Construction method and application of gene knockout mouse model based on ichthyosis virulence gene GLTP

By identifying GLTP gene mutations and constructing a Gltp gene knockout mouse model, the problem of the unknown pathogenic gene of hereditary ichthyosis has been solved, the disease mechanism has been revealed, and tools for research and treatment have been provided to support gene therapy and drug development.

CN122012690APending Publication Date: 2026-05-12DERMATOLOGY HOSPITAL SOUTHERN MEDICAL UNIV (GUANGDONG PROVINCIAL DERMATOLOGY HOSPITAL GUANGDONG PROVINCIAL CENT FOR STI & SKIN DISEASES CONTROL & PREVENTION RES CENT FOR LEPROSY CONTROL & PREVENTION CHINA)
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
DERMATOLOGY HOSPITAL SOUTHERN MEDICAL UNIV (GUANGDONG PROVINCIAL DERMATOLOGY HOSPITAL GUANGDONG PROVINCIAL CENT FOR STI & SKIN DISEASES CONTROL & PREVENTION RES CENT FOR LEPROSY CONTROL & PREVENTION CHINA)
Filing Date
2026-01-29
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

In the current technology, the pathogenic gene of hereditary ichthyosis is unknown, the pathogenesis is unclear, and there is a lack of effective diagnostic methods and therapeutic targets.

Method used

By identifying GLTP gene mutations, a Gltp gene knockout mouse model was constructed. Using CRISPR/Cas9 technology, mouse fertilized eggs were microinjected, and heterozygous mice were screened and self-crossed to obtain Gltp gene knockout mice, which simulate the characteristics of human ichthyosis, providing a tool for studying disease mechanisms and screening drugs.

Benefits of technology

A Gltp gene knockout mouse model was successfully constructed, simulating the symptoms of human ichthyosis. This revealed the mechanism by which GLTP deficiency leads to abnormal autophagy and skin barrier dysfunction, providing a tool for gene therapy and drug development, and supporting preclinical evaluation and personalized treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012690A_ABST
    Figure CN122012690A_ABST
Patent Text Reader

Abstract

The invention discloses a construction method and application of a gene knockout mouse model based on ichthyosis virulence gene GLTP. The NCBI (National Center of Biotechnology Information) gene ID (Identity) of the GLTP gene is 51228. The Gltp gene knockout mouse model is constructed by the following method: assembling sgRNA of a targeted mouse Gltp gene and Cas9 protein in vitro to obtain a CRISPR (clustered regularly interspaced short palindromic repeats) / Cas9-sgRNA compound; performing micro-injection on the compound to fertilized eggs of mice, and transplanting the fertilized eggs to obtain positive F0-generation mice; after the positive F0-generation mice and wild mice are mated, heterozygotes are screened, the heterozygotes are subjected to selfing, and the F0-generation mice are obtained. The GLTP gene is clearly identified as a new pathogenic gene of ichthyosis for the first time, the constructed Gltp gene knockout mouse model can spontaneously generate ichthyosis-like skin lesion, human disease characteristics are simulated, and a more ideal tool is provided for researching ichthyosis disease pathogenesis and screening targeted drugs.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of medical genetics technology, and more specifically, this invention relates to a novel pathogenic gene for ichthyosis. GLTP Identification and mouse-based Gltp Gene construction Gltp Methods and applications of gene knockout mouse models. Background Technology

[0002] Hereditary ichthyosis is a group of skin diseases characterized by abnormal keratinization, scaling, and barrier dysfunction. Although some pathogenic genes and mechanisms of ichthyosis have been preliminarily elucidated in recent years, the pathogenic genes of a considerable proportion of patients remain unknown, and the pathogenesis is unclear.

[0003] Therefore, finding new pathogenic genes for ichthyosis and studying their functional mechanisms is of great significance for a deeper understanding of the gene regulatory network of the skin barrier, and can also provide new drug targets for clinical treatment. Summary of the Invention

[0004] Based on this, the purpose of this invention is to provide a new pathogenic gene for ichthyosis, and based on this pathogenic gene, to provide a method for constructing a gene knockout mouse model and its application.

