Method for cultivating low-cadmium accumulation rice through CRISPRCas9 saturated editing OsHMA3 promoter
Editing the rice OsHMA3 promoter using CRISPR/Cas9 technology solved the problem of cadmium accumulation in rice grains, enabling the cultivation of low-cadmium-accumulation rice with excellent agronomic traits, meeting non-GMO requirements, and suitable for rice production in cadmium-contaminated farmland.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
- Filing Date
- 2026-03-12
- Publication Date
- 2026-05-12
AI Technical Summary
Existing technologies are insufficient to effectively reduce cadmium accumulation in rice grains without affecting the agronomic traits of rice, resulting in cadmium-contaminated rice posing a threat to human health.
By editing the OsHMA3 promoter mediated by CRISPR/Cas9, the OsHMA3 protein-coding gene was regulated, reducing the cadmium content in rice grains and improving the cadmium retention capacity of roots. The OsHMA3 promoter in rice was saturated with CRISPR/Cas9 technology to screen out rice mutants with low cadmium accumulation.
It significantly reduces cadmium content in rice grains, improves cadmium retention capacity in roots, meets food safety standards, exhibits excellent agronomic traits, is easy and efficient to operate, and meets non-GMO requirements.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of crop molecular breeding and environmental remediation technology, specifically relating to a method for cultivating low-cadmium-accumulating rice by saturating the OsHMA3 promoter with CRISPRCas9. Background Technology
[0002] Cadmium (Cd) is a highly toxic heavy metal, and soil cadmium pollution has become a global environmental problem, posing a serious threat to crop production and human health. Globally, soil cadmium pollution results in crop losses of up to 15,000 tons annually. Rice, the staple food of more than half the world's population, has a strong ability to absorb and accumulate cadmium from the soil. Consuming cadmium-contaminated rice is one of the main ways humans ingest cadmium, and long-term intake can lead to various diseases such as Itai-itai disease, kidney dysfunction, and even cancer. Therefore, cultivating rice varieties with low cadmium accumulation is a key approach to solving the food security problem caused by soil cadmium pollution.
[0003] The transfer of cadmium from soil to rice grains mainly involves three key steps: root absorption, root-stem translocation, and grain distribution. Studies have shown that rice roots primarily absorb cadmium from the soil through natural resistance-associated macrophage protein 5 (OsNramp5). After absorption, a portion of the cadmium is isolated in vacuoles under the mediation of vacuolar membrane-localized heavy metal ATPase 3 (OsHMA3). Loss of function of this gene leads to a large accumulation of cadmium in the aboveground parts and grains, while overexpression enhances the root system's ability to retain cadmium and reduces grain cadmium content. Another portion of the cadmium is distributed through… OsHMA3 homologous genes OsHMA2 It was mediated and transported to the aboveground part. Summary of the Invention
[0004] The purpose of this invention is to provide an efficient and safe method for cultivating non-GMO, low-cadmium-accumulating rice, through CRISPR / Cas9-mediated... OsHMA3 Promoter editing significantly reduces cadmium accumulation in rice grains without affecting agronomic traits, providing technical support and superior varieties for the safe utilization of cadmium-contaminated farmland.
[0005] To achieve the above objectives, the present invention provides the application of a substance for gene editing regulatory elements, wherein the application may be any of the following:
[0006] A1) Application in regulating cadmium content in plants; A2) Application in the preparation of products that regulate cadmium content in plants; A3) Application in cultivating plants with altered cadmium content; A4) Application in the preparation of products from plants with altered cadmium content; A5) Applications in plant breeding; The regulatory element is a regulatory element that regulates the gene encoding the OsHMA3 protein, and the OsHMA3 protein is any one of the following: B1) The amino acid sequence of this protein is SEQ ID NO: 2. B2) A protein having the same function as the amino acid sequence shown in SEQ ID NO: 2, but with substitution and / or deletion and / or addition of amino acid residues. Proteins that share more than 80% amino acid sequence identity with B1) and B2) and have the same function, B4) A fusion protein obtained by attaching a tag to the end of any of the proteins defined in B1)-B3).
[0007] In the above applications, the adjustable element is derived from rice.
[0008] In the above application, the indicator for plant breeding is the cadmium content of the plant, and the purpose of plant breeding is to cultivate plants with altered cadmium content in the seeds and / or roots. The alteration can be an increase or decrease in cadmium content in the seeds and / or roots.
[0009] The OsHMA3 protein can be synthesized artificially, or its encoding gene can be synthesized first and then expressed biologically.
