Thermophilic debranching enzyme mutant with improved debranching efficiency and activity and application thereof
By mutating the 358th amino acid of the thermophilic debranching enzyme T2P, the debranching efficiency and activity of the enzyme were improved, solving the problem of insufficient efficiency of existing starch debranching enzymes under high temperature conditions and meeting the needs of industrial application.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- EAST CHINA UNIV OF TECH
- Filing Date
- 2026-02-04
- Publication Date
- 2026-05-12
AI Technical Summary
Existing starch debranching enzymes have insufficient efficiency and activity under high temperature conditions, making it difficult to meet the requirements of industrial applications. Furthermore, existing acid hydrolysis methods suffer from poor selectivity and difficulty in process control.
By rationally designing proteins, the 358th lysine residue of the thermophilic debranching enzyme T2P was mutated to aspartic acid, glutamic acid, asparagine, or histidine, thereby improving the debranching efficiency and activity of the enzyme and developing a thermoresistant and efficient starch debranching enzyme.
It achieves efficient debranching under high temperature conditions, increasing enzyme activity to twice the original level and debranching efficiency to 3.3 times, meeting the needs of industrial applications.
Smart Images

Figure CN122012470A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a thermophilic debranching enzyme mutant with improved debranching efficiency and activity, and its application, belonging to the field of enzyme preparations. Background Technology
[0002] Starch is an important raw material for food, medicine, and chemicals; its molecular structure is dendritic. α -1.4 glucan, shorter α -1.4 glucan side chains α -1,6 glycosidic bonds are linked to a longer [structure / structure]. α -1.4 glucan backbone. Starch debranching is equivalent to starch hydrolysis. α Debranched starch, with its -1,6 glycosidic bonds forming easily crystallizing chain-like molecules, is widely used in the manufacture of health foods (slow-digesting starch for blood sugar and weight control), drug sustained-release agents, and biodegradable bio-based films. Simultaneously, starch debranching is a crucial step in starch sugar production, significantly improving the yield and quality of target sugars. Currently, the main method for preparing debranched starch is acid hydrolysis, which has disadvantages such as poor hydrolysis selectivity, difficulty in process control, and incomplete removal of branch points. α Dextran chains are relatively short; while enzymatic debranching has advantages such as strong glycosidic bond selectivity and mild reaction conditions, and has been widely used in starch sugar production.
[0003] Starch debranching enzymes can specifically hydrolyze starch. α -1,6 glycosidic bonds; currently, the main commercial starch debranching enzymes are isoamylase and pullulanase, both of which are suitable for weakly acidic, mesophilic environments. Pseudomonas amyloderamos Isoamylase is suitable for pH 3.5 and 40 °C, while Xiasheng pullulanase FDY-2224 is suitable for pH 3.5-6.0 and 40-65 °C. Meanwhile, commercial pullulanases define their enzyme activity by pullulanose hydrolysis activity, while their starch debranching activity is unknown.
[0004] Raw starch is difficult to dissolve at low temperatures, requiring high-temperature gelatinization for starch processing, with industrial gelatinization temperatures often exceeding 90°C. Using existing starch debranching enzymes necessitates lowering the starch paste temperature to 60°C and adjusting the pH to around 4.5, while also appropriately diluting the starch paste to reduce viscosity and promote mass transfer. Clearly, a heat-resistant and highly efficient debranching enzyme that combines starch gelatinization and debranching can simplify operations, shorten processing time, and thus reduce costs and increase efficiency. Summary of the Invention
[0005] To address the shortcomings of existing technologies and develop a heat-resistant and highly efficient starch debranching enzyme, this invention first predicts enzyme function through protein sequence homology alignment and homology modeling, and then screens out enzymes from the NCBI database. Thermus thermophilus GH13 protein is a potential high-temperature debranching enzyme. This was confirmed through heterologous expression of the GH13 protein gene and functional identification of recombinant proteins. Thermus thermophilusGH13 protein (T2P) is a thermophilic starch debranching enzyme, and its amino acid sequence is shown in SEQ ID NO.1. The optimal temperature range for T2P debranching is 76.0-100 °C, and the optimal reaction pH is 6.0. After incubation at 97 °C for 30 min, the residual debranching enzyme activity is 94.3% ± 0.9%, which fully meets the requirements for industrial gelatinization and liquefaction temperature, enabling one-step gelatinization and liquefaction debranching. However, the debranching efficiency and activity of T2P are still low, making it difficult to meet the requirements for industrial applications. Rational protein design is needed to improve the debranching efficiency and activity of T2P to reduce costs and increase efficiency in industrial applications. Therefore, this invention further rationally modifies the T2P protein. Through online homology modeling and molecular docking using SWISS-MODEL, it was found that the terminal group of the K358 side chain participates in the binding force field of 0ˊ Glc-C2 / 3-OH and -1ˊ Glc-C2-OH on the non-reduced end of the main chain at the branch point, which may significantly affect the strength and direction of this force field and thus change the debranching efficiency of the enzyme. V max / K m Therefore, the K358M / R / H / E / Q / D / N mutant was designed to investigate the effects of the polarity and steric hindrance of the side chain group at position 358 on the debranching performance of the enzyme.
