Application of pingpoda protein PDPN in preparation of medicine for treating viral myocarditis

By designing a novel immunogenic peptide, TQRERGTKPPLE, independent of the classic PLAG region of PDPN, the limitations of existing PDPN intervention strategies have been overcome, achieving effective treatment for viral myocarditis and providing new therapeutic targets and strategies.

CN122005751APending Publication Date: 2026-05-12XIEHE HOSPITAL ATTACHED TO TONGJI MEDICAL COLLEGE HUAZHONG SCI & TECH UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
XIEHE HOSPITAL ATTACHED TO TONGJI MEDICAL COLLEGE HUAZHONG SCI & TECH UNIV
Filing Date
2026-02-27
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

Existing intervention strategies for platelet-stimulating protein (PDPN) mainly focus on the limitations of its platelet aggregation stimulating domain (PLAG region), lacking effective therapeutic targets and strategies for viral myocarditis.

Method used

A novel immunogenic peptide, TQRERGTKPPLE, derived from the PDPN protein but independent of its classic PLAG region, was designed. Specific antibodies were generated by immunizing mice with this peptide. Monoclonal antibodies and vaccines can be further developed targeting this peptide, providing a new therapeutic target for viral myocarditis.

Benefits of technology

This immunogenic peptide can effectively induce mice to produce specific antibodies, significantly improve myocardial inflammation damage and inflammatory factor expression in viral myocarditis, provide a new therapeutic target, and has the potential to prevent and treat viral myocarditis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122005751A_ABST
    Figure CN122005751A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biology, and particularly relates to application of PDPN (Podoplanin) in preparation of a medicine for treating viral myocarditis. More specifically, the invention provides a novel immunogenic peptide fragment PDPN-TE12 aiming at PDPN, a coding sequence of the novel immunogenic peptide fragment PDPN-TE12, a pharmaceutical composition containing the novel immunogenic peptide fragment PDPN-TE12, and application of the novel immunogenic peptide fragment PDPN-TE12 in prevention and / or treatment of inflammatory cardiomyopathy such as viral myocarditis. Experimental results show that the polypeptide PDPN-TE12 can significantly relieve myocardial damage of mice with viral myocarditis and inhibit inflammatory cell infiltration and inflammatory cytokine expression, so that the polypeptide PDPN-TE12 can be used as a potential drug for treating viral myocarditis, and a new candidate strategy is provided for precise targeted therapy of the disease.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to immunomodulatory peptides and their applications. More specifically, this invention relates to immunogenic peptides derived from mouse podoplanin (PDPN), their coding sequences, pharmaceutical compositions comprising the peptides, and their use in the preparation of medicaments for the prevention and / or treatment of viral myocarditis. Background Technology

[0002] Viral myocarditis (VMC) is an inflammatory disease of the myocardium caused by infection with cardiotropic viruses (such as Coxsackievirus B3 and influenza virus). The clinical manifestations are diverse; mild cases may resolve spontaneously, but severe cases can lead to complications such as heart failure, sudden cardiac death, or progression to dilated cardiomyopathy (DCM), resulting in a poor prognosis and imposing a heavy disease burden on patients and society. Due to the complex pathogenesis of VMC, current treatments are mainly supportive and symptomatic. There is currently a lack of precise therapeutic targets and specific drugs targeting the core aspects of the disease, necessitating the development of new targeted therapy strategies.

[0003] Podoplanin (PDPN) is a conserved mucin-type type I transmembrane glycoprotein specifically expressed on lymphatic endothelial cells, and also widely expressed on various tumor cells and tumor-associated fibroblasts. It is closely related to the occurrence, development, invasion, and metastasis of various malignant tumors. Its extracellular platelet aggregation stimulating domain (PLAG) selectively binds to platelet C-type lectin (CLEC2), inducing platelet activation and aggregation, assisting tumor cell implantation, adhesion, and immune escape. Peptides developed based on the PLAG region of the PDPN extracellular domain can effectively inhibit the invasion and metastasis of malignant tumors. Patent publication CN113461783A discloses a podoplanin antagonistic peptide that specifically binds to PDPN, preventing the growth and proliferation of melanoma; patent publication CN105754953A discloses a monoclonal antibody against the platelet aggregation region of human podoplanin and its therapeutic application in lung tumors.

