Molecular marker and primer for identifying pitaya pulp color and application of molecular marker and primer

Abstract

The invention discloses a molecular marker for identifying pitaya pulp color, a primer and application of the molecular marker and the primer, and relates to the technical field of biology. The nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO. 1. The molecular marker provided by the invention can be used for accurately identifying the color of the pitaya pulp. Meanwhile, when the gene is applied to molecular marker assisted selection (MAS) and genome selection (GS), the genetic improvement progress of the dragon fruit variety can be accelerated. The KASP detection technology is adopted, the detection result is accurate and reliable, and the detection method is easy to operate, low in cost, environmentally friendly, free of harm to the human body and suitable for high-throughput and large-scale commercial application.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a molecular marker, primer, and their application for identifying the color of dragon fruit pulp. Background Technology

[0002] Dragon fruit, a specialty fruit of tropical and subtropical regions, is highly sought after for its rich nutrition and unique taste. The color of the flesh is one of the core traits determining its commercial value, with different colored varieties exhibiting significantly different market positioning and consumer demands. White-fleshed varieties (with white flesh) accumulate almost no colored secondary metabolites, while red-fleshed varieties (with red or pink flesh) are mainly due to differences in the accumulation of colored secondary metabolites (such as betaine). In rare cases, bicolor flesh can also occur (bicolor flesh has a red edge where the flesh meets the peel, while the interior is mostly white, thus it can also be considered a white variety). However, traditional dragon fruit breeding and flesh color assessment have many limitations: flesh color can only be observed after the plant has fruited, and accurate phenotypic assessment during the seedling stage is impossible, leading to long-term cultivation of ineffective plants and wasting land and manpower resources; traditional breeding relies on phenotypic selection, making it susceptible to environmental interference, with a breeding cycle of 3-5 years, resulting in low efficiency.

[0003] Molecular marker technology, with its advantages of precision and early detection, provides a new pathway for crop trait improvement. By using molecular markers closely linked to target traits, individuals exhibiting the target trait can be rapidly screened at the seedling stage, shortening the breeding cycle and improving selection efficiency. Currently, research on specific molecular markers for dragon fruit flesh color is limited, and the lack of precise markers that can be directly applied to breeding practices hinders the development of color-oriented breeding for dragon fruit. Therefore, developing molecular markers closely related to dragon fruit flesh color traits, constructing an efficient detection system, and achieving precise prediction and targeted selection of flesh color at the seedling stage are of great significance for promoting the high-quality development of the dragon fruit industry. Summary of the Invention

[0004] To address the problems of existing technologies, such as the need to determine the color of dragon fruit flesh after fruiting, long breeding cycles, and low efficiency, this invention develops a SNP molecular marker for identifying the color of dragon fruit flesh using high-throughput sequencing technology. This marker has been validated in genetic and natural populations. This marker can be used for the commercial identification of dragon fruit (seedlings) sold in the market. Furthermore, applying it to marker-assisted selection (MAS) and genomic selection (GS) can accelerate the genetic improvement of dragon fruit varieties.

[0005] The primary objective of this invention is to identify SNP molecular markers related to the flesh color trait. These markers are located on the dragon fruit genome (http: / / www.pitayagenomic.com / download.php), and their nucleotide sequences are shown in SEQ ID NO.1. The SNP is a C>G mutation at position 150 from the 5' end of SEQ ID NO.1, and this mutation has a stable correspondence with flesh color: the GG type is mainly white flesh, while the CG or CC type is mainly red or pink flesh. The CC genotype is preferred for obtaining a red flesh phenotype, and the CG genotype is preferred for obtaining a pink flesh phenotype.

[0006] To achieve efficient and accurate detection of the aforementioned molecular markers, this invention provides a set of specific primers adapted to KASP (Competitive Allele-Specific PCR) genotyping technology. The primers are characterized by their nucleotide sequences as shown in SEQ ID NO. 2, SEQ ID NO. 3, and SEQ ID NO. 4, where SEQ ID NO. 2 and SEQ ID NO. 3 are allele-specific primers with different colored fluorescent tags attached to their 5' ends, and SEQ ID NO. 4 is a universal primer. This primer set is designed for the SEQ ID NO. 1 sequence and 150 SNP sites, enabling specific identification of target sites through KASP genotyping technology. No electrophoresis is required; genotypes are directly determined by fluorescence signals. It exhibits high amplification efficiency and strong specificity, accurately distinguishing between GG, CG, and CC genotypes, avoiding detection errors caused by non-specific amplification and electrophoresis operations. Furthermore, it is compatible with high-throughput platforms, capable of detecting 96-384 samples per run, significantly improving detection efficiency.