[0006] This invention is achieved through the following technical solution: The first objective of this invention is to provide a thermophilic debranching enzyme mutant with improved debranching efficiency and activity, wherein the thermophilic debranching enzyme mutant is formed by mutating the 358th lysine of the thermophilic debranching enzyme as shown in SEQ ID NO.1 to aspartic acid, glutamic acid, asparagine or histidine.
[0007] A second object of the present invention is to provide a gene encoding the thermophilic debranching enzyme mutant.
[0008] A third objective of this invention is to provide a recombinant vector expressing the thermophilic debranching enzyme mutant.
[0009] In one embodiment of the present invention, the expression vector of the recombinant vector includes, but is not limited to, plasmids, granules, bacteriophages, and retroviruses. Preferably, the expression plasmid is a pET series expression vector. Preferably, the expression plasmid is pET28a.
[0010] A fourth object of the present invention is to provide a recombinant cell expressing the thermophilic debranching enzyme mutant.
[0011] In one embodiment of the present invention, the host cell of the recombinant cell is a bacterium, fungus, or animal / plant cell. Preferably, the host cell is *Escherichia coli*. More preferably, it is *Escherichia coli*. E.coli BL21.
[0012] A fifth object of the present invention is to provide the application of the thermophilic debranching enzyme mutant or the recombinant cells in starch debranching.
[0013] In one embodiment of the present invention, the application involves adding the thermophilic debranching enzyme mutant or the recombinant cells to a reaction system containing starch, and carrying out a debranching reaction under high-temperature conditions; wherein, the high-temperature conditions are a temperature not lower than 70°C. Preferably, the high-temperature conditions are a temperature of 80-105°C, and more preferably, the high-temperature conditions are a temperature of 90-105°C.
[0014] In one embodiment of the present invention, the pH of the reaction system is 5.0-8.0. Preferably, the pH is 5.5-8.0. More preferably, the pH is 6.5-8.0.
[0015] In one embodiment of the present invention, the starch content in the reaction system is 1%-33% by mass-volume ratio.
[0016] In one embodiment of the present invention, the starch-containing reaction system is obtained by gelatinizing and liquefying starch.
[0017] In one embodiment of the present invention, the starch is amylopectin. Preferably, the starch includes, but is not limited to, corn starch, glutinous rice starch, potato starch, and sweet potato starch.
[0018] The beneficial effects of this invention are: In the thermophilic debranching enzyme T2P of this invention, residue 358, which participates in the binding force field of 0ˊ Glc-C2 / 3-OH and -1ˊ Glc-C2-OH on the non-reducing end of the main chain at the branching point, is a key site affecting the enzyme's debranching efficiency. Mutating this site can maintain the enzyme's thermocompatibility and thermostable properties while improving its debranching efficiency and activity. The maximum debranching ratio of K358D / E / N / H to enzyme activity ( V max The efficiency of K358D / E was increased to twice that before the mutation, with the debranching efficiency being significantly improved. V max / K m The efficiency was increased to 3.3 times and 2.5 times the pre-mutation level, respectively. This provides methodological guidance for improving the debranching efficiency of T2P and similar debranching enzymes, which is beneficial for enhancing the industrial application value of thermophilic debranching enzymes. Attached Figure Description
[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0020] Figure 1 The relationship between debranching enzyme activity and amylopectin concentration. Detailed Implementation
[0021] The present invention will be further illustrated below with specific examples. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Furthermore, after reading the teachings of this invention, those skilled in the art can make various alterations or modifications to the invention, and these equivalent forms also fall within the scope defined by the appended claims.