[0004] However, recent discoveries have revealed a crucial role for PDPN in regulating immune-inflammatory cells in cardiovascular diseases. In 2019, Cimini et al. found that PDPN expression was elevated in the myocardium of mice with acute myocardial infarction (AMI), and that commercially available monoclonal antibodies could inhibit PDPN expression, significantly improving cardiac function and myocardial remodeling after myocardial infarction, accompanied by the recruitment and in situ differentiation of anti-inflammatory mononuclear-macrophages (CD163 / CD206). They proposed that PDPN plays an important regulatory role in ventricular remodeling after myocardial infarction through the mononuclear-macrophage system. Subsequently, in 2021, our research team discovered that the myocardium of VMC mice contains a large number of ectopic lymphoid follicles (ELFs) and germinal centers, which can promote the expression of anti-cardiac antibodies (AHAs) in myocardial tissue and mediate myocardial injury. The mechanism is that PDPN and IL-17A synergistically mediate ELF formation, AHA secretion, and pathogenic Th17 cell differentiation. Furthermore, in 2023, our team discovered a soluble form of PDPN expressed in VMC patients, with significantly higher expression levels than in healthy individuals and AMI patients. This could serve as a novel biomarker for VMC diagnosis and inflammation prediction, although the specific soluble fragment form remains unknown. Notably, in our VMC study, we found that CLEC2 does not play a dominant role in regulating PDPN ligands in vivo. Using a commercially available PDPN antibody significantly inhibited CCL21-CCR7 axis expression in the myocardium of VMC mice. Moreover, PDPN in VMC patients showed a significant positive correlation with elevated CCL21, while CLEC2 expression showed no significant difference in VMC patients. Since current research and literature mainly focus on immune regulation in the PLAG region of PDPN and after activation by its ligand CLEC2, the SZ168 monoclonal antibody, designed based on amino acid sequences 31-51 of the PLAG region of the PDPN extracellular domain, can directly inhibit PDPN-CLEC2 binding, exerting tumor suppression and platelet activation effects. In addition, SZ168 has been reported to significantly improve the neuroinflammatory response after acute lung injury and cerebral hemorrhage in sepsis, suggesting that targeting the PLAG region of PDPN can be an important therapeutic approach for immunoinflammatory therapy. However, current research on the extracellular domain of PDPN still has significant limitations. It is currently unclear whether there are effective antigenic determinants independent of the PLAG region, and whether it can serve as a drug target for viral myocarditis treatment remains to be further clarified. Summary of the Invention

[0005] (a) Technical problems to be solved

[0006] Based on the discussion of existing solutions in the background art, the technical problem that this invention aims to solve is to overcome the limitations of existing intervention strategies for platelet-stimulating protein (PDPN), which mainly focus on its platelet aggregation stimulating domain (PLAG region), and to provide a novel immunogenic peptide derived from PDPN protein but independent of its classic PLAG region. This will open up new drug targets and candidate substances for the prevention and treatment of inflammatory cardiomyopathy such as viral myocarditis, and solve the problem that the pathophysiological mechanism of PDPN protein in viral myocarditis is still unclear, and there is a lack of effective therapeutic targets and strategies for viral myocarditis.

[0007] (II) Technical Solution

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] In a first aspect, the present invention provides the use of flatfoot protein PDPN in the preparation of drugs for treating viral myocarditis.

[0010] In another aspect, the present invention provides an immunogenic peptide for the flatfoot protein PDPN, wherein the amino acid sequence of the immunogenic peptide is TQRERGTKPPLE as shown in SEQ ID No. 1, and the immunogenic peptide is hereby named PDPN-TE12.

[0011] The present invention also provides a pharmaceutical composition comprising a therapeutically effective amount of the immunogenic polypeptide and a pharmaceutically acceptable carrier or excipient.

[0012] The present invention also provides the use of the immunogenic polypeptide or the pharmaceutical composition in the preparation of a medicament for the prevention or treatment of viral myocarditis.

[0013] Furthermore, the viral myocarditis is caused by Coxsackievirus B3 (CVB3) infection.

[0014] In summary, this invention selects PDPN as a target to design a novel immunogenic peptide targeting PDPN. Based on this immunogenic peptide, mice are immunized to produce specific antibodies. These antibodies effectively improve myocardial inflammation damage and inflammatory factor expression in viral myocarditis. This novel immunogenic peptide is independent of the previous PLAG region and the direct CLEC2-mediated platelet activation pathway. This immunogenic peptide can be further used to develop monoclonal antibodies and vaccines, providing a new therapeutic target for the treatment of inflammatory cardiomyopathy such as viral myocarditis.