[0010] In this invention, the protein tag refers to a polypeptide or protein fused with a target protein using in vitro DNA recombination technology for expression, to facilitate the expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.
[0011] In this invention, the identity refers to the identity of amino acid sequences or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambdaratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences to calculate the identity value (%), then the identity value can be obtained.
[0012] In this invention, the 80% or more of identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.
[0013] The SEQ ID NO: 2 may consist of 1004 amino acid residues, as detailed below:
[0014] In some embodiments, the regulatory element may be a promoter. In some embodiments, the promoter is the OsHMA3 protein-coding gene (… OsHMA3 The upstream region of the promoter. In some embodiments, the promoter is a DNA molecule as shown in C1) or C2) below: C1) The nucleotide sequence is nucleotides 1495-1957 of SEQ ID NO: 1; Nucleic acid molecules that have more than 70% identity with the nucleotide sequences defined by C2 and C1 and have promoter activity.
[0015] In this application, promoter activity refers to the ability and efficiency of the promoter itself to bind universal transcription factors and RNA polymerases and effectively initiate transcription.
[0016] In the above applications, the substance may be any of the following: D1) sgRNA targeting the promoter; D2) Cas protein and D1) the sgRNA; D3) The gene encoding the sgRNA described in D1) and the gene encoding the Cas protein; D4) Biological material containing a gene encoding the sgRNA described in D1) and a gene encoding the Cas protein, wherein the biological material is a vector, expression cassette, or recombinant microorganism.
[0017] In some embodiments, regulating plant cadmium content means reducing plant cadmium content, and the target sequence of the sgRNA is positions 1917-1936 of SEQ ID NO: 1. In some embodiments, reducing plant cadmium content means reducing the cadmium content of rice seeds (grains). In some embodiments, reducing rice cadmium content means reducing the cadmium content of brown rice (caryopsis).
[0018] The term "sgRNA (single-guide RNA)" is a component of the CRISPR-Cas system, responsible for guiding the Cas protein to recognize and cleave target nucleic acid molecules. In practical gene editing applications, sgRNA can be synthesized directly or obtained through plasmid expression or in vitro transcription. In this field, "gRNA" and "sgRNA" are often used interchangeably. In this document, "gRNA" and "sgRNA" are also used interchangeably. sgRNA generally refers to a single RNA structure formed by artificially modifying the crRNA / tracrRNA complex (gRNA) with a dual RNA structure, directly (or through a linker) linking the crRNA and tracrRNA. sgRNA is a short RNA containing a recognition region and a framework region.
[0019] The term "recognition region," also known as a guide sequence, is typically an RNA sequence (referred to herein as the "guide sequence") that is identical to or complementary to the target sequence or target site within the target RNA (sgRNA or gRNA). The guide sequence is generally sufficiently complementary to the target sequence to hybridize with it and guide the CRISPR / Cas complex to specifically bind to the target sequence. Perfect complementarity between the guide sequence and the target sequence is preferred, but some mismatch (e.g., a mismatch of 1-6 nucleotides) is permissible, as long as it still results in gene knockout. The complementarity between the guide sequence and its corresponding target sequence is at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%. Methods for determining the complementarity of two nucleic acid sequences are within the capabilities of those skilled in the art.
[0020] The term "scaffold" generally refers to the structural or scaffold RNA sequence that guides the binding or interaction of RNA with RNA-directed nucleases and / or other RNA molecules (e.g., tracrRNA) into RNA (sgRNA or gRNA), and can also be called the backbone sequence of sgRNA. The scaffold can be conventionally selected by those skilled in the art; for example, it can be the backbone sequence of the sgRNA corresponding to Cas9, or it can be a mutant constructed based on this sequence that still retains the function of binding the corresponding Cas9.
[0021] In some embodiments, the regulation of plant cadmium content is to reduce the cadmium content in plant seeds and / or increase the cadmium content in plant roots, wherein the target sequence of the sgRNA is positions 1917-1936 of SEQ ID NO: 1.
[0022] In some embodiments, the regulation of plant cadmium content is to increase the cadmium content in plant seeds and / or decrease the cadmium content in plant roots, wherein the target sequence of the sgRNA is the sgRNA at positions 1521-1540 of SEQ ID NO: 1.
[0023] In some embodiments, the control element is a 5' untranslated region (5'-UTR).
[0024] In some embodiments, the sgRNA targets the double-stranded DNA whose nucleotide sequence is SEQ ID NO: 1, specifically 5′-TCCTCGTCATCTCCAGATCG-3′.