[0022] The terminology involved in this invention: Starch debranching: The term "starch debranching" refers to the hydrolysis of α-1,6 glycosidic bonds in amylopectin, transforming it into easily crystallizing chain-like molecules. Amylopectin is a polysaccharide compound with a dendritic branching structure, its molecules consisting of thousands of glucose residues linked by α-1,4-glycosidic and α-1,6-glycosidic bonds.
[0023] Debranching enzymes: The term "debranching enzymes" refers to enzymes that specifically hydrolyze α-1,6 glycosidic bonds in polysaccharides such as starch and glycogen. Based on their substrate specificity, they can be divided into two categories: isoamylases (EC 3.2.1.68) and pullulanases (EC 3.2.1.41). Based on their different amino acid sequences, they belong to the glycoside hydrolase family GH13 and GH57, respectively.
[0024] Expression: The term “expression” refers to any step involving the production of debranching enzymes, including but not limited to transcription, post-transcriptional modification, translation, post-translational modification, and secretion. Expression vector: The term "expression vector" refers to a linear or circular DNA molecule that contains a polynucleotide encoding a debranching enzyme and is operatively linked to a control sequence that provides for its expression. Host cell: The term "host cell" refers to any cell type that is readily transformed, transfected, transduced, etc., using nucleic acid constructs or expression vectors containing the polynucleotides of the present invention. The host cells of the present invention can be selected from bacteria such as *Bacillus* (e.g., *Escherichia coli*), *Bacillus* (e.g., *Bacillus subtilis*), and fungi such as yeasts (e.g., *Pichia pastoris*, *Saccharomyces cerevisiae*). For example, *Escherichia coli* used in the examples. E.coli BL21.
[0025] Recombination: When used to refer to cells, nucleic acids, proteins, or vectors, the term "recombination" means that the cells have been modified from their natural state. Thus, for example, recombinant cells express genes not found in their natural (non-recombinant) form within the cells, or express natural genes at different levels or under different conditions compared to those found in nature. The difference between recombinant nucleic acids and their natural sequences lies in the operative linking of one or more nucleotides and / or a heterologous sequence (e.g., a heterologous promoter in the expression vector). The difference between recombinant proteins and their natural sequences may lie in the fusion of one or more amino acids and / or a heterologous sequence. The expression vectors of the present invention can be introduced into host cells for recombination using methods well known in the art, including calcium chloride heat shock, electroporation, PEG-mediated recombination, gene gun methods, etc.
[0026] Mutant: The term "mutant" or "debranching enzyme mutant" refers to a polypeptide with similar debranching enzyme activity that contains alterations (i.e., substitution, insertion, and / or deletion) at one or more (e.g., several) positions relative to the parental debranching enzyme. Substitution means replacing an amino acid occupying a position with a different amino acid; deletion means removing an amino acid occupying a position; and insertion means adding an amino acid adjacent to and immediately following the amino acid occupying a position.
[0027] Those skilled in the art will understand that, as a result of the degeneracy of the genetic code, many different polynucleotides can encode the same polypeptide. Furthermore, it should be understood that those skilled in the art can perform nucleotide substitutions using conventional techniques, which will not affect the polypeptide sequence encoded by the polynucleotides used in this invention. Additionally, polynucleotides can be modified using methods known in the art to enhance the activity or survival time of the polynucleotides of this invention in vivo.
[0028] The technical solution of the present invention will be described in detail below with reference to specific embodiments. In the following embodiments, unless otherwise specified, the reagents, materials and equipment used can be purchased commercially, prepared by conventional methods, or commonly used in the industry.
[0029] Example 1: Obtaining the thermophilic debranching enzyme gene and constructing the recombinant plasmid Enzyme function prediction was performed using protein sequence homology alignment and homology modeling, and enzymes with unknown functions were screened from the NCBI database. Thermus composti GH13 protein gene sequence t2p (Amino acid sequence as shown in SEQ ID NO.1, nucleotide sequence as shown in SEQ ID NO.2), the expression plasmid pET28a- was synthesized by Sangon Biotech (Shanghai) Co., Ltd. and inserted between Nco I and Xho I at the pET28a multiple cloning site. t2p .
[0030] Example 2: Design and construction of highly efficient debranched mutants 1. Through online homology modeling and molecular docking using SWISS-MODEL, branch point binding force field analysis revealed that the terminal amino group of the K358 side chain participates in the binding force field of the 0ˊ Glc-C2 / 3-OH and -1ˊ Glc-C2-OH groups on the non-reduced ends of the main chain at the branch point. This force field may significantly affect the strength and direction of the binding force field, thereby altering the debranching efficiency of the enzyme. V max / K m Therefore, the K358M / R / H / E / Q / D / N mutant was designed to investigate the effects of the polarity and steric hindrance of the side chain group at position 358 on the debranching performance of the enzyme.