[0005] The specific technical solutions for achieving the above-mentioned objectives are as follows.

[0006] A first aspect of the present invention provides a detection GLTP The application of gene mutation reagents in the preparation of reagent kits for the diagnosis or auxiliary diagnosis of ichthyosis, wherein... GLTP The gene's NCBI gene ID is 51228.

[0007] A second aspect of the present invention provides a kit for diagnosing or assisting in the diagnosis of ichthyosis, comprising detecting... GLTP Reagents for gene mutation, the GLTP The gene's NCBI gene ID is 51228.

[0008] A third aspect of the present invention provides Gltp The method for constructing a gene knockout mouse model includes the following steps: (1) Targeting mice Gltp The sgRNA of the gene and the Cas9 protein were assembled in vitro to obtain the CRISPR / Cas9-sgRNA complex; (2) The CRISPR / Cas9-sgRNA complex described in step (1) was microinjected into mouse zygotes, and positive F0 generation mice were obtained by transplanting the zygotes. (3) After mating positive F0 generation mice with wild-type mice, heterozygotes are selected, and the heterozygotes are self-crossed to obtain Gltp Gene knockout mouse model.

[0009] In a fourth aspect, the present invention provides a product constructed by the above-described construction method. Gltp Gene knockout mouse model.

[0010] The fifth aspect of the present invention provides the above. Gltp Application of gene knockout mouse models in the study of the pathological mechanism of ichthyosis and / or in screening drugs for the treatment of ichthyosis.

[0011] The inventors of this invention discovered this while studying seven patients with hereditary ichthyosis. GLTP Bile allele frameshifts or nonsense mutations (c.58_62del, c.85delC, c.98delT, c.49C>T, and c.180C>A) can lead to GLTP The loss of gene expression, leading to ichthyosis, has been clearly identified for the first time. GLTP This invention identifies a novel pathogenic gene for ichthyosis and reveals for the first time the complete molecular pathway by which GLTP deficiency leads to abnormal autophagy and subsequently skin barrier dysfunction, thus establishing a disease pathogenesis model of "gene defect-autophagy blockade-barrier disruption." This invention has significant value in translational medicine research, providing support for preclinical evaluation of gene therapy strategies, optimization of drug delivery systems, and development of personalized treatment plans.

[0012] This invention utilizes gene knockout technology to select mice. Gltp Exons 2-4 of the gene were used as the target region to ensure the absence of protein expression after knockout, thus successfully constructing... Gltp Gene knockout mouse models, which spontaneously develop ichthyosis-like skin lesions, mimic the characteristics of human diseases, providing a more ideal tool for studying the pathogenesis of ichthyosis and screening targeted drugs (small molecule drugs targeting the GLTP pathway, autophagy regulators, and barrier function repair drugs). Attached Figure Description

[0013] Figure 1 This is a diagram illustrating the clinical manifestations of a patient with congenital ichthyosis.

[0014] Figure 2 This refers to the pathological manifestations of skin lesions in patients with congenital ichthyosis.

[0015] Figure 3 For patients with congenital ichthyosis GLTP Gene mutation sequencing diagram.

[0016] Figure 4 The results of GLTP immunofluorescence on the skin of normal controls and patients with congenital ichthyosis are shown.

[0017] Figure 5 Electron microscopy results for normal controls and patients with congenital ichthyosis.

[0018] Figure 6 Immunofluorescence results of autophagy markers in normal controls and patients with congenital ichthyosis.

[0019] Figure 7 for Gltp + / + and Gltp - / - Western blotting and immunofluorescence results of mouse skin.

[0020] Figure 8 for [[ID=...]]... + / + and Gltp - / - Skin manifestations in mice.

[0021] Gltp for Figure 9 + / + and Gltp - / - Pathological characteristics of mouse skin tissue.

[0022] [[ID=3...]]... for Gltp + / + and Figure 10 - / - TEWL score and toluidine blue test results in mice.