[0025] In the above applications, the gene described in D3) is introduced into the recipient plant, specifically by transforming plant cells or tissues using conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electrocoagulation, and Agrobacterium-mediated transformation, and then cultivating the transformed plant tissues into plants. The transformed cells, tissues, or plants are understood to include not only the final products of the transformation process but also the materials obtained through asexual reproduction and transgenic progeny.
[0026] Those skilled in the art can readily mutate the regulatory element sequence of the present invention using known methods, such as directed evolution and point mutation. Artificially modified nucleotides that have 75% or more identity with the nucleotide sequence of the regulatory element of the present invention, provided they have the same function, are derived from and are equivalent to the sequence of the present invention.
[0027] The aforementioned 80% or higher degree of identity can be 80%, 85%, 90%, or 95% or higher degree of identity.
[0028] In this article, identity refers to the similarity of amino acid or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, a search can be performed to calculate the identity of amino acid sequences, and then the identity value (%) can be obtained.
[0029] In this document, the 80% or more of identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.
[0030] The vectors described herein are known to those skilled in the art and include, but are not limited to: plasmids, bacteriophages (such as λ phage or M13 filamentous phage), granules (i.e., Cos plasmids), Ti plasmids, or viral vectors.
[0031] In this invention, the gene editing can be the insertion or deletion of nucleotide sequences.
[0032] In one embodiment of the present invention, the recombinant vector may be a plant gene editing vector, and the plant gene editing vector may be a VK005 editing vector.
[0033] As a specific embodiment, the recombinant vector is the recombinant vector VK005-sgRNA3, and the sequence of the recombinant vector is shown in SEQ ID NO: 3 and SEQ ID NO: 4.
[0034] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS genes, luciferase genes, etc.), antibiotic resistance markers (gentamicin markers, kanamycin markers, etc.), or chemical reagent resistance marker genes (such as herbicide resistance genes). From a safety perspective, transgenic plants can be screened directly under stress without adding any selective marker genes.
[0035] In the above applications, the microorganism described in D4) can be yeast, bacteria, algae, or fungi. Specifically, it can be Agrobacterium tumefaciens EHA105. The recombinant microorganism can specifically be EHA105 / VK005-sgRNA3 and / or EHA105 / VK005-sgRNA8.
[0036] In the above applications, the plant may be any of the following: N1) dicotyledonous or monocotyledonous plants; N2) Poales plants; N3) Poaceae plants; N4) Oryza plants; N5) rice.
[0037] The present invention also provides a method, which may be M1 or M2: M1. A method for reducing cadmium content in rice, the method comprising gene editing of the aforementioned regulatory element to obtain gene-edited rice, thereby reducing the cadmium content of the rice to be improved; wherein the cadmium content of the gene-edited rice is lower than that of the rice to be improved; M2. A breeding method for cultivating rice with reduced cadmium content, the method comprising gene editing of rice containing the regulatory elements described above to obtain rice with reduced cadmium content, wherein the cadmium content of the rice with reduced cadmium content is lower than that of the rice to be improved.
[0038] In some embodiments, reducing the cadmium content in rice refers to reducing the cadmium content in rice seeds (grains). In some embodiments, reducing the cadmium content in rice refers to reducing the cadmium content in brown rice (calyxes).
[0039] In the above method, M1 and M2 may include the step of introducing the aforementioned substance into the rice to be improved.
[0040] The gene-edited rice is obtained by knocking out the regulatory element in rice to be improved that contains the regulatory element.
[0041] The cadmium content in the seeds of the gene-edited rice is lower than that in the rice to be improved.
[0042] In some embodiments, in methods M1 and M2, the gene editing is an insertion or deletion mutation. In one embodiment, the gene editing involves deleting positions 1870-1918 of SEQ ID NO: 1 in the genome of the rice to be improved (i.e., deleting the following 49 nucleotides: 5'-ttttggcgccgccgtcgctgtcgccgacgacaccaccgccgccgccgccgtc-3'). The present invention also provides the aforementioned substance.
[0043] The present invention also provides gene-edited rice, wherein the gene-edited rice may be rice that does not contain the regulatory elements described above.
[0044] In some embodiments, the gene-edited rice is rice obtained by deleting positions 1870-1918 of SEQ ID NO: 1 in the genome of the rice to be improved (i.e., deleting the following 49 nucleotides: 5'-ttttggcgccgccgtcgctgtcgccgacgacaccaccgccgccgccgccgtc-3').
