Molecular marker related to chicken breast muscle color character and application

Abstract

The invention discloses a molecular marker related to chicken breast muscle color characters and application, and belongs to the technical field of genetic engineering. The nucleotide sequence of the molecular marker is shown as SEQ ID NO.1, the mutation site of the molecular marker is located at the 392bp site of the CDS sequence of the INHA gene, C / T mutation exists at the 392bp site, and CC, CT and TT genotypes exist at the mutation site. Tests show that the molecular marker is significantly related to the breast muscle redness of chicken, and the breast muscle redness of chicken individuals when the mutation site genotype is TT is significantly higher than that of CC and CT genotype chicken individuals. The method can provide a theoretical basis for local chicken breed meat quality character breeding and marker-assisted selection.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to a molecular marker related to the color trait of chicken breast muscle and its application. Background Technology

[0002] Inhibin (INH) is a heterodimeric glycoprotein hormone secreted by granulosa cells of the female ovary and Sertoli cells of the male testis. It belongs to the transforming growth factor β superfamily and consists of two distinct subunits, α and β, linked by a disulfide bond. INH plays a crucial role in follicle development, oocyte maturation, and embryonic development. INH exists in two forms: INHA (αβA) and INHB (αβB). INHA and INHB have essentially the same functional activity, and at the amino acid level, they are roughly the same except for significant differences in the content of histidine, isoleucine, and lysine.

[0003] Inhibin INHA primarily originates from dominant follicles and luteal cells, produced and secreted by the granulosa layer of large pre-ovulatory follicles. mRNA encoding the α- and βA-subunits is also found in chicken skeletal and cardiac muscle tissues; simultaneously, βA-subunit mRNA has been detected in small intestinal muscle. INHA The gene is located on chromosome 7, contains two exons and one intron, is 1679 bp in length, and has a coding region of 987 bp, encoding 329 amino acids. Researchers both domestically and internationally have discovered the important regulatory role of inhibin in reproductive function in animals such as pigs, cattle, sheep, and mice, and in chickens, it is also largely related to the growth and reproductive traits of hens. Active immunization against INHA leads to increased ovulation in sheep, pigs, chickens, mice, and cattle. INHA It is considered the functional center of inhibin and has the potential to increase the ovulation rate of poultry.

[0004] Numerous research reports indicate that INHA Genes are not only closely related to human reproductive performance, but also to animal reproductive performance. INHA The gene has been confirmed as a major or candidate gene affecting reproductive performance. Single nucleotide polymorphism analysis related to chicken reproductive traits revealed... INHA It may be a candidate gene for improving reproductive traits in chickens. Gui Taotao et al. discovered this through SNP screening. INHA It is likely one of the main genes affecting follicle development and plays a crucial role in chicken follicle development, serving as a suitable molecular marker for selective breeding of egg production. Jin Heng et al. studied the development of Ningdu Yellow Hens... INHA The relationship between gene polymorphism sites and their growth and reproductive traits was further analyzed using correlation analysis, revealing... INHA Genes are closely related to the growth and development of their organisms. Currently, both domestic and international research... INHAStudies on gene polymorphism mainly focus on traits related to growth and reproduction, with few reports on its correlation with poultry meat quality traits.

[0005] The quality of poultry meat is determined by its nutritional value, sensory characteristics, and safety. The content of high-value proteins, cholesterol, vitamins, micronutrients, and unsaturated fatty acids in poultry meat determines its nutritional quality, while basic sensory characteristics include meat color, aroma, and flavor. Large-scale broiler production has been achieved; the current focus is on improving meat quality by modifying various characteristics of broilers. Appearance, texture, juiciness, water content, firmness, tenderness, aroma, and flavor are the most important and easily perceived meat characteristics, influencing consumers' initial and final judgments about meat quality before and after purchase. Quantifiable characteristics of meat, such as water retention, shear strength, drip loss, cooking loss, pH value, shelf life, collagen content, protein solubility, viscosity, and fat binding capacity, are essential for processors involved in manufacturing value-added meat products. Commonly used indicators for evaluating chicken meat quality include meat color, tenderness, water loss rate, water-holding capacity, and pH value. With the improvement of people's living standards, the requirements for chicken meat quality are also increasing, making research on the selective breeding of chicken meat quality traits an inevitable trend. However, it has not yet been seen. INHA Research reports on the role of genes in chicken meat quality traits. Summary of the Invention

[0006] The purpose of this invention is to provide a molecular marker related to the color trait of chicken breast muscle and its application, in order to solve the problems existing in the prior art. Through screening, a molecular marker was discovered in the Ningdu Yellow Rooster. INHA The C+392T site on exon 2 of the gene is significantly correlated with the redness of the breast muscle, an evaluation index of chicken meat quality traits. This provides a theoretical basis for the breeding of meat quality traits and marker-assisted selection in local chicken breeds.