[0023] Gltp for Gltp + / + and Figure 11 - / - Western blotting results of autophagy indicators in mouse epidermal tissue. Detailed Implementation

[0024] To facilitate understanding of the present invention, a more complete description will be provided below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0025] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the invention. The term "and / or" as used in this invention includes any and all combinations of one or more of the associated listed items.

[0026] Unless otherwise specified, experimental methods in the following examples were performed under standard conditions, such as those described in Green and Sambrook et al., *Molecular Cloning: A Laboratory Manual* (2013), or as recommended by the manufacturer. All commonly used chemical reagents used in the examples are commercially available products.

[0027] In some embodiments of the present invention, detection is disclosed. Gltp The application of gene mutation reagents in the preparation of reagent kits for the diagnosis or auxiliary diagnosis of ichthyosis, wherein... Gltp The gene's NCBI gene ID is 51228.

[0028] In one embodiment, the mutation site includes one or two of c.49C>T, c.58_62del, c.85delC, c.98delT, and c.180C>A. In this invention, the... GLTP Gene mutations include GLTP Any biallelic frameshift or nonsense mutation that could lead to loss of GLTP protein expression, including but not limited to c.58_62del, c.85delC, c.98delT, c.49C>T and c.180C>A.

[0029] In one embodiment, the reagent is a primer or a probe.

[0030] In one embodiment, the reagent comprises: (a) Primer pairs for detecting c.49C>T, c.58_62del, c.85delC and c.98delT, the nucleotide sequences of which are shown in SEQ ID NO:1~SEQ ID NO:2; (b) Primer pairs used to detect c.180C>A, the nucleotide sequences of which are shown in SEQ ID NO:5~SEQ ID NO:6.

[0031] In other embodiments of the present invention, a kit for diagnosing or assisting in the diagnosis of ichthyosis is disclosed, comprising the above-described detection method. GLTP Reagents for gene mutation.

[0032] In one embodiment, the mutation site includes one or two of c.49C>T, c.58_62del, c.85delC, c.98delT, and c.180C>A.

[0033] In one embodiment, the reagent is a probe or primer.

[0034] In one embodiment, the reagent comprises: (a) Primer pairs for detecting c.49C>T, c.58_62del, c.85delC and c.98delT, the nucleotide sequences of which are shown in SEQ ID NO:1~SEQ ID NO:2; (b) Primer pairs used to detect c.180C>A, the nucleotide sequences of which are shown in SEQ ID NO:5~SEQ ID NO:6.

[0035] In other embodiments of the present invention, a method is disclosed. GLTP The method for constructing a gene knockout mouse model includes the following steps: (1) Targeting mice GLTP The sgRNA of the gene and the Cas9 protein were assembled in vitro to obtain the CRISPR / Cas9-sgRNA complex; (2) The CRISPR / Cas9-sgRNA complex described in step (1) was microinjected into mouse zygotes, and positive F0 generation mice were obtained by transplanting the zygotes. (3) After mating positive F0 generation mice with wild-type mice, heterozygotes are selected, and the heterozygotes are self-crossed to obtain Gltp Gene knockout mouse model.

[0036] In one embodiment, the sequence of the sgRNA in step (1) is shown in SEQ ID NO:12 and SEQ ID NO:13.

[0037] In one implementation, the step (3) described Gltp Gene knockout mouse models were identified by the following method: using mouse tail tip tissue DNA as a template, two PCR amplifications were performed using SEQ ID NO:14~SEQ ID NO:15 and SEQ ID NO:16~SEQ ID NO:17 as primers, respectively, and the amplification products were analyzed by electrophoresis.

[0038] In one embodiment, the PCR amplification reaction system includes 12.5 μL of 2 × Phanta Flash MasterMix, 9.5 μL of ddH2O, 1 μL each of forward and reverse primers, and 1 μL of template. The PCR amplification reaction program is as follows: pre-denaturation at 98°C for 30 seconds; followed by 35 cycles: denaturation at 98°C for 10 seconds, annealing at 62°C for 5 seconds, extension at 72°C for 5 seconds, and finally final extension at 72°C for 1 minute.