[0045] In some embodiments, the cadmium content in the seeds (brown rice) of the gene-edited rice is lower than that in the rice to be improved and / or the cadmium content in the roots is higher than that in the rice to be improved.
[0046] In some specific embodiments, the gene-edited rice is obtained by knocking out the regulatory element in rice to be improved, which contains the regulatory element.
[0047] In some specific embodiments, the knockout is achieved via a CRISPR-Cas system. The CRISPR-Cas system includes an RNA-directed nuclease (Cas protein) and sgRNA.
[0048] In this application, Cas protein is an "RNA-directed nuclease," which refers to an RNA-directed DNA endonuclease associated with the CRISPR system. Unrestricted examples of RNA-directed nucleases include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, Cpf1, their homologs or modified forms thereof. In one implementation, the RNA-directed nuclease is Cas9 or nCas9 (D10A).
[0049] The gene-edited rice may be the whole rice plant or a part of it (cells, tissues and / or organs).
[0050] The cells include original knockout cells (T0 generation cells), cells regenerated or developed from T0 generation cells, cells from any progeny or descendant of T0, including seed or embryo cells, or cultured cells, callus cells, etc.
[0051] The tissues and / or organs may be original knockout T0 generation, meristematic tissues regenerated or developed from T0 generation, bud organs / structures (e.g., leaves, stems, or nodes), roots, flowers or floral organs / structures (e.g., flowers, bracts, sepals, petals, stamens, carpels, anthers, and ovules), seeds (e.g., embryos, endosperm, and seed coats), fruits (e.g., mature ovaries), propagules, or other plant tissues (e.g., vascular tissue, dermal tissue, ground tissue). The tissues and / or organs may also be tissues and / or organs from any progeny or descendant of T0.
[0052] In some specific embodiments of the present invention, the rice to be improved may be the rice variety Zhonghua 11 (ZH11).
[0053] In some specific embodiments of the present invention, the gene-edited rice can be... HMA3-Pro3 The mutant, after being treated with nutrient solution containing 0.5 μM cadmium, showed significantly lower cadmium concentrations in the aboveground parts and significantly higher cadmium concentrations in the roots than the wild type; when planted in highly cadmium-contaminated soil, the cadmium concentration in brown rice decreased from 0.27 mg / kg in the wild type to below 0.16 mg / kg.
[0054] In some specific embodiments of the present invention, the gene-edited rice can be... HMA3-Pro8 The mutant, after being treated with nutrient solution containing 0.5 μM cadmium, showed significantly higher cadmium concentrations in the aboveground parts than the wild type, and significantly lower cadmium concentrations in the roots than the wild type.
[0055] This invention utilizes CRISPR / Cas9 technology to study rice. OsHMA3 Saturated promoter editing successfully bred a low-cadmium-accumulating rice mutant, which has the following beneficial effects: Non-GMO characteristics: This invention obtains mutants by editing the cis-regulatory region (promoter) of a gene, without introducing exogenous genes. It is a non-GMO material, which complies with relevant regulatory policies and market demands, and has broad application prospects.
[0056] Significantly low cadmium accumulation effect: obtained through screening HMA3-Pro3 When the mutant was planted in highly cadmium-contaminated soil, the cadmium concentration in brown rice decreased from 0.27 mg / kg in the wild type to 0.16 mg / kg, a reduction of 40.7%, which is far below the national food safety standard (0.2 mg / kg). Under different cadmium concentration treatments, it could significantly reduce cadmium accumulation in the aboveground parts and improve the cadmium retention capacity of the roots.
[0057] Excellent agronomic traits: HMA3-Pro3 The mutant showed no significant differences from the wild type in agronomic traits such as single-plant yield, aboveground dry weight, plant height, thousand-grain weight, and number of grains per ear, thus solving the potential yield reduction problem in traditional low-cadmium breeding.
[0058] The absorption of essential elements is not affected: the content of essential elements such as zinc, manganese and iron in the mutant is not significantly different from that in the wild type, thus ensuring the nutritional quality of rice.
[0059] Technically efficient and feasible: This invention uses CRISPR / Cas9 technology for promoter saturation mutagenesis, which has high screening efficiency and can quickly obtain target mutants, providing an efficient molecular breeding method for the cultivation of low cadmium rice varieties.
[0060] This invention provides editing via CRISPR / Cas9 OsHMA3 The method for cultivating low-cadmium-accumulating rice using promoters is simple to operate and highly efficient. The resulting mutants are non-GMO, have low cadmium accumulation, and exhibit excellent agronomic traits. They can be directly applied to rice production in cadmium-contaminated farmland or used as parent materials for low-cadmium rice breeding. This method has broad industrial application prospects and significant social, economic, and environmental benefits. Attached Figure Description
[0061] Figure 1It is a T1 generation homozygous non-transgenic mutant screening and genotype editing mode.
