Primer probe combination for rapidly detecting mycoplasma synoviae based on fluorescence MIRA method and detection method thereof
By designing specific primer-probe combinations using the fluorescent MIRA method and performing isothermal amplification at 39℃ using MIRA technology, the problems of speed, simplicity, and sensitivity in the detection of Mycoplasma synoviae in chickens in grassroots testing laboratories have been solved, and efficient detection of Mycoplasma synoviae in chickens has been achieved.
Patent Information
- Application Number
- CN202610190782.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-10
- Publication Date
- 2026-05-12
AI Technical Summary
Existing technologies are difficult to use quickly, easily, and efficiently to detect Mycoplasma synoviae in primary testing laboratories, and they also have high requirements for equipment and personnel, as well as low sensitivity.
A fluorescence MIRA method based on MIRA technology was adopted, and a specific primer-probe combination was designed. Isothermal amplification was performed at 39℃, and Mycoplasma synoviae in chickens was detected by fluorescence value or ultraviolet colorimetry. This method simplifies equipment requirements and has high specificity and sensitivity.
It enables rapid, simple, highly specific, and highly sensitive detection of Mycoplasma synoviae in chickens within 30 minutes, making it suitable for grassroots and field applications and reducing reliance on specialized equipment and technicians.
Smart Images

Figure CN122012759A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biological detection technology, and more specifically to a primer-probe combination and detection method for rapid detection of Mycoplasma synoviae in chickens based on the fluorescence MIRA method. Background Technology
[0002] Mycoplasma synoviae (MS) is a cell-wall-less microorganism, intermediate in size between bacteria and viruses. MS primarily causes infectious synovitis of the joints and tendon sheaths. It can also cause subclinical respiratory infections, eggshell tip abnormality syndrome, and decreased egg production. It is prone to mixed infections with Escherichia coli, avian influenza virus, and avian infectious bronchitis virus. Chickens infected with MS initially show good spirits and normal appetite, but as the disease progresses, they exhibit symptoms such as joint swelling, lameness, decreased appetite, slow growth, pale combs, and ruffled feathers, severely impacting the healthy development of poultry farming.
[0003] Since the clinical symptoms of MS infection are mostly subclinical, laboratory diagnosis of MS is essential. Laboratory diagnosis of MS includes isolation and identification, serological testing, and molecular biological testing. MS has stringent requirements for in vitro culture conditions, with long culture times and high difficulty. Serological testing can only detect late-stage infection and is prone to false positives and cross-reactivity. In contrast, molecular biological testing is convenient, simple, and more suitable for rapid clinical detection. Currently, molecular biological methods used for MS detection include conventional polymerase chain reaction (PCR), real-time quantitative PCR (qPCR), high-resolution melting curve (HRM), and loop-mediated isothermal amplification (LAMP). Although these molecular biological detection methods avoid the problems of long isolation and culture times and high costs, they have certain personnel and environmental requirements, and most of the required equipment is expensive, subject to space limitations, and has low sensitivity, making them difficult to widely apply in grassroots testing laboratories such as livestock and poultry farms or agricultural markets.
[0004] Multi-enzyme isothermal rapid amplification (MIRA) is a novel isothermal nucleic acid amplification method developed based on recombinase polymerase amplification (RPA) technology. Based on the organism's recombination repair mechanism, MIRA utilizes recombinases, single-stranded binding proteins, and DNA polymerases to achieve amplification at a constant temperature of 39°C for 20 minutes in vitro. Fluorescent MIRA, on the other hand, adds a fluorescent group to the probe to enable real-time observation of the amplification results. This method only requires a simple isothermal fluorescence detector or ultraviolet colorimetric development for real-time observation. This method has advantages such as low temperature requirements, simple equipment requirements, short amplification time, and high sensitivity, making it suitable for on-site, point-of-care testing.