[0039] In one embodiment, if PCR amplification is performed using primers SEQ ID NO:14-SEQ ID NO:15, and a 382 bp band appears in the amplification product, but no band appears when PCR amplification is performed using primers SEQ ID NO:16-SEQ ID NO:17, then... Gltp Gene knockout mouse model.

[0040] In other embodiments of the present invention, the method described above is disclosed to construct the product. Gltp Gene knockout mouse model.

[0041] In other embodiments of the present invention, the above-described... Gltp Application of gene knockout mouse models in the study of the pathological mechanism of ichthyosis and / or in screening drugs for the treatment of ichthyosis. The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments.

[0042] Example 1: Novel pathogenic gene for ichthyosis Gltp Identification This embodiment identifies a novel pathogenic gene for ichthyosis through whole-exome sequencing and bioinformatics analysis. Gltp Specifically, it includes the following steps: 1. Seven patients with sporadic congenital ichthyosis were collected, and their clinical manifestations were as follows: GLTP As shown, at birth, the patients presented with dry, scaly skin all over their bodies. As the disease progressed, symptoms such as erythema and itching appeared. The scales on the trunk and extensor surfaces of the limbs gradually increased in size, becoming brown and adherent, exhibiting a typical pattern of worsening in winter and improvement in summer. All seven patients' parents were carriers and had no related clinical manifestations. The histopathological findings of the skin tissue in the seven patients are as follows: GLTP As shown (represented by cases P1 and P2), the epidermis exhibits hyperkeratosis, parakeratosis, vacuolar changes in granular cells, significant thickening of the spinous layer, and a small number of perivascular lymphoid tissue cells in the superficial dermis.

[0043] 2. Whole-exome sequencing was performed on three patients (cases P1-P3). Based on the obtained data, genes carrying rare variants (major allele frequency MAF < 0.005) were screened. These variants included homozygous, compound heterozygous, or de novo variants, and had to be shared in at least two patients. Ultimately, only... Figure 1 The genes meet the above criteria. Further investigation is needed. Figure 2 The gene was tested using Sanger assay to verify the mutation, and the results were as follows: GLTP As shown. The results showed that 3 patients GLTP All genes (NCBI gene ID: 51228) carried biallelic mutations, and Case 1 (P1) carried a homozygous frameshift mutation c.58_62del (p.T20Afs). 137); Case 2 (P2) carries the compound heterozygous mutation c.58_62del (p.T20Afs 137) / c.98delT(p.F33Sf 17); Case 3 (P3) carries a homozygous frameshift mutation c.58_62del (p.T20Afs 137).

[0044] For the other 4 patients (cases P4-P7) Figure 3 Sanger sequencing of gene exons revealed that both Case 4 (P4) and Case 5 (P5) carried a homozygous frameshift mutation c.58_62del (p.T20Afs). 137); Case 6 (P6) carries the compound heterozygous mutation c.58_62del (p.T20Afs). 137) / c.85delC(p. H29Tfs 21); Case 7 (P7) carries the compound heterozygous mutation c.49C>T (p.Q17). ) / c.180C>A(p.Y60 (Results as follows) GLTP (As shown). Frameshift mutation c.58_62del (p.T20Afs) 137) The frequency in East Asian populations was 0.0007349 (gnomeAD), but it was not detected in populations in other regions; c.49C>T (p.Q17) The global population frequency is 0.000001246 (gnomeAD); while c.85delC (p. H29Tfs) 21) c.98delT(p.F33Sf 17) and c.180C>A (p.Y60) None of these mutations have been reported in public databases. Since these mutations are all frameshift deletions, we speculate... GLTP The mutation is a loss-of-function mutation, and the loss of function may be closely related to the occurrence of hereditary ichthyosis.