[0031] 2. Based on the existing infrastructure built in this laboratory E. coli BL21(DE3) / pET-28a- t2p Primers were designed carrying the thermophilic debranching enzyme T2P gene shown in SEQ ID NO.2, and the mutant K358X was constructed by reverse extension PCR.
[0032] 359f: GATCCTGAAAATCGAGGTGGGATGGTCTGGGAGGAGGCC r358R: ACTCCGATTTTCAGGATCCCTTCCCCCCGCCATCCCCACTTCCTCCC r358M: ACTCCGATTTTCAGGATCCATTCCCCCCGCCATCCCCACTTCCTCCC r358E:ACCTCGATTTTCAGGATCCTCTCCCCCCGCCATCCCCACTTCCTCCC r358Q:ACCTCGATTTTCAGGATCTGTCCCCCCGCCATCCCCACTTCCTCCC r358D: ACTCCGATTTTCAGGATCATCTCCCCCCGCCATCCCCACTTCCTCCC r358N: ACTCCGATTTTCAGGATCATTTCCCCCCGCCATCCCCACTTCCTCCC PCR reaction system: 25 μL reaction solution containing 12.5 μL PrimeSTAR Max Premix (2×), 10 μL ddH2O, and 1.0 μL each of 10 μM primers 359f / r358X. E. coli BL21(DE3) / pET-28a- t2p 0.3 μL of fresh bacterial culture (the amount can be increased to 0.5 μL for aged bacterial culture) was obtained by inoculating LB medium (5 g / L yeast extract, 10 g / L peptone, 10 g / L sodium chloride) at 0.1% (v / v) and shaking at 37 ℃ and 200 r / min for 12 h.
[0033] PCR cycling: pre-denaturation, 95 ℃, 5 min; denaturation, 98 ℃, 10 s; annealing, 58.0 ℃, 5 s, 53.9 ℃, 10 s; extension, 72 ℃, 3 min 30 s; 20-25 cycles.
[0034] Electrophoresis detection: 1% agarose gel, 0.5×TBE electrode buffer, 5 μL of PCR product, electrophoresis at 200 V constant voltage for 15 min, the target band is best when it is single and bright.
[0035] Transformation: Take 2 μL of the qualified PCR product from the previous step and add it to 20 μL of a freeze-thawed solution. E. coli BL21(DE3) supercompetent cells were transformed by heat shock at 42 ℃ and then plated on LB agar plates containing 50 μg / mL kanamycin sulfate (yeast extract 5 g / L, peptone 10 g / L, sodium chloride 10 g / L, agar powder 20 g / L); and incubated at 37 ℃ for 12 h. Transformant identification: Pick a single colony and inoculate it into 3 mL of LB medium containing 50 μg / mL kanamycin sulfate. Place the incubation tube (12-15 mL) in a shaker and incubate at 37 ℃, 290 r / min for 4-6 h. Take 200-500 μL of turbid bacterial culture and send it to Shanghai Sangon Biotech for sequencing. If the sequencing is correct, preserve the bacterial culture for later use.
[0036] Example 3: Expression of wild-type enzymes and their mutants The frozen recombinant bacterial strain was streaked onto an LB agar plate containing 50 μg / mL kanamycin and incubated overnight at 37 ℃. A single colony was picked and inoculated into 5 mL of LB liquid medium containing 50 μg / mL kanamycin and incubated for 12 h. 500 μL of the bacterial culture was then inoculated into 50 mL of LB liquid medium containing 50 μg / mL kanamycin and incubated at 37 ℃ until OD500. 600 The concentration was 0.6; IPTG was added to a final concentration of 0.1 mmol / L, and the cells were incubated at 25 °C for 18 h; the cells were then collected by centrifugation at 7000 r / min for 5 min. The remaining cells should be stored at -80 °C.
[0037] Example 4: Purification of wild-type enzyme and its mutants Resuspend the bacterial cells from 5 mL of bacterial culture in 1 mL of loading buffer into a 5 mL centrifuge tube; sonicate in an ice-water bath at 70% power for 3 s, pause for 2 s, and repeat for 3 min; clear the lysate and centrifuge at 12000 r / min for 10 min. Purify the supernatant using nickel affinity chromatography, and desalt the target fraction eluent using a Sephadex G-25 column to obtain the purified protein.