[0005] Therefore, providing a primer-probe combination and detection method for rapid detection of Mycoplasma synoviae in chickens based on the fluorescent MIRA method is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention
[0006] In view of this, the present invention provides a primer-probe combination and detection method for rapid detection of Mycoplasma synoviae in chickens based on fluorescence MIRA, specifically providing a highly specific and sensitive MS detection method based on MIRA technology. The method of the present invention is convenient, rapid, and requires simple equipment, making it suitable for widespread application.
[0007] The method of this invention can detect Mycoplasma synovitis within 30 minutes under constant temperature conditions, without the need for complex instruments and equipment, and has high specificity and sensitivity.
[0008] To achieve the above objectives, the present invention adopts the following technical solution:
[0009] This invention designs a set of specific primers and probes based on the vlhA gene of MS, and uses MIRA technology to amplify the MS isothermally at 39°C for 20 minutes, and detects the MS based on fluorescence value or blue light color development.
[0010] Specific primer-probe combinations for rapid detection of MS include: Upstream primer: CTGAACCAACACCTGGAAACCCAAATACTG; SEQ ID NO. 3.
[0011] Downstream primer: AATCTTGGCTTCAGCTTCTGTTGTAGTTG; SEQ ID NO. 7.
[0012] Fluorescent probe: CCAGGAGGTGGTACAGTTGACCCTGTAGAGGC[FAM-dT][THF]C[BHQ1-dT]AAAACAGAAGCTA-C3-spaser.
[0013] The fluorescent probe is modified with FAM group at the 33rd base T starting from the 5' end, TF group at the 34th base G is replaced with THF group, BHQ1 group at the 36th base T is modified with BHQ1 group, and C3 spacer blocking modification is performed at the 3' end.
[0014] Furthermore, a rapid detection method for MS based on MIRA technology specifically includes the following steps: (1) Extract DNA from the sample to be tested by boiling.
[0015] (2) Perform isothermal amplification using a fluorescent DNA isothermal rapid amplification kit (purchased from AMP Future Biotechnology Co., Ltd.). Add buffer A, primer, probe, ddH2O and DNA to be detected to each dry powder tube respectively. Finally, add buffer B to the inside of the cap of the reaction tube, and mix by inverting the tube to ensure that the reaction starts simultaneously.
[0016] (3) Result determination: The difference between the reaction endpoint fluorescence value and the initial fluorescence value of the experimental group and the difference between the reaction endpoint fluorescence value and the initial fluorescence value of the negative control group are analyzed by biostatistics. If there is a difference, the test result is positive; if there is no difference, the test result is negative; or if there is fluorescence under ultraviolet light, it is positive, and if there is no fluorescence, it is negative.
[0017] The samples to be tested in step (1) are throat swabs, palatal cleft swabs, tracheal swabs, joint contents, etc. from chickens.
[0018] The specific steps for nucleic acid extraction using the boiling method described in step (1) are as follows: Place the collected swabs in a 37℃ incubator for 30 min, then vortex for 30 s to fully release the pathogens. Aspirate the liquid from the swabs and transfer it to a new 1.5 mL sterile centrifuge tube. Centrifuge at 12000 r / min for 5 min and discard the supernatant. Add 1 mL of 1×PBS to resuspend the swabs, vortex to mix, and centrifuge again at 12000 r / min for 5 min. Discard the supernatant. Repeat this washing process twice. Then resuspend the swabs in 50 μL of 1×PBS, heat in a 100℃ water bath for 8 min, immediately after heating, place on ice for 5 min, and finally centrifuge at 12000 r / min for 5 min. The supernatant is the genomic DNA.
[0019] The isothermal amplification system described in step (2) consists of: 29.4 μL of buffer A, 1.5 μL each of primers (10 μM), 1.2 μL of probe (10 μM), 5 μL of template, 8.9 μL of ddH2O, and 2.5 μL of buffer B.
[0020] The isothermal amplification procedure is to react at 39 °C for 20 min, with fluorescence collected every 30 s.