[0045] In this step, for verification Figure 3 The mutation status of the gene exon regions was investigated, and PCR amplification and Sanger sequencing analysis were performed on all five exons. The specific steps are as follows: 200 μL of peripheral whole blood sample was collected from the patient, and genomic DNA was extracted using a commercial DNA extraction kit. Five pairs of specific primers (SEQ ID NO:1~SEQ ID NO:2) were used for detection. GLTPGene exon 1; product length 883bp; covering c.49C>T, c.58_62del, c.85delC, c.98delT mutation sites), SEQ ID NO:3~SEQ ID NO:4 (detection) GLTP Gene exon 2; product length 521bp), SEQ ID NO:5~SEQ ID NO:6 (detection) GLTP Gene exon 3; product length 716bp; covering c.180C>A mutation site), SEQ ID NO:7~SEQ ID NO:8 (detection) GLTP Gene exon 4; product length 436bp), SEQ ID NO:9~SEQ ID NO:10 (detection) GLTP PCR was performed on exon 5 of the gene (product length 443 bp). After PCR, the product was separated by 2% agarose gel electrophoresis. After confirming that the target band size was as expected and the brightness was appropriate under a gel imaging system, the PCR product was sequenced by Sanger sequencing to verify the mutation status of the target site.

[0046] SEQ ID NO: 1: 5′-CGAAAGAGAACCGTGACCAAC-3′ SEQ ID NO: 2: 5′-TGACATGTTTAGAGCGGAGAGG-3′ SEQ ID NO:3: 5′-GGTTGGTGCTGTAGCCTCAT-3′ SEQ ID NO:4: 5′-GTCAACCTTTAATTAGACTTTGGT-3′ SEQ ID NO: 5′-GTCAGTAGTGGCTGGAGAACATGAA-3′ SEQ ID NO: 6: 5′-ATAAAGAGCTTAGCACAACTCCCA-3′ SEQ ID NO:7: 5′-AATAACCACTCCCTCTGGGGC-3′ SEQ ID NO:8: 5′-CAGTACACTAGCCTCACCCAA-3′ SEQ ID NO:9: 5′-TCGCTCAAAATACACCTCCCTT-3′ SEQ ID NO: 10: 5′-AGGGGCAGTTCACCGAC-3′ PCR reactions were performed using 2 × Phanta Flash Master Mix (Dye Plus) (Nanjing Novizan P520). The reaction mixture consisted of 12.5 μL of 2 × Phanta Flash Master Mix (Dye Plus), 9.5 μL of ddH2O, 1 μL each of forward and reverse primers (10 pmol / μL), and 1 μL of template DNA (≈50 ng / μL), for a total reaction volume of 25 μL. The reaction program was as follows: pre-denaturation at 98°C for 30 seconds; followed by 35 cycles: denaturation at 98°C for 10 seconds, annealing at 62°C for 5 seconds, extension at 72°C for 5 seconds, and a final extension at 72°C for 1 minute.

[0047] 3. Immunofluorescence detection was performed on paraffin sections of skin lesions from the three patients (P1-P3) and the same areas of skin tissue from healthy individuals. The results are as follows: GLTP As shown, the results indicate that GLTP protein is highly expressed in the granular layer of the epidermis in normal individuals, while none of the three patients expressed GLTP protein, further confirming that the lack of GLTP expression leads to hereditary ichthyosis.

[0048] Therefore, this embodiment identifies a novel pathogenic gene for ichthyosis. GLTP And discovered Figure 4 Mutations in this substance lead to its loss of expression, thereby causing hereditary ichthyosis.

[0049] Example 2: Further exploration of the pathogenesis of ichthyosis In the pathogenic gene of ichthyosis GLTP, Based on the fact that defects cause hereditary ichthyosis, this embodiment further explores the pathogenesis of ichthyosis.

[0050] Electron microscopy was performed on the skin lesions of three patients (P1-P3) and the skin tissue of normal individuals in the same areas. The results are as follows: GLTP As shown, the results indicated that the patient's ultrastructure was abnormal. In normal individuals, the stratum corneum structure is regular, the lipid capsule is intact, and the granular layer contains a large number of lamellar bodies. However, in the patient's stratum corneum lipid capsule is disordered, the granular layer has fewer lamellar bodies and a disordered structure, and a large number of characteristic autolysosomes wrapped in multiple membranes are present.