[0015] (III) Beneficial Effects

[0016] The beneficial effects of this invention are:

[0017] 1. Based on the extracellular circular amino acid sequence, hydrophilicity, antigenicity, and accessibility of PDPN, and by combining bioinformatics and pharmacology methods, this invention designs a peptide targeting PDPN: TQRERGTKPPLE. Validation shows that this peptide can effectively induce the production of specific antibodies in immunized mice.

[0018] 2. Choosing a suitable adjuvant is the key to successful antibody production. In this invention, commercially available complete Freund's adjuvant (Sigma-Aldrich) is used to induce antibody production in mice.

[0019] 3. In this invention, the designed PDPN peptide is emulsified with complete Freund's adjuvant to induce antibody production in BALB / c mice. When mice are induced to produce high-titer antibodies, they are given a VMC model induced by CVB3 virus infection to study whether the antibody against PDPN can preventively improve myocardial inflammatory damage and inflammatory factor expression in VMC.

[0020] 4. High-titer antibody serum generated after immunizing mice with PDPN peptides was separated and in vitro transferred to Balb / c mice. Simultaneously, a VMC model induced by CVB3 virus infection was established to investigate whether antibodies against PDPN could treat myocardial inflammatory damage and inflammatory factor expression in VMC mice. This demonstrates that the immunogenic peptides of PDPN can be used to prepare drugs for the prevention and / or treatment of viral myocarditis.

[0021] In summary, this invention selects PDPN as a target to design a novel immunogenic peptide targeting PDPN. Based on this immunogenic peptide, mice are immunized to produce specific antibodies. These antibodies effectively improve myocardial inflammation damage and inflammatory factor expression in viral myocarditis. This novel immunogenic peptide is independent of the previous PLAG region and the direct CLEC2-mediated platelet activation pathway. This immunogenic peptide can be further used to develop monoclonal antibodies and vaccines, providing a new therapeutic target for the treatment of inflammatory cardiomyopathy such as viral myocarditis. Attached Figure Description

[0022] Figure 1 The expression level of PDPN in VMC mice in Example 1 is shown. A: H&E staining of the heart of control and VMC mice (days 3, 7, and 14), scale=100μm; B: Myocardial pathological score of mice; C: Heart-to-body weight ratio (HW / BW) of mice; D: Serum cTnT expression level of mice; E: Western blot detection of PDPN expression in mouse myocardium; F: RT-qPCR detection of changes in PDPN expression in mouse myocardium; G: ELISA detection of PDPN level in peripheral blood of mice. n=7.

[0023] Figure 2This is a time titer graph of anti-PDPN short peptide antibodies produced after immunizing male BALB / C mice with PDPN-TE12 (A) and PDPN-GT14 (B) in Example 2. n=4-5.

[0024] Figure 3 This describes the prophylactic therapeutic effect of the PDPN-TE12 immunogenic antibody on VMC mice in Example 3. A: H&E staining of mouse hearts, scale=100μm; B: Myocardial pathological score of mice; C: Heart-to-body weight ratio (HW / BW) of mice; D: Serum cTnT expression level of mice; E, F, G: RT-qPCR detection of mRNA expression levels of myocardial inflammatory factors Il17a, Il6, and Il1b in mice. n=5-7.

[0025] Figure 4 This is a safety assessment of PDPN-TE12 immunization in male BALB / C mice in Example 3. A: Results of H&E staining of liver, spleen, lung, and kidney tissues.

[0026] Figure 5 The image shows the anti-PDPN peptide antibody titer after serum from male BALB / C mice immunized with PDPN-TE12 (A) and PDPN-GT14 (B) in Example 3 was adopted and transferred to male BALB / C mice for modeling. n=5.

[0027] Figure 6 The direct therapeutic effect of the PDPN-TE12 immunogenic antibody on VMC mice in Example 3 was demonstrated by adoptive serum transfer. A: H&E staining of mouse heart, scale=100μm; B, C: CD68 and CD4 histochemical staining of mouse heart, scale=50μm; D: Myocardial pathological score of mouse; E: Mouse heart-to-body weight ratio (HW / BW); F: Serum cTnT expression level of mouse; G, H, I: RT-qPCR detection of mRNA expression levels of myocardial inflammatory factors Il17a, Il6, and Il1b in mouse. n=5.