[0007] To achieve the above objectives, the present invention provides the following solution: This invention provides a molecular marker associated with the color trait of chicken breast muscle, the nucleotide sequence of which is shown in SEQ ID NO.1, and the 130th position of the molecular marker [i.e. INHA A C / T mutation exists at position 392 of the CDS sequence of the gene (GenBank accession number: NM_001031257.2). The mutation site contains CC, CT and TT genotypes.

[0008] The present invention also provides the application of the aforementioned molecular marker in identifying the color trait of chicken breast muscle.

[0009] The present invention also provides the application of the aforementioned molecular marker in chicken breeding, wherein the trait index of chicken breeding is the color of chicken breast muscle.

[0010] Preferably, chickens with the TT genotype have a higher color in their breast muscles than chickens with the CC and CT genotypes.

[0011] Preferably, the color of the chicken breast muscle is the redness of the breast muscle of a 16w Ningdu Yellow Rooster.

[0012] This invention also provides a method for detecting the color of chicken breast muscle, comprising the following steps: Genomic DNA was extracted from the chicken to be tested; The molecular marker is amplified using primer pairs, followed by sequencing. The genotype of the molecular marker mutation site is analyzed based on the sequencing results, and the color of the chicken breast muscle to be tested is determined based on the genotype results.

[0013] Preferably, the nucleotide sequences of the primer pair are as shown in SEQ ID NO.2-3.

[0014] Preferably, chickens with the TT genotype exhibit higher breast muscle color than chickens with the CC and CT genotypes when the molecular marker mutation site is present.

[0015] Preferably, the color of the chicken breast muscle is the redness of the breast muscle of a 16w Ningdu Yellow Rooster.

[0016] The present invention discloses the following technical effects: This invention will take the 16-week Ningdu Yellow Rooster as the research object and analyze... INHA The correlation between exon 2 polymorphism and meat quality traits was investigated, and a highly significant correlation was found between the C+392T site and the meat quality traits of Ningdu Yellow Rooster. P <0.01) correlation indicates INHA Genes can be considered as candidate genes affecting the meat quality traits of Ningdu Yellow Roosters. Further analysis revealed that the C+392T locus was significantly associated with breast muscle color in Ningdu Yellow Rooster meat quality traits, and individuals with the TT genotype at this locus showed extremely significant breast muscle color. P <0.01) is higher than that of individuals with the CC and CT genotypes. Therefore, this invention can provide a theoretical basis for the breeding of meat quality traits and marker-assisted selection in local chicken breeds at the molecular level. Attached Figure Description

[0017] Picture 1 The results are shown in the electrophoresis detection of the amplification products; M is the standard DNA molecule, and 1-2 are the amplification products. Picture 2 for INHA Peak diagram of polymorphic variation sites in exon 2 of a gene. Detailed Implementation

[0018] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0019] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0020] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0021] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This specification and embodiments are merely exemplary.

[0022] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0023] Example 1 1. Test materials and measured properties The DNA samples used in this experiment were obtained from a natural population of 499 Ningdu Yellow Roosters preserved in a -20℃ freezer at the Jiangxi Provincial Key Laboratory for Genetic Improvement of Local Chicken Breeds. Meat quality traits of the left breast muscle of the 499 16-week-old Ningdu Yellow Roosters were measured, including pH value, meat color (L represents brightness, a represents redness, and b represents yellowness), shear force, and drip loss at 24 and 48 hours.

[0024] pH value: The portable pH meter (PHBJ-260) was calibrated using standard solutions with pH values ​​of 9.18 and 6.86. Within 45 minutes after slaughter, the probe of the pH meter was inserted into the breast muscle of each chicken, ensuring that the probe was embedded in the muscle. When the pH meter reading stabilized, the reading was recorded. This was repeated three times, and the average value was calculated. Generally, the muscle pH value of chickens with good meat quality will be between 6.0 and 6.5.

[0025] Meat color: The color of the exposed breast muscle cross-section was measured 30 minutes after slaughter using a colorimeter (CHROMA METER CR-400). Muscle brightness (L), redness (a), and yellowness (b) were measured. Each sample was measured three times, and the average value was used for subsequent analysis. Meat color is mainly determined by the state and relative content of myoglobin, oxymyoglobin, and metmyoglobin. Brightness is affected by the pH value of the muscle, the content of myoglobin in the muscle affects redness, and the metabolism of lutein affects yellowness. Measuring the meat color can accurately determine its freshness; freshly slaughtered chicken breast meat is generally bright and light red.