[0038] Sample loading buffer: 20 mM KH2PO4-K2HPO4 pH 7.8-8.0, 500 mM NaCl, 20 mM imidazole.
[0039] Elution buffer: 20 mM KH2PO4-K2HPO4 pH 7.8-8.0, 500 mM NaCl, 250 mM imidazole.
[0040] Example 5: Enzymatic properties of debranching enzymes 1. Debranching enzyme debranching activity assay: Iodine staining agent: Take 4.0 μL of 1% I2-KI (1.0 g I2, 8.0 g KI, 100 mL H2O) and add 1 mL of 100 mM HCl and mix well.
[0041] Take 60 μL of 20.0 mg / mL amylopectin solution (16 μL of 100 mg / mL corn amylopectin, 16 μL of 200 mM citrate-Na2HPO4 pH 6.0 buffer, and 28 μL of H2O) and add it to a PCR tube (200 μL). Place the tube in the PCR instrument's temperature control module and cool it to 4 ℃. Add 20 μL of crude enzyme solution and mix well. Heat the tube to the set temperature and hold it for a certain time. Cool it to 4 ℃ and add 80 μL of 1 M NaOH and mix well. Take 5.7 μL of the alkalization reaction solution and add it to a 96-well microplate containing 195 μL of iodine stain. Mix well and place the tube in the microplate reader to measure the OD. 620 .
[0042] 2. Optimal pH for debranching enzymes The debranching activity of debranching enzymes at pH 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, and 8.0 was determined by iodine staining at 77 °C for 30 min, with three replicates for each treatment. The results (Table 1) showed that the optimal debranching pH range of the mutants was wider than that before the mutation. Specifically, the optimal debranching pH for K358D / E was 6.0-7.5, for K358N it was 5.5-7.0, and for K358H it was 5.5-7.5.
[0043] 3. Optimal temperature for debranching enzymes The debranching activity of debranching enzymes was determined by iodine staining at 71.8, 73.5, 77.0, 81.2, 85.4, 89.6, 93.8, 98.0, 101.5, 103.3, and 105.0 °C for 30 min after hydrolyzing 20.0 mg / mL maize amylopectin at pH 5.5. Three replicates were set up for each treatment. The results (Table 1) showed that the optimal temperature for debranching in the mutant was 76–100 °C, which was comparable to that before the mutation.
[0044] 4. Thermostability of debranching enzymes The debranching enzymes were incubated at 97.0 ℃ for 120 min and then rapidly cooled to 4 ℃. Three replicates were prepared for each treatment, with 20 μL of enzyme solution per sample. The residual enzyme activity after incubation was determined by iodine staining. 60 μL of a 20.0 mg / mL corn amylopectin solution (pH 5.5) was added to the enzyme solution, mixed well, and incubated at 77 ℃ for 30 min. The results (Table 1) showed that the residual debranching enzyme activity of the mutant after incubation at 97 ℃ for 120 min was 90% ± 7%, comparable to that before the mutation.
[0045] Table 1. Debranching characteristics of T2P mutants
[0046] Example 6: Determination of debranching kinetic parameters of debranching enzymes 1. Determination of debranching activity of debranching enzymes using the phenol reagent method. 1.25 N mg / mL amylopectin solution: 100 mg / mL corn amylopectin N μL, 200 mM citric acid-Na2HPO4 pH 6.0 buffer 16 μL, H2O 44 N μL.
[0047] MBTH (3-methyl-2-benzothiazolinone hydrazone) reagent: 1.6 mg / mL MBTH, 0.4 mg / mL DTT (dithiothreitol).
[0048] Ferric ammonium sulfate dodecahydrate reagent: 20 g / L FeNH4(SO4)2·12H2O, 20 g / L Sulfanicacid, 0.25 M HCl.
[0049] Add 60 μL of amylopectin solution to a PCR tube (200 μL) and place it in the PCR instrument's temperature control module. Cool to 4 ℃, then add 20 μL of enzyme solution and mix well. Heat to the set temperature and maintain for the set time. Cool to 4 ℃ and add 80 μL of 1 M NaOH and mix well. Add 10 μL of alkaline enzyme digest to 50 μL of phenol reagent and mix well. Incubate in the PCR instrument at 80 ℃ for 15 min. During natural cooling, add 40 μL of ferric ammonium sulfate reagent and mix well. Develop color for 15-30 min. Add 5.6 μL of the colorimetric solution to 195 μL of H2O (diluted 36 times) and mix well. Measure the OD using a microplate reader. 620 .