[0007] This invention also provides a kit for detecting the aforementioned molecular markers. The kit is based on KASP genotyping technology, with the core component being the aforementioned specific primer set. It also includes a KASP-specific Master Mix (containing Taq enzyme, dNTPs, fluorescent probes, and reaction buffer), sterile water, and standard controls (one tube each of GG, CG, and CC standard genotype templates, each at a concentration of 50 ng / μL). The Master Mix is ​​pre-mixed with fluorescent groups, eliminating the need for additional fluorescent reagent preparation. During use, simply mix the primer set, Master Mix, and template DNA in the correct proportions to initiate the reaction. The kit comes with detailed instructions, clearly defining the reaction system ratios and program parameters. It eliminates the need for complex experimental condition optimization and can be directly applied to batch detection of field samples, lowering the detection threshold. It also supports both conventional PCR instruments and high-throughput quantitative PCR instruments, adapting to different scale detection needs.

[0008] The present invention provides a genetic breeding method for screening the fruit pulp color traits of pitaya, which can accurately achieve the directional breeding of fruit pulp color and significantly improve the breeding efficiency. The method is characterized in that the method comprises the following core steps: detecting the genotypes of the aforementioned SNP molecular markers by any method, and selecting individuals with different genotypes as parents according to the breeding objectives.

[0009] Preferably, based on the above molecular markers and detection tools, the present invention provides an efficient genetic breeding method for pitaya, which can achieve the directional breeding of fruit pulp color traits. The method is characterized in that the method comprises the following core steps: First, obtain the plant tissues of the待测火龙果育种资源群体 (preferably fresh leaves at the seedling stage, with a sampling amount of 0.05-0.1 g), and extract genomic DNA using the CTAB method or the plant DNA extraction reagent supporting the kit; Secondly, use the specific primer set or detection kit described in the present invention to detect the genotypes of the target SNP loci of the待测个体 by the KASP genotyping technology. The recommended reaction system is 10 μL: 5 μL of KASP Master Mix, 0.14 μL of the primer set mixture (each primer concentration is 10 μM, volume ratio 1:1:2), 1 μL of template DNA, and 3.86 μL of sterile water. The reaction procedure is pre-denaturation at 94 °C for 15 min; denaturation at 94 °C for 20 s, annealing and extension at 61-55 °C for 60 s (decreasing 0.6 °C per cycle, a total of 10 cycles); denaturation at 94 °C for 20 s, annealing and extension at 55 °C for 60 s (a total of 26 cycles); Finally, collect the fluorescence signals by a fluorescence quantitative PCR instrument, and select individuals with specific genotypes as parents according to the breeding objectives: If the goal is to cultivate a white pulp variety, select homozygous GG individuals; If the goal is to cultivate a red or pink pulp variety, select heterozygous CG individuals or select homozygous CC individuals. For red, CC individuals can be preferentially selected, and for pink, CG individuals can be preferably selected, so as to achieve accurate seed selection at the seedling stage, eliminate non-target genotype individuals, and reduce subsequent land and management costs.

[0010] The present invention also provides a method for predicting the fruit pulp color traits of pitaya using molecular markers, which can quickly predict the fruit pulp color, especially suitable for the commercial identification of market seedlings. The method is characterized in that the method comprises the following steps: detecting the genotypes of the aforementioned SNP molecular markers by any method, and predicting the fruit pulp color of pitaya according to the detected genotype results.

[0011] Preferably, the method for detecting the aforementioned molecular marker genotype specifically includes the following steps: (1) extracting genomic DNA from the dragon fruit sample to be tested. The sample can be commercially available seedlings, germplasm resources, etc. The sampling site is selected from easily accessible leaves. A simplified alkaline lysis method can be used for rapid extraction to meet the needs of batch testing; (2) using the aforementioned primer set or kit to detect the genotype of the dragon fruit to be tested. If it is a large-scale commercial identification, it can be combined with fluorescence quantitative PCR technology to achieve automated interpretation and improve detection efficiency; (3) based on the detection results, determining the genotype of the aforementioned molecular marker of the dragon fruit to be tested, and then predicting the flesh color: when the genotype is GG, it is predicted to be white flesh; when the genotype is CG or CC, it is predicted to be red or pink flesh. The accuracy of this prediction result is high after population verification, which can provide a reliable basis for seedling transactions.