[0021] As can be seen from the above technical solution, compared with the prior art, the present invention discloses a primer and probe combination and detection method for rapid detection of Mycoplasma synoviae in chickens based on the fluorescent MIRA method. It can specifically detect Mycoplasma synoviae with a sensitivity of up to 2.3 copies / μL. It has the advantages of high specificity, high sensitivity, good repeatability, simple and rapid operation, and no dependence on professional technicians and specific instruments and equipment. It is suitable for grassroots and field applications and can quickly detect Mycoplasma synoviae, providing an efficient and accurate detection method for determining Mycoplasma synoviae infection in production. Attached Figure Description
[0022] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.
[0023] Figure 1 This is a graph showing the screening results of MIRA primer pairs for Mycoplasma synovitis in Example 1 of the present invention; the curves in the graph represent the reaction fluorescence curves when the primer pairs are F1R1, F2R1, F3R1, F1R2, F2R2, F3R2, F1R3, F2R3, and F3R3 respectively.
[0024] Figure 2 The figure shows the effect of different primer concentrations on the MIRA detection reaction in Example 1 of this invention; the curves in the figure represent the fluorescence curves of the reaction when the final primer concentrations are 1.2 μM, 1.0 μM, 0.8 μM, 0.6 μM, and 0.4 μM.
[0025] Figure 3 The figure shows the effect of different probe concentrations on the MIRA detection reaction in Example 1 of the present invention; the curves in the figure represent the fluorescence curves of the reaction when the final probe concentrations are 0.3 μM, 0.24 μM, 0.18 μM, 0.12 μM and 0.06 μM.
[0026] Figure 4 This is a graph showing the specific detection results (fluorescence values) in Example 2 of the present invention.
[0027] Figure 5 This is a diagram of the specific detection results (ultraviolet light) in Example 2 of the present invention.
[0028] Figure 6 This is a graph showing the sensitivity detection results (fluorescence values) in Example 2 of the present invention.
[0029] Figure 7 This is a sensitivity detection result diagram (ultraviolet light) in Embodiment 2 of the present invention. Detailed Implementation
[0030] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0031] vlhA gene sequence: GATGCGTAAAATAAAAGGATTTATTTATGAAAAATAAAAAAATTAAAATTACTATTAGCAGCTAGTGCAGTGGCCATTGCTCCTGCTGTTATAGCAATTTCATGTGGTGATCAAACTCCAGCACCTGAACCAACACCTGGAAACCCAAATACTGATAATCCTCAAAACCCAAATCCAGGAAATCCAGGTACTCCAGGAAATCCAGGTACTGATAATCCTCAAAACCCAAATCCAGGAAAC CCAGGAGGTGGTACAGTTGACCCTGTAGAGGC TGCT AAAACAGAAGCTA
[0032] Example 1 (1) A conserved sequence was obtained by comparing the Mycoplasma synoviae vlhA sequence published on NCBI (as shown in SEQ ID NO. 1) with bioinformatics software. Three upstream primers, named F1, F2, and F3, and three downstream primers, named R1, R2, and R3, were designed based on the conserved sequence. One Exo probe was named Prob1. The upstream and downstream primer and probe sequences are as follows: F1: 5'-AGCACCTGAACCAACACCTGGAAACCCAA-3'; SEQ ID NO. 2.
[0033] F2: 5'-CTGAACCAACACCTGGAAACCCAAATACTG-3'; SEQ ID NO.3.
[0034] F3: 5'-TGAACCAACACCTGGAAACCCAAATACTGA-3'; SEQ ID NO.4.
[0035] R1: 5'-CTGATAATTCTGCTGAAGCATCAATAGCG-3'; SEQ ID NO.5.
[0036] R2: 5'-CTGAATCTGATAATTCTGCTGAAGCATCAAT-3'; SEQ ID NO.6.
[0037] R3: 5'-AATCTCTGGCTTCAGCTTCTGTTGTAGTTG-3'; SEQ ID NO.7.
