyethylene glycol-modified lipids = 2-7: 0.5-5: 0.5-5 / 0.5-5: 0.5-5.
3. The liposomes according to claim 1, characterized in that, The ginsenosides are selected from ginsenosides Rg3, Rh2, or a combination thereof; the nucleic acid aptamer is the AS1411 aptamer targeting nucleolin.
4. The liposomes according to claim 1, characterized in that, The CRISPR-Cas9 system includes the Cas9 protein or its encoding mRNA, and a single-stranded guide RNA (sgRNA) that specifically targets the LDHA or LDHB gene, wherein the sgRNA targets the catalytically active region of the LDHA gene.
5. The liposomes according to claim 1, characterized in that, The liposomes are stable at room temperature, and undergo a phase transition to release their contents when the local temperature rises to 30-70°C under near-infrared light irradiation; wherein the wavelength of the near-infrared light is 780-2500 nm, and the power density is 0.1-5.0 W / cm³. 2 .
6. A pharmaceutical composition comprising a tumor microenvironment dual-targeting thermosensitive liposome as described in any one of claims 1-5 and a pharmaceutically acceptable carrier.
7. A method for preparing tumor microenvironment dual-targeting thermosensitive liposomes as described in any one of claims 1-5, characterized in that, The process includes the following steps: (1) dissolving thermosensitive lipids, cationic lipids, cholesterol / ginsenosides, polyethylene glycol modified lipids and IR-1048 in an organic solvent to form a lipid / IR-1048 mixture; (2) evaporating the lipid mixture obtained in step (1) to form a lipid film, and preparing basic liposomes by ultrasound and extrusion; (3) loading the CRISPR-Cas9 system into the aqueous core of the basic liposomes obtained in step (2) using microfluidic technology or ultrasound treatment; (4) loading perfluoropentane into the liposomes obtained in step (3) using ultrasound treatment; and (5) modifying the surface of the liposomes obtained in step (4) with nucleic acid aptamers by chemical coupling.
8. The use of a tumor microenvironment dual-targeting thermosensitive liposome as described in any one of claims 1-5 in the preparation of a medicament for treating tumors, wherein the tumor is selected from breast cancer, colon cancer, pancreatic cancer, lung cancer, liver cancer, melanoma or other solid tumors.
9. The application according to claim 8, characterized in that, The following mechanisms enable synergistic tumor therapy: (1) Enhanced liposome enrichment in the tumor microenvironment through dual-targeted delivery mediated by ginsenosides and AS1411 nucleic acid aptamers; (2) Under near-infrared light irradiation, IR-1048 generates a photothermal effect, raising the temperature and triggering the perfluoropentane phase transition; (3) The perfluoropentane phase transition causes volume expansion, destroying the liposome structure and releasing the CRISPR-Cas9 system and IR-1048; (4) The released CRISPR-Cas9 system edits the LDHA gene, inhibits lactate production, and reverses the tumor immunosuppressive microenvironment; (5) The IR-1048-mediated photothermal effect directly kills tumor cells and induces the death of immunogenic tumor cells; (6) LDHA gene editing and photothermal therapy synergistically activate the anti-tumor immune response.