[0028] In the figure, *P<0.05, **P<0.01, ***P<0.001, and ***P<0.0001. Detailed Implementation

[0029] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0030] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0031] A novel immunogenic peptide targeting mouse PDPN (hereinafter referred to as PDPN-TE12 immunogenic peptide) has the amino acid sequence shown in SEQ ID NO:1, TQRERGTKPPLE. Additionally, a previously identified extracellular effective antigenic determinant of PDPN, abbreviated as PDPN-GT14, with the sequence GDGMVPPGIEDKIT, was used as a positive control.

[0032] Example 1: Expression level of PDPN in CVB3-induced VMC mice

[0033] 1. Detection of PDPN expression level in VMC mice

[0034] Male BALB / c mice aged 5-6 weeks (weighing approximately 18g) were selected. VMC mouse model establishment: On day 0, mice were administered 1*10^5 PFU of CVB3 virus (diluted in 200μl of RPMI-1640 medium) via intraperitoneal injection. Control mice received the same dose of RPMI-1640 medium. Mice were treated on days 3, 7, and 14 after model establishment.

[0035] 1) Anesthesia: Anesthesia was administered via intraperitoneal injection of 1% sodium pentobarbital at a dose of 100 ml / kg.

[0036] 2) Serum collection: Trim the beard, collect blood from the orbital vein, collect it in an EDTA-K2 anticoagulant tube, centrifuge at 3000 rpm for 10 min at room temperature to collect the supernatant, and store at -80℃ for later use.

[0037] 3) Heart collection and processing: After collecting serum, the mice were sacrificed, the heart was quickly separated, rinsed twice in PBS, and the ventricular part of the heart was cut and soaked in 4% paraformaldehyde. The tissue was routinely dehydrated and embedded in paraffin, while the remaining heart tissue was stored at -80°C.

[0038] 4) Hematoxylin and eosin (H&E): Embedded cardiac tissue was longitudinally sectioned into 5 μm thick slices and stained with hematoxylin and eosin (H&E). The cardiac pathology score was described as follows: 0 points, no inflammatory infiltration; 1 point, <25%; 2 points, 25%-50%; 3 points, 50%-75%; 4 points, >75%. Five images covering almost the entire cardiac slice were scored using ImageJ software in a double-blind manner.

[0039] 5) ELISA: Mouse serum cTnT levels were quantified using the mouse cTnT ELISA kit (Immunoway) according to the manufacturer's protocol; mouse serum PDPN levels were detected using the mouse PDPN ELISA kit (Singalway Antibody).

[0040] 6) RT-qPCR: Remaining total cardiac RNA was extracted using Trizol (Invitrogen). After quantification, 1 μg of RNA was reverse transcribed into cDNA using the PrimeScript RT kit (TaKaRa Biotechnology). Amplification was then performed on an ABI PRISM 7900 sequencing system using the SYBR Premix Ex Taq kit (TaKaRa Biotechnology) and specific primers. 2 −△△Ct Calculate the current relative expression level of the gene. Primer sequences are as follows:

[0041] PDPN: F: TATTTTGTTGGACAGAACATGGACC;

[0042] PDPN: R: CCACTTAGAAGCAAAAGAACATGGA.

[0043] GAPDH: F: GGCAAATTCAACGGCACAGTCAAG;

[0044] GAPDH: R:TCGCTCCTGGAAGATGGTGATGG.

[0045] 7) Western blotting (WB): Total protein from mouse heart was separated using RIPA lysis buffer (Roche Diagnostics). Protein samples were then subjected to SDS-PAGE using 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to a PVDF (Roche Diagnostics) membrane. After washing with TBST, the samples were incubated with anti-PDPN antibody (Invitrogen) overnight at 4°C. After washing again with TBST, the samples were incubated with HRP-conjugated IgG secondary antibody at room temperature for 2 hours. After washing again with TBST, the samples were developed using chemiluminescence buffer.

[0046] 2. Experimental Results

[0047] Compared to the control group, VMC mice showed inflammatory cell infiltration and myocardial damage starting on day 3, peaking on day 7, and then gradually recovering on day 14. Myocardial pathological scores, heart-to-body weight ratio, and serum cTnT levels all reached their highest points on day 7 (all P < 0.05). Detection of PDPN in the mouse heart revealed that PDPN expression levels were consistent with the myocardial inflammation levels in VMC mice, peaking on day 7 and gradually decreasing over day 14. Furthermore, serum soluble PDPN levels in VMC mice were significantly higher on day 7 than in the control group, and on days 3 and 14 (all P < 0.05). Therefore, PDPN plays an important biological role in the development and progression of VMC disease.