[0062] Figure 2 It is for screening and identification of low cadmium accumulation mutants.
[0063] Figure 3 yes HMA3-Pro3 In mutant strains and wild-type ZH11 (WT) OsHMA3 Gene expression level detection.
[0064] Figure 4 yes HMA3-Pro3 Heavy metal accumulation characteristics in the stems of mutant strains and wild-type ZH11 (WT) under different cadmium concentration treatments.
[0065] Figure 5 yes HMA3-Pro3 Heavy metal accumulation characteristics in roots of mutant strains and wild-type ZH11 (WT) under different cadmium concentration treatments.
[0066] Figure 6 yes HMA3-Pro3 Mutant strains and wild-type ZH11 (WT) grains accumulate lower cadmium levels.
[0067] Figure 7 This is a comparison of agronomic traits between the HMA3-Pro3 mutant and the wild-type ZH11 (WT). Detailed Implementation
[0068] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0069] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0070] The following examples used SPSS 11.5 statistical software to process the data. The experimental results are expressed as mean ± standard deviation. One-way ANOVA was used, and P < 0.05 was considered satisfactory. () indicates a significant difference, P < 0.01. () indicates a highly significant difference, P < 0.001. () indicates a highly significant difference.
[0071] In the following examples, the variety approval number of Zhonghua 11 (ZH11) rice is: Tianjin Approval Rice 1989016.
[0072] Example 1 OsHMA3 Acquisition and identification of gene promoter mutation materials I. sgRNA Design Startup sub-region determination: based on published rice OsHMA3 The gene sequence was analyzed to determine its upstream 500bp promoter region, which is... OsHMA3 The gene sequence (SEQ ID NO: 1, 5803bp) contains a 463bp regulatory region (corresponding to positions 1495-1957 of SEQ ID NO: 1) and a 37bp 5' untranslated region (5'-UTR) (corresponding to positions 1958-1994 of SEQ ID NO: 1), as detailed in SEQ ID NO: 1 below: In SEQ ID NO: 1, positions 1-1952 are the regulatory region, positions 1953-1994 are the 5'-UTR, positions 1995-2283, 2386-2741, 2830-3085, 3299-3436, 3533-3863, 4047-4252, and 4365-5803 are exons, and the rest are introns, as detailed below:
[0073] The protein encoded by SEQ ID NO: 1 is SEQ ID NO: 2 (1004aa), as follows:
[0074] sgRNA design: Using CRISPR design tools, 11 specific sgRNAs and related primers were designed for the above 500bp region to ensure the targeting specificity and editing efficiency of the sgRNAs. The specific sequences are shown in the table below. The uppercase letter sequences in F (5'-3') are the corresponding target sites of the sgRNAs.
[0075] Table 1. Specific sgRNAs and related primer sequences
[0076] II. Construction of CRISPR / Cas9 Editing Vector The designed sgRNAs were cloned into the VK005 editing vector to construct recombinant editing vectors. The correctness of the vector construction was verified by enzyme digestion and sequencing. Taking sgRNA3 (corresponding to the reverse complementary sequence of positions 1917-1936 of SEQ ID NO: 1) as an example, the specific experimental procedure is as follows: The VK005 vector contains a hygromycin expression cassette from positions 1407 to 3390; positions 5098 to 11534 contain a Cas9 protein expression cassette. Take 3 μg of VK005 plasmid and digest it with BspQI at 37°C for 4 hours. The recovered plasmid is then used to achieve a concentration of 100 ng / μL. The digestion system is as follows:
[0077] Step 1: Formation of the oligo duplex Use pHMA3-3F: 5'-cagCGATCTGGAGATGACGAGGA-3' and pHMA3-3R: 5'-aacTCCCTCGTCATCTCCAGATCG-3' The synthesized oligos were diluted to 10 μM and mixed in the following proportions.
[0078] After mixing, proceed as follows: 95℃ for 3 minutes Slowly cool from 95°C to 25°C, for example, -1°C / 20 seconds, or place the sample tube in 95°C water and allow it to cool naturally to room temperature (16°C) for 5 minutes.
[0079] Step 2: The oligo dimer is inserted into the carrier, and the reaction is carried out at 16°C for 2 hours according to the following system.