[0050] 2. Debranching efficiency determination of debranching enzymes The debranching activity of purified enzyme protein (2.5-4.0 μg) hydrolyzed with 2.5, 5.0, 10.0, 20.0, 40.0, and 55.0 mg / mL amylopectin at 95 °C for 5 min was determined by the phenol reagent method, with three replicates for each treatment. OD values of the debranched products were plotted. 620 Graph showing the change of amylopectin concentration ( Figure 1 ), with OD corresponding to 55.0 mg / mL amylopectin 620 Value Calculation V max This refers to the relative amount of debranched products released per milligram of protein per minute. V max =10×OD 620 / m / t, m: amount of enzyme protein in the reaction system (mg), t: reaction time (min); plot ( Figure 1 ) Calculate the measured OD 620 The concentration of amylopectin corresponding to half of the maximum value, i.e. K m The results (Table 1) show that the maximum debranching ratio of K358D / E / N / H enzyme activity ( V max The substrate affinity of K358D / E was increased to twice that before the mutation, which was 2 times higher than that before the mutation. K m The efficiency of K358D / E was also significantly improved, increasing to 3.3 times and 2.5 times the efficiency before mutation, respectively.
[0051] The sequences used in this invention: The amino acid sequence of the thermophilic debranching enzyme T2P is SEQ ID NO.1: MAWYEGAFFYQIFPDRFFRAGPPGRPAPAGPFEPWEAPPTLRGFKGGTLWGVAEKLPYLLDLGVEALYLNPVFASTANHRYHTVDYFQVDPILGGNEALRHLLEVAHAHGIRVILDGVFNHTGRGFFAFQHLLENGPESPYRDWYYVKGFPLNAYTPHPNYEAWWGNPELPKLKVETPAVREYLLSVAEHWIRFGVDGWRLDVPNEIGDPEFWRAFRRRVKGANPEAYIVGEIWEEADFWLQGDMFDATMNYPLSRAILGFVGGEALDRGLAAKTGLGHIEPLQALAFSHRLESLFSRYRPEVVRAQMNLLTSHDTPRLLTLMGGSAERARLALALLFLLPGNPTVYYGEEVGMAGGKDPENRGGMVWEEARWQKDLLETVKRLARLRKEHPELRTAPYLRVYAQDGHLAFARGPYLVVVNASPHPFRQDFPLHGVFPRGGRAVDLLSGEVCTPQGGRLCGPVLPPFSLALWREA Nucleotide sequence of thermophilic debranching enzyme T2P, SEQ ID NO.2: The embodiments provided above are not intended to limit the scope of the invention, nor are the described steps intended to limit the order of execution. Any obvious modifications made to the invention by those skilled in the art based on existing common knowledge also fall within the scope of protection defined by the claims.
Claims
1. A thermophilic debranching enzyme mutant with improved debranching efficiency and activity, characterized in that, The thermophilic debranching enzyme mutant is formed by mutating lysine at position 358 of the thermophilic debranching enzyme, as shown in SEQ ID NO.1, to aspartic acid, glutamic acid, asparagine, or histidine.
2. A gene encoding the thermophilic debranching enzyme mutant of claim 1.
3. A recombinant vector expressing the thermophilic debranching enzyme mutant of claim 1.
4. The recombinant vector according to claim 3, characterized in that, The expression vectors of the recombinant vector include, but are not limited to, plasmids, granules, bacteriophages, and retroviruses.
5. A recombinant cell expressing the thermophilic debranching enzyme mutant of claim 1.
6. The recombinant cell according to claim 5, characterized in that, The host cells of the recombinant cells are bacteria, fungi, or animal and plant cells.
7. The use of the thermophilic debranching enzyme mutant of claim 1 or the recombinant cells of claim 5 or 6 in starch debranching.
8. The application according to claim 7, characterized in that, The application involves adding the thermophilic debranching enzyme mutant or the recombinant cells to a reaction system containing starch and carrying out a debranching reaction under high temperature conditions; wherein, the high temperature conditions are a temperature not lower than 70°C.
9. The application according to claim 8, characterized in that, The pH of the reaction system is 5.0-8.
0.
10. The application according to claim 8, characterized in that, The starch-containing reaction system is obtained by gelatinizing and liquefying starch; in the reaction system, the starch content is 1%-33% by mass-volume ratio.