[0051] Immunofluorescence staining was performed on autophagy markers LC3B and P62, and the results are as follows: GLTP As shown, the results indicated that normal individuals showed only a few LC3B positive cells in the granular layer, while P62 showed no significant staining. In the patient's skin lesions, a large number of LC3B and P62 positive cells were aggregated in the cytoplasm of the granular layer, suggesting severe obstruction of autophagic flux and disordered autophagy function in the patient's skin.

[0052] Therefore, GLTP deficiency leads to abnormal autophagy and thus causes skin barrier dysfunction. The pathogenesis of hereditary ichthyosis is "gene defect-autophagy blockade-barrier disruption".

[0053] Example 3 Figure 5 Construction of gene knockout mouse model Based on mice Figure 6 The gene (mouse Gene ID: 56356) structural characteristics were constructed using CRISPR-Cas9 technology in this embodiment. Gltp Gene knockout mouse models specifically include the following steps: 1. Design and synthesize sgRNA choose Gltp Exons 2-4 of the -201 transcript (ENSMUST00000012028.13) were selected as the knockout target region, and two specific sgRNAs (SEQ ID NO:12 and SEQ ID NO:13) were designed for the target region. sgRNA1 (SEQ ID NO:12): 5'-GCTAAACGCCGAGCTGACAC-3' PAM: AGG sgRNA2 (SEQ ID NO:13): 5'-CCAGAATGATTGTAGAGCGC-3' PAM: AGG The nucleotide sequence of the target region is shown in SEQ ID NO:11. This region includes a 344 bp key coding sequence, and its knockout completely disrupts the functional domain of the GLTP protein. The selection of the target region and the design of the sgRNA covering all three transcripts ( Gltp -201、 Gltp -202、 Gltp The conserved functional region (-203) ensures that the GLTP protein function is completely lost after knockout.

[0054] SEQ ID NO:11 ATTGCCTTGGGTCCCCGGTATTCACGCCCATCAAGGCAGACATAAGCGGTAACATCACCAAAATCAAAGCCGTATATGACACCGACCCAGCCAAGTTCAAGACCCTGCAGAACATCCTGGAGGTGGAGAAGGGGATGTATGGGGCGGAGTGGCCTAAAGTGGGGGCCACTCT GGCACTGCTGTGGCTGAAAAGGGGCCTGCGCTTCATCCAGGTGTTCCTGCAGAGCATCTGCGATGGGGAACGCGACGAGAACCACCCCAACCTCATCCGAGTCAACGCCAACAAGGCCTATGAGATGGCCCTGAAGAAGTACCATGGCTGGCTGGTGCAGAAGATCTTCAAG 2. The sgRNA from step 1 was pre-assembled with Cas9 protein (Jiangsu Jicui Yaokang Biotechnology Co., Ltd.) in vitro to form a CRISPR / Cas9-sgRNA complex, which has cleavage activity.

[0055] 3. The CRISPR / Cas9-sgRNA complex described in step 2 was injected into the fertilized eggs of C57BL / 6JGpt mice (Jiangsu Jicui Yaokang Biotechnology Co., Ltd.) by microinjection, and positive F0 generation mice were obtained by transplanting the fertilized eggs.

[0056] 4. Positive F0 generation mice and wild-type mice ( Gltp + / + After mating, heterozygotes transmitted through the reproductive system are selected. Gltp + / - Then, self-pollination is used to obtain homozygous knockouts. Gltp Gene-producing mice ( Gltp - / - ).

[0057] In this step, the mouse genotype is accurately identified through PCR and electrophoresis analysis. The specific steps are as follows: Tissue from the mouse tail tip is collected, and genomic DNA is extracted using a commercial DNA extraction kit. PCR (PCR ① + PCR ②) is performed using two pairs of specific primers: SEQ ID NO:14~SEQ ID NO:15 (wild-type 5991 bp, targeted knockout band 382 bp) and SEQ ID NO:16~SEQ ID NO:17 (wild-type 242 bp, targeted knockout band 0 bp) to verify the knockout effect and ensure accuracy. After PCR, the products are separated by 2% agarose gel electrophoresis. The band size is observed and recorded under a gel imaging system to determine the mouse genotype. Wild-type mice ( Gltp + / + In PCR①, the target fragment was too long (5991 bp) to be effectively amplified, so no band was observed. Only in PCR② was a 242 bp band (wild-type allele) amplified. Heterozygous mice ( Gltp + / - Simultaneously, a 382 bp band (knockout allele) appeared in PCR① and a 242 bp band (wild-type allele) appeared in PCR②; homozygous knockout mice ( Gltp - / - In PCR①, only a 382 bp band appeared (allele knockout), while no band was observed in PCR②.