[0080]
[0081] Step 3: Conversion Take 5-10 μL of the final product from step two and add it to 50 μL of freshly thawed DH5α competent cells. Gently mix, incubate on ice for 30 minutes, heat shock at 42°C for 90 seconds, let stand on ice for 2 minutes, then add 500 μL of antibiotic-free LB, place in a 37°C constant temperature shaker, rotate at 170 rpm, and after one hour of recovery, plate the Kana+ resistant (Kana+) plate.
[0082] Step 4: Identification of positive clones Select 3 to 5 white colonies, shake them to collect 4 ml of bacterial culture, extract plasmids, and sequence them.
[0083] The sequence of positions 1-15000 of the recombinant editing vector VK005-sgRNA3 is SEQ ID NO: 3, where positions 4501-4520 are the target site CGATCTGGAGATGACGAGGA corresponding to sgRNA3, and the sequence of positions 15001-16857 is SEQ ID NO: 4.
[0084] The other recombinant vector sequences differ from SEQ ID NO: 3 in that positions 4501-4520 are replaced with the corresponding sgRNA target sites. Ultimately, 11 recombinant editing vectors were obtained, from VK005-sgRNA1 to VK005-sgRNA11.
[0085] III. Agrobacterium-mediated rice transformation Rice callus induction: Mature seeds of rice variety ZH11 were dehulled, disinfected with 70% ethanol for 30 seconds, then disinfected with 5% sodium hypochlorite solution for 20 minutes, rinsed with sterile water 3-5 times, and inoculated onto callus induction medium. The seeds were then cultured in the dark at 28°C for 2-3 weeks to obtain embryogenic callus.
[0086] Agrobacterium transformation: The constructed recombinant editing vector was transformed into Agrobacterium EHA105 competent cells to obtain recombinant Agrobacterium EHA105 / VK005-sgRNA3; positive Agrobacterium clones were identified by PCR. After co-culturing positive Agrobacterium with rice callus for 3 days, the cells were transferred to a selection medium containing hygromycin for resistance selection to obtain resistant callus.
[0087] Differentiation and regeneration: The resistant callus was transferred to a differentiation medium and cultured under light at 28°C to induce shoot differentiation; when the shoots grew to 2-3 cm, they were transferred to a rooting medium to induce rooting and obtain T0 generation regenerated plants.
[0088] IV. Mutant Screening and Identification Identification of T0 generation plants: Genomic DNA was extracted from the T0 generation regenerated plants and amplified using PCR. OsHMA3 The promoter target region was analyzed, and the PCR products were verified by Sanger sequencing to determine whether insertion or deletion mutations occurred. A total of 300 independent T0 generation edited plants were obtained.
[0089] For DNA fragments within 500 bp containing the target site, a pair of specific primers was designed on the genome. Using the genomic DNA of T0 generation transgenic rice as a template, the DNA fragment containing the target site was amplified. The specific steps are as follows: Using the DNA described above as a template, and with upstream primer H-F1 and downstream primer H-R1 from Table 2, the DNA fragment containing the target site was amplified using 2×KOFU high-fidelity enzyme Mix. Specific primer information is shown in Table 2 below.
[0090] Table 2 Primers used for mutation identification
[0091] PCR reaction system: 0.5µL DNA template, 1µL H-F1, 1µL H-R1, 20µL ddH2O, 25µL 2×kofu high-fidelity enzyme Mix. Reaction program: 95℃ pre-denaturation for 3 min, 32 cycles: 96℃ denaturation for 10 s, 68℃ extension for 30 s, 68℃ extension for 5 min.
[0092] Screening of T1 generation homozygous non-transgenic mutants: T0 generation positive mutant plants were self-pollinated to obtain T1 generation seeds. Genomic DNA was extracted from the T1 generation plants after sowing, and genotyping was performed to screen for homozygous mutants. Simultaneously, transgenic elements (such as the hygromycin resistance gene) were detected by PCR to screen for non-transgenic homozygous mutants. A total of 11 non-transgenic, homozygous edited mutants were obtained, with the editing pattern as follows: Figure 1 As shown.
[0093] V. Screening and Identification of Low Cadmium Accumulation Mutants Cadmium treatment experiment in nutrient solution: Seedlings of 11 T2 generation homozygous mutants were planted in a nutrient solution containing 0.5 μM cadmium and cultured for 7 days. The cadmium concentrations in the aboveground parts and roots were then measured. The results showed that... HMA3-Pro3 The aboveground cadmium concentration of the mutant was significantly lower than that of the wild type, while the root cadmium concentration was significantly higher than that of the wild type. HMA3-Pro8 The aboveground cadmium concentration of the mutants was significantly higher than that of the wild type, while the root cadmium concentration was significantly lower than that of the wild type; the cadmium concentration of the remaining 9 mutants was not significantly different from that of the wild type. Therefore, selection... HMA3-Pro3 Further research on the mutants ( Figure 2 ).