[0026] Shear force: Following the People's Republic of China Agricultural Industry Standard NY / T 1180-2006 "Determination of Meat Tenderness - Shear Force Measurement Method", the sample was placed on the blade groove of a digital display muscle tenderizer, with the muscle fibers perpendicular to the blade direction. The instrument was then started to cut the meat sample, and the maximum shear force (peak value) during the cutting process was measured. Each sample was measured three times, and the average value was used for subsequent analysis. The lower the shear force value, the more tender the muscle meat.

[0027] Drip loss: A rectangular muscle sample (W0) measuring 55 mm in length, 50 mm in width, and 15 mm in thickness was weighed. One end of the meat sample was then tied with a thin thread, pulling the muscle fibers downwards. The sample was sealed in an inflatable plastic bag and hung in a refrigerator at 4°C for 24 hours. After 24 hours, the meat sample (W1) was weighed, and the 24-hour drip loss was calculated as follows: W 24h (%) = (W0 - W1) / W0 100%. After storing the meat sample again in the refrigerator for 48 hours under the same conditions, weigh the meat sample again (W2) and calculate the drip loss as W. 48h (%) = (W0 - W2) / W0 100%.

[0028] 2. Test methods 2.1 Primer design and PCR amplification Download chicken from NCBI INHA The genome sequence (GenBank accession number: NM_001031257.2) was used. Upstream and downstream primers were designed using Genetool software to amplify [the genome sequence]. INHAThe primer sequences for the 565 bp upstream and downstream fragments of exon 2 of the gene are: F: 5'-GCACGACACCCTGAGCCACT-3' (SEQ ID NO.2), R: 5'-GGGGTGCACGATCCAATTGTC-3' (SEQ ID NO.3). The primers were synthesized by Hunan Qingke Biotechnology Co., Ltd.

[0029] The PCR reaction system was as follows (50 μL): 2 × PCR mix 25 μL, forward and reverse primers 0.4 μL each, DNA template 1.0 μL, ddH2O 23.2 μL.

[0030] The PCR reaction program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 45 s, 35 cycles; final extension at 72℃ for 10 min. The PCR products were analyzed by 1% agarose gel electrophoresis to determine if the fragment size met expectations. The analyzed PCR products were then sent to Hunan Qingke Biotechnology Co., Ltd. for direct sequencing using upstream primers.

[0031] 2.2 Data Statistical Analysis Statistical analysis was performed using the SAS 9.0 GLM program, and the model was constructed as follows: Y ij = μ+G i +e ij Among them, Y ij G represents the phenotypic value of the trait, μ is the population mean of the trait, and G is the population mean of the trait. i e represents the genotype effect value. ij The random residual effect was considered. Association analysis between SNP loci and meat quality traits in Ningdu Yellow Roosters was performed, referencing the paper "Regression and Principal Component Analysis of Testicular Weight and Secondary Sexual Characteristics in Ningdu Yellow Roosters at Different Ages" published by Zhou Min et al. Results are expressed as mean ± standard deviation. P <0.05 is used as the criterion for judging a significant difference. P <0.01 is used as the standard for judging that the difference is extremely significant.

[0032] Gene effect analysis methods: Additive effect (a) = (AA-BB) / 2; Dominance effect (d) = AB-(AA+BB) / 2.

[0033] 3. Results and Analysis 3.1 Amplification Results The electrophoretic detection results of the amplification products are as follows: Picture 1As shown, after direct sequencing of the PCR product and removal of uncertain upstream and downstream sequences, a 514 bp sequence (SEQ ID NO.1) was obtained. Alignment with NCBI (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) confirmed that this sequence is... INHA The sequence of exon 2 of the gene.

[0034] The sequence shown in SEQ ID NO.1: CGTGCGAGCCCACGCAGCCAGACAAGCTGCTGGAGGAAGAAGGCATCTTCACTTACCTCTTCCAGCCCTCGGCGCACGCCCTGAGCCGCACGCTGACATCCGCCCAGCTCTGGTTCTACAGCGGCCCCT C GGCTGCTCCCAACCACTCGGCCCCCGCTGTGCTGACCCTCTCACCGCAGGGCAGGGTGCCGGTGGTGGCCACAGCGTCGCGGACACCGGAGCACTGGACCGTGTTTGACTTCGGCCCCGATGCGCTGCCCCAGCTGGCACAGCCGCTCTTTGTGCTCCTGGTGCGCTGCCCCGGCTGCCCCTGCCTGGCCGA TGGGGACAAGATGCCCTTCCTGGTGGCCACTACCCGTGCCAAGCAGCCGGGAGGGCTCGCCGCTCCGCCGTGCCCTGGTCGCCGGCTGCGCTCAGCCTGCTGCAGCGCCCATCGGAGGACGTGGCCGCCCACACCAACTGCCGCCGGGCGTCCCTCAACATCTCTTTCGAGGAGCTGGGCTGGGACAATTG.