[0048] Example 2: Preparation of PDPN-TE12 immunogenic peptide and evaluation of antibody production effect

[0049] 1. Peptide preparation:

[0050] Based on the spatial conformation, bioinformatics, and pharmacological characteristics of PDPN, a novel immunogenic peptide targeting the extracellular amino acid sequence of mouse PDPN was designed and named PDPN-TE12, specifically the PDPN-TE12 immunogenic peptide. The specific amino acid sequence is TQRERGTKPPLE. Simultaneously, a previously reported immunogenic peptide of PDPN was used as a positive control, with the amino acid sequence GDGMVPPGIEDKIT, named PDPN-GT14. The above-mentioned PDPN-TE12 and PDPN-GT14 peptides were synthesized using a solid-phase synthesis method (synthesized and quality-controlled by Shanghai Jier Biochemical Co., Ltd.). The purity of the synthesized peptides was analyzed by high-performance liquid chromatography (HPLC), and the purity of both PDPN-TE12 and PDPN-GT14 peptides was found to be above 98%. The obtained peptides were lyophilized, aliquoted, and stored in cryovials at -80°C for later use.

[0051] 2. Evaluation of Immunization Efficacy

[0052] 1) Immunization Procedure: A vector for immunization was prepared using complete Freund's adjuvant. The specific procedure was as follows: PDPN-TE12 and PDPN-GT14 peptide powders were fully dissolved in 1 ml of 0.9% NaCl solution. 1 ml of complete Freund's adjuvant was drawn into a 2 ml syringe and emulsified thoroughly through a three-way stopcock (5 min × 6 times) to obtain an emulsion of 1 mg / ml. On day 0, 100 μl of the emulsion was subcutaneously injected into the left axilla and groin of mice. On day 7, 100 μl of the emulsion was subcutaneously injected into the right axilla and groin of mice. Normal control mice were injected with the same dose of the 0.9% NaCl solution and complete Freund's adjuvant mixture at the same time and site. Blood was collected from the tail vein on day 0, week 1, week 2, week 3, and week 4. The supernatant was collected by centrifugation at 3000 rpm for 10 min at room temperature and stored at -80℃ for later use.

[0053] 2) ELISA detection: To avoid cross-reaction, bovine serum albumin (BSA) was coupled with PDPN-TE12 and PDPN-GT14 peptides to prepare coating substrates (15 μg / ml). Coated plates were prepared, and the antibody titers of the corresponding immunogenic peptides TE-12 and GT-14 against PDPN were determined by ELISA.

[0054] ①Incubation with primary antibody: Add 100 μl of mouse serum sample diluted 1:40 to the coated 96-well plate, and incubate at 37°C for 2 h.

[0055] ②Incubation with secondary antibody: Discard the liquid, wash 3 times with washing buffer (0.03% PBST pH 7.4), pat dry, then add HRP-conjugated mouse IgG secondary antibody (1:5000 dilution), 100 μl / well, incubate at 37℃ for 0.5 h;

[0056] ③ Color development: Discard the liquid, wash 3 times with washing solution, pat dry, then add TMB color development solution, 100 μl / well, and observe the color change at room temperature;

[0057] ④ Termination of reaction: When the color of the blank control well just begins to change, add the stop solution (1 Mol dilute HCl), 100 μl / well to terminate the reaction;

[0058] ⑤ Reading and analysis: Read the absorbance (OD) value at a wavelength of 450nm on the microplate reader. An OD value ≥ 2.1 times that of the blank control group is considered positive. Calculate the relative expression level of the antibody based on the blank control.

[0059] 3. Experimental Results

[0060] The results are as follows Figure 2After two immunizations of BALB / c mice, specific antibodies against the immunogenic peptide of PDPN-TE12 were generated. The antibody titer in mouse serum began to rise initially after the first immunization, reached its highest level in the third week, and then began to decline initially in the fourth week, but was still a significant positive result (>2.1 times that of the negative control). At the same time, PDPN-GT14 could also induce mice to produce specific antibodies, reaching the highest antibody titer level in the third week.