[0094] Compared to wild-type ZH11, HMA3-Pro3 The gene editing pattern of the mutant is as follows: In both homologous chromosomes, a 49-nucleotide 5'-ttttggcgccgccgtcgctgtcgccgacgacaccaccgccgccgccgccgtc-3' deletion exists at positions 1870-1918 of the genome sequence (SEQ ID NO: 1), thus affecting... OsHMA3 Gene expression levels.
[0095] OsHMA3 Gene expression level detection: wild-type and... HMA3-Pro3 In the mutant root system OsHMA3 Gene expression levels. Extracted from 2-week-old embryos. HMA3-Pro3 mRNA from the root tissues of wild-type seedlings was reverse transcribed into cDNA and examined using a real-time PCR instrument. OsHMA3 Gene expression levels.
[0096] The results showed that, under both untreated and cadmium-treated conditions, HMA3-Pro3 mutant OsHMA3 The relative level of mRNA was 4.32±0.319, which is about 4 times that of the wild type (1.02±0.028). Figure 3 ).
[0097] Example 2: Heavy metal accumulation characteristics under different cadmium concentrations wild-type ZH11 and HMA3-Pro3 Seedlings of the mutants were planted in nutrient solutions containing 0.2 μM, 0.5 μM, and 1.0 μM cadmium, respectively. The culture conditions were: 16 h light at 11000 Lux followed by 8 h darkness; daytime temperature of 30–37 °C; and nighttime temperature of 25–28 °C. Cadmium concentrations in the aboveground parts and roots were measured after 7 days of culture. The biological experiments were repeated three times, with three seedlings taken from each treatment group for each line.
[0098] The methods for detecting metal ion concentration are as follows: Plant samples were dried in a 70℃ oven for 3 days, then nitrated with nitric acid at 150℃ for 6 hours, and finally diluted to 50 mL. Metal ions were detected using ICP-MS (inductively coupled plasma mass spectrometry).
[0099] The nutrient solution preparation method is as follows: Half-concentration Kimura B nutrient solution formula (1 L) Add the following to each liter of deionized water: ammonium sulfate 48.2 mg, magnesium sulfate heptahydrate 135.1 mg, potassium nitrate 18.5 mg, calcium nitrate tetrahydrate 86.4 mg, potassium dihydrogen phosphate 24.8 mg, potassium sulfate 15.0 mg, boric acid 2.86 mg, manganese chloride tetrahydrate 1.81 mg, ammonium molybdate tetrahydrate 0.09 mg, zinc sulfate heptahydrate 0.22 mg, copper sulfate pentahydrate 0.08 mg, and NaFeEDTA trihydrate 7.34 mg. After thorough dissolution and mixing, adjust the pH to 5.5–5.7 with acid or alkali.
[0100] The results showed that at three cadmium concentration gradients of 0.2 μM, 0.5 μM, and 1.0 μM, HMA3-Pro3 The cadmium concentrations in the aboveground parts of the mutants were 7.92±0.86 mg / kg, 17.27±0.88 mg / kg, and 19.91±0.99 mg / kg, respectively, which were significantly lower than those in the wild type (16.34±0.99 mg / kg, 27.00±0.87 mg / kg, and 30.15±0.97 mg / kg). Under 0.5 μM and 1.0 μM cadmium treatments, HMA3-Pro3 The cadmium concentrations in the roots of the mutants were 644.35±25.82 mg / kg and 686.37±55.77 mg / kg, respectively, significantly higher than those in the wild type (502.87±16.32 mg / kg and 525.80±11.22 mg / kg). Simultaneously, the cadmium concentrations in the aboveground parts (…) were also measured. Figure 4 ) and root system ( Figure 5 The concentrations of zinc, manganese, and iron were measured, and the results showed... HMA3-Pro3 The mutant was not significantly different from the wild type, indicating that the mutant does not affect the absorption of essential elements.
[0101] Example 3: Planting Experiment in High-Cadmium-Contaminated Soil Three wild-type ZH11 plants and HMA3-Pro3 The mutants were grown in pots in soil with high cadmium contamination. The cultivation conditions were: 16 hours of light at 11000 Lux and 8 hours of darkness; daytime temperature of 30–37°C and nighttime temperature of 25–28°C. After maturity, the seeds and aboveground parts were harvested, and the heavy metal concentrations were determined according to the method in Example 2.