[0035] In the above sequence, the underlined bases are mutation sites.

[0036] 3.2 INHA Association analysis of exon 2 polymorphism in genes with meat quality traits of Ningdu yellow rooster meat Based on Ningdu Yellow Rooster INHA Screening for polymorphic sites in exon 2 of the gene revealed a C / T mutation (abbreviated as C+392T) at 392bp (see...). Picture 2 Furthermore, it showed a highly significant (P<0.01) correlation with the meat quality traits of Ningdu Yellow Rooster, as shown in Table 1.

[0037] Table 1 Ningdu Yellow Rooster INHAAssociation analysis of exon 2 polymorphism sites in genes with meat quality traits Note: In the table, L represents brightness, a represents redness, b represents yellowness, J represents shear strength, and W represents... 24h W represents the water loss over 24 hours. 48h This indicates water loss over 48 hours. This indicates that the difference is highly significant. NS indicates a significant difference, while NS indicates a non-significant difference.

[0038] 3.3 Association analysis between C+392T locus and meat quality traits Association analysis was performed between the C+392T locus and the pectoral muscle texture trait of 499 individuals in a 16-week Ningdu Yellow Rooster population. The results showed a highly significant correlation between the C+392T locus and muscle redness. Table 2 shows that the TT genotype individuals exhibited a highly significant correlation with muscle redness. P <0.01) higher than individuals with CC and CT genotypes. From the perspective of how this locus affects meat quality traits, it primarily acts in a dominant manner on the redness of the muscle in 16-week-old Ningdu Yellow Roosters. The T allele is beneficial for increasing muscle redness, with the TT genotype being superior.

[0039] Table 2 Association analysis between C+392T locus and meat quality traits Note: 'a' indicates an additive effect, and 'd' indicates a dominant effect. Different capital letters in peer data indicate highly significant differences. P <0.01), different lowercase letters indicate significant differences ( P <0.05), the same letters indicate no significant difference ( P >0.05).

[0040] Flesh color is a direct indicator of visual perception, and its chromaticity depends on the L (lightness) value, a (redness) value, and b (yellowness) value. The above results illustrate... INHA The genotype at the C+392T locus affects the expression of meat quality traits in Ningdu Yellow Roosters, especially its significant correlation with muscle redness. Therefore, chicken breeds with superior genotypes can be selected for breeding to provide a reference for the selection of meat quality traits in Ningdu Yellow Roosters, thereby helping to improve chicken quality and meet people's needs.

[0041] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A molecular marker associated with the color trait of chicken breast muscle, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.

1. A C / T mutation exists at the 130th base of the molecular marker, and the mutation site contains CC, CT and TT genotypes.

2. The application of the molecular marker as described in claim 1 in identifying the color trait of chicken breast muscle.

3. The application of molecular markers in chicken breeding as described in claim 1, characterized in that, The phenotypic indicator for chicken breeding is the color of the chicken breast muscle.

4. The application as described in claim 2 or 3, characterized in that, Chickens with the TT genotype have a higher breast muscle color than chickens with the CC and CT genotypes.

5. The application as described in claim 2 or 3, characterized in that, The color of the chicken breast muscle is the redness of the breast muscle of a 16w Ningdu Yellow Rooster.

6. A method for detecting the color of chicken breast muscle, characterized in that, Includes the following steps: Genomic DNA was extracted from the chicken to be tested; The molecular marker described in claim 1 is amplified using primer pairs, followed by sequencing. The genotype of the mutation site of the molecular marker is analyzed based on the sequencing results, and the color of the chicken breast muscle to be tested is determined based on the genotype results.

7. The method as described in claim 6, characterized in that, The nucleotide sequences of the primer pairs are shown in SEQ ID NO.2-3.

8. The method as described in claim 6, characterized in that, Chickens with the TT genotype exhibited higher breast muscle color than those with the CC and CT genotypes when the molecular marker mutation site was present.

9. The method as described in claim 6, characterized in that, The color of the chicken breast muscle is the redness of the breast muscle of a 16w Ningdu Yellow Rooster.

Images