[0058] SEQ ID NO: 14: 5′-CAAGAGGTTCTGCTTTGTAGCCC-3′ SEQ ID NO: 15: 5′-GGGTCTGTTATGATCCATCGTGA-3′ SEQ ID NO: 16: 5′-ATTGTCATGTGGCGAAGCCTC-3′ SEQ ID NO: 17: 5′-GGCCTGTATCCTACACCCTTCAA-3′ PCR reactions were performed using 2 × Phanta Flash Master Mix (Dye Plus) (Nanjing Novizan P520). The reaction mixture consisted of 12.5 μL of 2 × Phanta Flash Master Mix (Dye Plus), 9.5 μL of ddH2O, 1 μL each of forward and reverse primers (10 pmol / μL), and 1 μL of template DNA (≈100 ng / μL), for a total reaction volume of 25 μL. The reaction program was as follows: pre-denaturation at 98°C for 30 seconds; followed by 35 cycles: denaturation at 98°C for 10 seconds, annealing at 62°C for 5 seconds, extension at 72°C for 5 seconds, and a final extension at 72°C for 1 minute.

[0059] Example 4 Gltp Validation of gene knockout mouse models The one constructed in Example 3 Gltp The gene knockout mouse model was validated as follows: 1. Genetic characteristics: Heterozygous mice ( Gltp + / - After mating, the birth rate of offspring conformed to Mendelian inheritance laws, indicating that gene knockout does not affect embryonic development. This characteristic ensures the reproducibility and stability of the model, providing a basis for large-scale experiments.

[0060] 2. Knockout efficiency verification: Western blot and immunofluorescence results are as follows Gltp As shown, the results confirm that homozygous knockout mice Gltp - / - GLTP protein is completely absent in skin tissue.

[0061] 3. Phenotypic Validation (1) Appearance phenotype The results are as follows Figure 7 As shown, from Gltp It can be seen that homozygous knockout mice Figure 8 - / - After birth, the child spontaneously develops an ichthyosis-like phenotype, including dry skin, wrinkles, and a typical waxy appearance (displaying features similar to those of humans). Figure 8 Highly consistent skin phenotype in patients with gene-mutant ichthyosis. Gltp + / + No abnormal phenotype.

[0062] (2) Histopathological verification The results of hematoxylin-eosin staining are as follows: GLTP As shown, the results indicate that wild-type mice from the same litter... Gltp + / + The epidermis consists of only 2-3 layers of cells; homozygous knockout mice Figure 9 - / - The skin exhibits typical characteristics of ichthyosis, such as hyperkeratosis, acanthosis, and superficial dermal inflammatory cell infiltration.

[0063] (3) Skin barrier test The results are as follows Gltp As shown, compared to wild-type mice from the same litter... Gltp + / + homozygous knockout mice Figure 10 - / - The transepidermal water loss (TEWL) of the skin was significantly increased, indicating severe impairment of the epidermal barrier function; the toluidine blue assay was used to verify the homozygous knockout mice. Gltp - / -The skin of the mice showed obvious dye penetration, while wild-type littermates were able to effectively reject the dye penetration, confirming that the skin's barrier function against external substances is severely defective.

[0064] (4) Autophagy index analysis Autophagy indicators were detected by Western blotting, and the results are as follows: Gltp As shown, the results indicate that, compared to wild-type mice from the same litter... Gltp + / + homozygous knockout mice Figure 11 Gltp Gltp It should be noted that the original text seems to have some repeated parts which are presented as is in the translation to maintain consistency with the original. Also, the ellipsis in the translation indicates that there are some parts not fully shown in the original text but are translated in a way to follow the translation rules. If there are any specific requirements or corrections regarding this translation, please let me know. - / - An elevated LC3B-II / I ratio and P62 accumulation in the epidermal tissue suggest autophagic flux blockade, consistent with the patient's presentation.