[0102] The results are as follows Figure 6 As shown, HMA3-Pro3 The cadmium concentration in brown rice of the mutant was 0.16±0.008 mg / kg, significantly lower than that in the wild type (0.27±0.011 mg / kg); the cadmium concentration in the aboveground stems was 0.38±0.06 mg / kg, also significantly lower than that in the wild type (0.59±0.08 mg / kg); while the concentrations of zinc, manganese, and iron in brown rice and aboveground parts were not significantly different from those in the wild type.
[0103] Example 4: Comparison of agronomic traits in the field Will HMA3-Pro3 Mutant seeds and wild-type ZH11 seeds were planted in an experimental field (non-cadmium contaminated). Sowing began in May 2024, and rice seedlings were transplanted to the paddy field in June. Fertilizer (compound fertilizer) was applied in August, and the field was kept well-watered. Water supply was reduced after grain filling in early September, and the rice was harvested in October. Ten plants were randomly selected for agronomic trait survey.
[0104] The results of the agronomic trait survey show that, HMA3-Pro3 The mutant's single-plant yield was 25.34±1.35g, aboveground dry weight was 24.57±2.36g, plant height was 127.2±0.83cm, thousand-grain weight was 27.11±0.33g, and number of grains per ear was 101.8±4.58, all of which were not significantly different from the wild type. Figure 7 ).
[0105] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.
Claims
1. The application of substances that act as gene editing regulatory elements, characterized in that, The application is any one of the following: A1) Application in regulating cadmium content in plants; A2) Application in the preparation of products that regulate cadmium content in plants; A3) Application in cultivating plants with altered cadmium content; A4) Application in the preparation of products from plants with altered cadmium content; A5) Applications in plant breeding; The regulatory element is a regulatory element of the OsHMA3 protein encoding gene, and the OsHMA3 protein is any one of the following: B1) The amino acid sequence of this protein is SEQ ID NO:
2. B2) A protein having the same function as the amino acid sequence shown in SEQ ID NO: 2, but with substitution and / or deletion and / or addition of amino acid residues. Proteins that share more than 80% amino acid sequence identity with B1) and B2) and have the same function, B4) A fusion protein obtained by attaching a tag to the end of any of the proteins defined in B1)-B3).
2. The application according to claim 1, characterized in that, The control element is derived from rice.
3. The application according to claim 1 or 2, characterized in that, The control element is a promoter.
4. The application according to claim 3, characterized in that, The promoter is a DNA molecule as shown in C1) or C2) below: C1) The nucleotide sequence is nucleotides 1495-1957 of SEQ ID NO: 1; Nucleic acid molecules that have more than 70% identity with the nucleotide sequences defined by C2 and C1 and have promoter activity.
5. The application according to claim 4, characterized in that, The substance is any one of the following: D1) sgRNA targeting the promoter; D2) Cas protein and D1) the sgRNA; D3) The gene encoding the sgRNA described in D1) and the gene encoding the Cas protein; D4) Biological material containing a gene encoding the sgRNA described in D1) and a gene encoding the Cas protein, wherein the biological material is a vector, expression cassette, or recombinant microorganism.
6. The application according to claim 5, characterized in that, The regulation of plant cadmium content is to reduce the cadmium content in plant seeds, and the target sequence of the sgRNA is positions 1917-1936 of SEQ ID NO:
1.
7. The application according to any one of claims 1-6, characterized in that, The plant is any one of the following: N1) Dicotyledonous or monocotyledonous plants; N2) Plants of the order Poales; N3) Gramineae plants; N4) Rice plants; N5) rice.
8. The method, characterized in that, The method is M1 or M2: M1. A method for reducing cadmium content in rice, the method comprising gene editing the regulatory element described in claim 1 to obtain gene-edited rice, thereby reducing the cadmium content of the rice to be improved; wherein the cadmium content of the gene-edited rice is lower than that of the rice to be improved; M2. A breeding method for cultivating rice with reduced cadmium content, the method comprising gene editing of rice to be improved containing the regulatory element described in claim 1 to obtain rice with reduced cadmium content, wherein the cadmium content of the rice with reduced cadmium content is lower than that of the rice to be improved.
9. The method according to claim 8, characterized in that, M1 and M2 include the step of introducing the substance of claim 5 or 6 into the rice to be improved.
10. Gene-edited rice, characterized in that, The gene-edited rice is rice that does not contain any of the regulatory elements described in claims 1-4.