[0038] Prob1: CCAGGAGGTGGTACAGTTGACCCTGTAGAGGC[FAM-dT][THF]C[BHQ1-dT]AAAACAGAAGCTA-C3-spaser.
[0039] The probe is based on CCAGGAGGTGGTACAGTTGACCCTGTAGAGGCTGCTAAAACAGAAGCTA (SEQ ID NO.8). Starting from the 5' end, the 33rd base T is modified with the FAM group, the 34th base G is replaced with THF, the 36th base T is modified with the BHQ1 group, and the 3' end is modified with C3 spacer blocking modification.
[0040] (2) Using clinical positive samples as MIRA reaction templates, DNA was extracted from the samples, and a total of 9 primer-probe combinations were used, including 3 upstream primers, 3 downstream primers, and 1 Exo probe. The reaction system is shown in Table 1. The reaction conditions were 39℃ for 20 min.
[0041] Table 1
[0042] See results Figure 1 Under the same conditions, the F2R3 primer pair showed good amplification efficiency and high fluorescence value, so this primer pair was selected as the optimal primer pair for subsequent experiments.
[0043] (3) Kit optimization: Based on Table 1, the final concentrations of upstream and downstream primers and probes in the reaction system were adjusted to obtain the optimal reaction components. The optimization results are shown in Table 1. Figure 2 , Figure 3 Considering both economic efficiency and amplification efficiency, the amplification signal was stable and the amplification efficiency was good when the final primer concentration was 0.6 μM and the final probe concentration was 0.24 μM. In summary, the optimal reaction system for this method is: 29.4 μL buffer A, 1.5 μL each of primers, 1.2 μL probe, 5 μL template, 8.9 μL ddH₂O, and 2.5 μL buffer B.
[0044] Example 2 (1) Specificity test Mycoplasma synoviae (MS), Mycoplasma gallisepticum (MG), and Escherichia coli (S. synoviae) E. coli Salmonella pullorum ( ), S. pullorum Positive samples of avian infectious bronchitis virus (IBV), avian metapneumovirus (aMPV), avian reticuloendotheliosis virus (REV), avian leukosis virus (ALV), avian influenza virus (AIV), and Newcastle disease virus (NDV) were tested, with ddH2O used as a negative control (NTC). The specificity of the detection method established in Example 1 was investigated. Fluorescence results are shown in [Figure 1]. Figure 4 Only MS-positive samples produced fluorescence patterns with extremely significant differences, while the fluorescence signals of other samples showed no significant difference from the negative control. Ultraviolet results are shown below. Figure 5 Only MS-positive samples showed color development under ultraviolet light, while other samples and negative controls did not show color development. This result indicates that the established fluorescence MIRA method has good specificity for MS.
[0045] (2) Sensitivity test Mycoplasma synovitis was amplified using the optimal primer pair F2R3 as PCR primers. The amplification product (as shown in SEQ ID NO.9) was recovered from the gel and ligated into the pMD18-T vector. After transformation into Escherichia coli DH5α competent cells, the plasmid was extracted and its concentration was determined. The constructed recombinant plasmid was verified by sequencing and stored at -20℃ as a positive standard plasmid for later use.
[0046] CTGAACCAACACCTGGAAACCCAAATACTGATAATCCTCAAAACCCAAATCCAGGAAATCCAGGTACTCCAGGAAATCCAGGTACTGATAATCCTCAAAACCCAAATCCAGGAAACCCAGGAGGTGGTACAGTT GACCCTGTAGAGGCTGCTAAAACAGAAGCTAAAACCGCTATTGATGCTTCAGCAGAATTATCAGATTCAGTTAAAGAAGCATTAAAAAGACAAGTTGAAGCAACTACAACAGAAGCTGAAGCCAGAGATT; SEQ ID NO.9.