[0061] Example 3: In vivo evaluation of the therapeutic effect and safety of PDPN-TE12 immunogenic antibody in VMC mice

[0062] 1. Prophylactic therapeutic effect of PDPN-TE12 immunogenic antibody on VMC mice:

[0063] BALB / c mice (5-6 weeks old, 18g weight) were immunized with PDPN-TE12 emulsified with complete Freund's adjuvant. In the third week, the mice were injected intraperitoneally with CVB3 virus to construct a VMC model. The effect of the PDPN-TE12-specific antibody produced by the body on the level of myocardial inflammation in VMC mice was preliminarily investigated. PDPN-GT14 was used as a positive control.

[0064] 1) The specific groupings are as follows:

[0065] Group 1: Control group: No treatment was given, n=5;

[0066] Group 2: VMC group: During week 0 and week 1, a mixture of 0.9% NaCl solution and complete Freund's adjuvant was administered, following the same immunization process as described above. During week 3, CVB3 virus (1*10^5 PFU) was injected intraperitoneally. n=7.

[0067] Group 3: PDPN-TE12 group: During week 0 and week 1, a suspension of PDPN-TE12 peptide emulsion was administered with complete Freund's adjuvant and the same as the immunization process described above. During week 3, CVB3 virus (1*10^5 PFU) was injected intraperitoneally. n=7.

[0068] Group 4: PDPN-GT14 group: During week 0 and week 1, a suspension of PDPN-GT14 peptide emulsion was administered with complete Freund's adjuvant and the same immunization process as described above. During week 3, CVB3 virus (1*10^5 PFU) was injected intraperitoneally. n=7.

[0069] Mice were sacrificed in week 4, and blood was collected through the orbital rim, serum was separated, and tissues from the heart, liver, spleen, lungs, and kidneys were collected.

[0070] 3) ELISA: The mouse serum cTnT level was quantitatively measured using the mouse cTnT ELISA kit (Immunoway) according to the manufacturer's protocol.

[0071] 4) H&E: Perform myocardial pathology scoring as described above.

[0072] 5) RT-qPCR: Perform as described above.

[0073] The primer sequences are as follows:

[0074] Il17a: F:TTTAACTCCCTTGGCGCAAAA;

[0075] R:CTTTCCCTCCGCATTGACAC.

[0076] Il6:F:GAGAGGAGACTTCACAGAGGATACC;

[0077] R:TCATTTCCACGATTTCCCAGAGAAC.

[0078] Il1b: F: TCGCAGCAGCACATCAACAAG;

[0079] R:TCCACGGGAAAGACACAGGTAG.

[0080] 6) Experimental Results

[0081] like Figure 3 As shown, the control group mice showed no significant inflammatory cell infiltration in their hearts, while the VMC mice exhibited extensive inflammatory cell infiltration, accompanied by significantly elevated levels of the myocardial injury marker cTnT. Furthermore, two mice showed significant weight loss and died on day 4 of VMC formation. However, mice immunized with PDPN-TE12 and PDPN-GT14 before VMC formation did not die, and their myocardial inflammation pathology scores were significantly lower than those in the VMC group, accompanied by decreased serum cTnT levels. Simultaneously, we assessed cardiac inflammatory cytokines in each group of mice, and the results showed that the mRNA expression levels of Il17a, Il6, and Il1b were significantly lower in the PDPN-TE12 and PDPN-GT14 immunized groups compared to the VMC group.

[0082] In addition, the histological structure of the liver, spleen, lungs, and kidneys was evaluated using the H&E staining system. Figure 4The results showed that the liver lobules of mice were intact, hepatocytes were morphologically normal, and no obvious fatty degeneration was observed. Compared with the control group, a small amount of inflammatory cell infiltration was observed in the livers of the VMC, TE-12, and GT-14 groups, but no obvious hepatocyte necrosis was observed. The white and red pulp structures of the spleen were clear, and no obvious tissue damage was observed. The alveolar structure was intact, and no inflammatory cell infiltration or fibrosis was observed in the interstitium. The glomeruli and tubules of the kidneys were normal in structure, and no obvious inflammatory cell infiltration or interstitial fibrosis was observed. In summary, the pathological evaluation of key target organs showed that the PDPN-TE12 immunogenic antibody did not cause significant additional damage to the vital organs of mice.