[0065] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0066] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. Detection GLTP The application of gene mutation reagents in the preparation of reagent kits for the diagnosis or auxiliary diagnosis of ichthyosis, wherein... GLTP The gene's NCBI gene ID is 51228.

2. The application according to claim 1, characterized in that, The reagent is a primer or probe.

3. The application according to claim 1, characterized in that, The mutation sites include one or two of c.49C>T, c.58_62del, c.85delC, c.98delT, and c.180C>A; And / or, the reagent comprises: (a) Primer pairs for detecting c.49C>T, c.58_62del, c.85delC and c.98delT, the nucleotide sequences of which are shown in SEQ ID NO:1~SEQ ID NO:2; (b) Primer pairs used to detect c.180C>A, the nucleotide sequences of which are shown in SEQ ID NO:5~SEQ ID NO:

6.

4. A reagent kit for diagnosing or assisting in the diagnosis of ichthyosis, characterized in that, Including detection GLTP Reagents for gene mutation, the GLTP The gene's NCBI gene ID is 51228.

5. The reagent kit according to claim 4, characterized in that, The mutation sites include one or two of c.49C>T, c.58_62del, c.85delC, c.98delT, and c.180C>A; And / or, the reagent comprises: (a) Primer pairs for detecting c.49C>T, c.58_62del, c.85delC and c.98delT, the nucleotide sequences of which are shown in SEQ ID NO:1~SEQ ID NO:2; (b) Primer pairs used to detect c.180C>A, the nucleotide sequences of which are shown in SEQ ID NO:5~SEQ ID NO:

6.

6. A kind Gltp A method for constructing a gene knockout mouse model, characterized in that, Includes the following steps: (1) Targeting mice Gltp The sgRNA of the gene and the Cas9 protein were assembled in vitro to obtain the CRISPR / Cas9-sgRNA complex; (2) The CRISPR / Cas9-sgRNA complex described in step (1) was microinjected into mouse zygotes, and positive F0 generation mice were obtained by transplanting the zygotes. (3) After mating positive F0 generation mice with wild-type mice, heterozygotes are selected, and the heterozygotes are self-crossed to obtain Gltp Gene knockout mouse model.

7. The method according to claim 6 Gltp A method for constructing a gene knockout mouse model, characterized in that, The sequence of the sgRNA described in step (1) is shown in SEQ ID NO:12 and SEQ ID NO:

13.

8. The method according to claim 6 Gltp A method for constructing a gene knockout mouse model, characterized in that, The steps described in step (3) Gltp Gene knockout mouse models were identified by the following method: using mouse tail tip tissue DNA as a template, two PCR amplifications were performed using SEQ ID NO:14~SEQ ID NO:15 and SEQ ID NO:16~SEQ ID NO:17 as primers, and the amplification products were analyzed by electrophoresis. Preferably, the PCR amplification reaction system includes 12.5 μL of 2 × Phanta Flash Master Mix, 9.5 μL of ddH2O, 1 μL each of forward and reverse primers, and 1 μL of template. The PCR amplification reaction program is as follows: pre-denaturation at 98°C for 30 seconds; followed by 35 cycles: denaturation at 98°C for 10 seconds, annealing at 62°C for 5 seconds, extension at 72°C for 5 seconds, and finally final extension at 72°C for 1 minute. Preferably, if PCR amplification using SEQ ID NO:14~SEQ ID NO:15 as primers produces a 382bp band, and PCR amplification using SEQ ID NO:16~SEQ ID NO:17 as primers produces no band, then... Gltp Gene knockout mouse model.

9. The method for constructing according to any one of claims 6 to 8 yields... Gltp Gene knockout mouse model.

10. The claim 9 Gltp Application of gene knockout mouse models in the study of the pathological mechanism of ichthyosis and / or in screening drugs for the treatment of ichthyosis.