[0047] Take 5 μL of each sample with a concentration of 2.3 × 10⁻⁶. 6 -1×10 0 Positive standard plasmids of copies / μL were used as samples, and the method established in Example 1 was used for detection, with the empty pMD18-T plasmid as a negative control (NTC). Fluorescence results are shown in [Figure Number]. Figure 6 The results of ultraviolet light are shown in Figure 7 This method can detect samples as low as 2.3 copies / μL using fluorescence value and ultraviolet colorimetric analysis.
[0048] (3) Repeatability test Three positive standard plasmids with different concentrations were selected, including sample 1 (2.3 × 10⁻⁶). 5 copies / μL), Sample 2 (2.3×10 4 copies / μL), Sample 3 (2.3×10 3 The samples were tested in triplicate (copies / μL), with an empty vector plasmid serving as a negative control. The reaction solution was prepared according to the system described in Example 1, and MIRA-specific amplification was performed according to the reaction procedure described in Example 1 to assess the intra-batch reproducibility of the invention. The three concentration samples were tested at three time points at 14-day intervals to assess the inter-batch reproducibility of the invention. The coefficients of variation for intra-batch and inter-batch reproducibility tests were calculated. The reproducibility test results are shown in Tables 2 and 3. The intra-group coefficients of variation were all less than 10%, indicating that the invention has good reproducibility and stability.
[0049] Table 2 Intra-batch repeatability
[0050] Table 3. Inter-batch repeatability
[0051] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. A primer-probe combination for rapid detection of Mycoplasma synoviae in chickens based on fluorescence MIRA method, characterized in that, The primer-probe combination sequence is as follows: Upstream primer: CTGAACCAACACCTGGAAACCCAAATACTG; Downstream primer: AATCTTGGCTTCAGCTTCTGTTGTAGTTG; Probe: CCAGGAGGTGGTACAGTTGACCCTGTAGAGGC[FAM-dT][THF]C[BHQ1-dT]AAAACAGAAGCTA-C3-spaser.
2. A method for rapid detection of Mycoplasma synoviae in chickens based on fluorescence MIRA, not for disease diagnosis, characterized in that... Includes the following steps: (1) Extract DNA from the sample to be tested using the boiling method; (2) Amplification is performed using the primer-probe combination described in claim 1; (3) Result determination: The difference between the reaction endpoint fluorescence value and the initial fluorescence value of the experimental group and the difference between the reaction endpoint fluorescence value and the initial fluorescence value of the negative control group are analyzed by biostatistics. If there is a difference, the test result is positive; if there is no difference, the test result is negative; or if there is fluorescence under ultraviolet light, it is positive, and if there is no fluorescence, it is negative.
3. The method according to claim 2, characterized in that, The sample to be tested in step (1) is a throat swab, palatal cleft swab, tracheal swab, or joint contents of a chicken.
4. The method according to claim 2, characterized in that, Step (1) describes the following steps for extracting DNA from the sample by boiling: Place the collected swab in a 37°C incubator for 30 min, then vortex for 30 s to fully release the pathogen. Aspirate the liquid from the swab and add it to a new 1.5 mL sterile centrifuge tube. Centrifuge at 12000 r / min for 5 min and discard the supernatant. Add 1 mL of 1×PBS to resuspend the sample, vortex to mix, and centrifuge again at 12000 r / min for 5 min. Discard the supernatant. Repeat this washing process twice. Then resuspend the sample in 50 μL of 1×PBS, heat in a 100°C water bath for 8 min, immediately place on ice for 5 min after heating, and finally centrifuge at 12000 r / min for 5 min. The supernatant is genomic DNA.
5. The method according to claim 2, characterized in that, The isothermal amplification system described in step (2) is as follows: 29.4 μL of buffer A, 1.5 μL each of 10 μM upstream and downstream primers, 1.2 μL of 10 μM probe, 5 μL of template, 8.9 μL of ddH2O, and 2.5 μL of buffer B; The isothermal amplification program is to react at 39 °C for 20 min, with fluorescence collected every 30 s.