[0083] 2. Direct therapeutic effect of PDPN-TE12 immunogenic antibody on VMC mice: serum adoptive transfer

[0084] BALB / c mice (5-6 weeks old, 18g) were immunized with PDPN-TE12 emulsified with complete Freund's adjuvant. Blood was collected via the orbital vein at week 3, and mouse serum was separated. Serum was then adopted into BALB / c mice via the tail vein at days 0 and 3, and a VMC model was established by intraperitoneal injection of CVB3 virus. The effects of PDPN-TE12-specific antibodies produced by the body on the level of myocardial inflammation in VMC mice were further investigated, with PDPN-GT14 used as a positive control.

[0085] 1) The specific groupings are as follows:

[0086] Group 1: VMC group: serum from control mice immunized with a mixture of 0.9% NaCl solution and complete Freund's adjuvant on days 0 and 3, 200 μl / time; VMC model was established on day 1 by intraperitoneal injection of CVB3 virus (1*10^5 PFU), n=5;

[0087] Group 2: TE12 group: 200 μl of mouse serum after immunization with PDPN-TE12 peptide on day 0 and day 3 (3 weeks); VMC model was constructed by intraperitoneal injection of CVB3 virus (1*10^5 PFU) on day 1, n=5;

[0088] Group 4: GT14 group: 200 μl of mouse serum after immunization with PDPN-GT14 peptide on days 0 and 3 (3 weeks); VMC model was constructed on day 1 by intraperitoneal injection of CVB3 virus (1*10^5 PFU), n=5;

[0089] Mice were sacrificed on day 7, and blood was collected from the orbital cavity, serum was separated, and heart tissue was separated.

[0090] 2) ELISA: Simultaneously, the antibody titers of PDPN-TE12 and PDPN-GT14 in serum, as well as the serum cTnT expression level, were detected using the methods described above;

[0091] 3) H&E: Perform myocardial pathology scoring as described above;

[0092] 4) RT-qPCR: Detect cardiac inflammatory markers Il17a, Il6 and Il1b in the manner described above.

[0093] 5) Immunohistochemistry: Embedded cardiac tissue was longitudinally sectioned into 5 μm thick slices, incubated with anti-CD4 antibody (Abcam) and anti-CD68 antibody (Abcam) for 1 h, followed by incubation with secondary antibody for 30 mins, and then stained with diaminobenzidine and hematoxylin. The expression levels of CD4 and CD68 in the myocardium were observed under a microscope.

[0094] 6) Experimental Results

[0095] like Figure 5 As shown: Through adoptive serum transfer, mice obtained high titers of PDPN-TE12 and PDPN-GT14 antibodies, respectively. Furthermore, as... Figure 6 As shown, myocardial inflammatory cell infiltration was significantly reduced in the TE12 and GT14 groups compared to the VMC group, accompanied by serum cTnT expression. Further histochemical analysis of CD4 and CD68 revealed a significant decrease in both CD4 and CD68 inflammatory cell infiltration after serum adoptive transfer. Therefore, TE-12 is an effective immunogenic peptide of PDPN, and the specific antibodies it produces can significantly reduce myocardial inflammatory infiltration and myocardial damage in VMC, thus improving VMC prognosis.

[0096] The experimental data presented in this embodiment demonstrate that the PDPN-TE12 immunogenic peptide can effectively stimulate mice to produce high levels of antibodies against the PDPN-TE12 immunogenic peptide. These specific antibodies can reduce myocardial inflammation and myocardial damage in the VMC mouse model.

[0097] Finally, it should be noted that the above embodiments are only for illustrating the present invention and not for limiting the scope of protection of the present invention. Furthermore, after reading the technical content of this invention, those skilled in the art can make various modifications, alterations, or variations to the present invention, and all such equivalent forms also fall within the scope of protection claimed in this application.

Claims

1. Application of flatfoot protein PDPN in the preparation of drugs for treating viral myocarditis.

2. An immunogenic peptide targeting the flatfoot protein PDPN, characterized in that, The amino acid sequence of the immunogenic peptide is TQRERGTKPPLE.

3. A pharmaceutical composition, characterized in that, It comprises a therapeutically effective amount of the immunogenic polypeptide as described in claim 2, and a pharmaceutically acceptable carrier or excipient.

4. The use of the immunogenic polypeptide of claim 2 or the pharmaceutical composition of claim 3 in the preparation of a drug for the prevention or treatment of viral myocarditis.

5. The application as described in claim 4, characterized in that, The viral myocarditis is caused by infection with Coxsackievirus B3, which is abbreviated as CVB3.