[0012] The beneficial effects achieved by this invention are as follows: The aforementioned SNP molecular markers have significant application value in breeding related to dragon fruit flesh color traits or in predicting dragon fruit flesh color. Applying them to MAS breeding enables precise seedling selection, eliminating individuals with non-target genotypes, and reducing breeding costs. Integrating them into the GS model can improve the predictive accuracy of multi-trait aggregation breeding and accelerate the process of variety genetic improvement. Simultaneously, the aforementioned primer sets or kits also have significant application advantages in breeding related to dragon fruit flesh color traits or in predicting dragon fruit flesh color. They exhibit high specificity and stable detection results, and can be widely applied to early screening in breeding units, quality identification in seedling enterprises, and resource evaluation in research institutions, providing the dragon fruit industry with full-chain technical support from variety cultivation to commercial circulation. Attached Figure Description

[0013] The method of the present invention and its beneficial effects will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0014] Figure 1 It is a QTL-based LOD (Level of Detail) chain diagram. Figure 2 This is a statistical result of different genotypes after grouping the fruit flesh color of the genetic population; Red represents red, Pink represents pink, White represents white, and Union represents mixed colors.

[0015] Figure 3 This is a statistical result of different flesh colors of the individual after grouping the genotypes of the genetic population; Red represents red, Pink represents pink, White represents white, and Union represents mixed colors.

[0016] Figure 4 This is a statistical result of different genotypes after grouping the flesh color of fruit in a natural population; Red represents red, Pink represents pink, White represents white, and Union represents mixed colors.

[0017] Figure 5 This is a statistical result of different flesh colors after grouping the genotypes of a natural population; Red represents red, Pink represents pink, White represents white, and Union represents mixed colors. Detailed Implementation

[0018] The technical solutions in the embodiments of the present invention are clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as commonly understood by those skilled in the art to which this application pertains. The above description of the disclosed embodiments enables those skilled in the art to implement or use the present invention. Various modifications to the above embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention should not be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

[0019] Example Example 1: Development of SNPs and QTL Localization 1. Experimental Materials All experimental materials were obtained from the Nanning Pitaya Germplasm Resource Nursery of the Ministry of Agriculture and Rural Affairs. The offspring and parent samples are shown in Table 1 and Table 4, respectively.

[0020] 2. Sample DNA extraction, library construction, and sequencing 1) Use a kit to extract genomic DNA.

[0021] 2) Perform whole-genome resequencing on the samples.

[0022] 3. Data quality control Use the software fastp (version: 0.20.0) to filter low-quality sequences from the raw data to obtain Clean Data, with the parameters set to default.

[0023] 4. Population variation detection In this invention, we use the dragon fruit genome as the reference genome (http: / / www.pitayagenomic.com / download.php). The obtained sequencing reads need to be repositioned onto the reference genome before subsequent variation analysis can be performed. The reference genome was aligned using BWA (Burrows-Wheeler Aligner, 0.7.17-r1188) with parameters set to -M and -R. The generated SAM file was converted to BAM format using samtools (version 1.9). Then, PCR duplications were marked using picardMarkDuplicates (version 2.21.2). Only high-quality reads were then retained for subsequent analysis.

[0024] 5. SNP Filtering (1) Sequencing depth and quality value filtering: average sequencing depth greater than or equal to 10X, minimum quality value greater than or equal to 30, locus detection rate of 97%, biselectrophoresis, minimum allele frequency (maf) ≥ 0.05. (2) Target region filtering: based on the target region to be amplified, SNPs located within the target region are screened.

[0025] 6. Genetic mapping and QTL localization (1) Phenotypic analysis: After obtaining phenotypic data, perform basic visualization, descriptive analysis, etc.

[0026] (2) Genotype and map filtering: For projects with a large number of markers, the markers can be screened according to the marker missing ratio, minimum genetic distance, and minimum physical distance, or no screening is required; this invention retains a total of 7,000 markers through screening.

[0027] (3) Perform QTL scan: Using R / qtl software, perform QTL scan according to the selected model and the specified step size, and perform permutation a specified number of times for each trait.

[0028] (4) Determination of saliency interval: Based on the given threshold and confidence interval determination method, determine the location of QTL and its confidence interval. Points with LOD exceeding the threshold are saliency points. Consecutive saliency points constitute a saliency interval. The location of the point with the highest LOD value is taken as the peak of the interval. Based on the LOD value of the peak point, the interval that can be covered after decreasing by a specified LOD value (such as 1.5) is taken as the confidence interval of the QTL. If the distance between two peaks does not exceed the given length, they are merged into a saliency interval.

[0029] like Figure 1As shown, the cim() function of R / qtl was used to plot the composite interval of the trait with a scan step size of 1 cM. QTLs were screened using LOD=2.5 as the threshold. The results showed that there were significant linkage sites on chromosome 3.

[0030] Finally, we selected the following SNP in the QTL location region: chr03_4354096: for further verification. The nucleotide sequence of the SNP is shown in SEQ ID NO.1: AAATAAAACCAAAAATAAAAATAAAAATCACATGTTTCCTTTTACTTGTTAACAATTGAATTTTGTGCATGTGAAGGATATATTTGATGCCGGAACAGACACCACTTCCAGTACATTTGAATGGGCCATGGCTGAGTTAATTAAAAATC[C |G]GACGATGATGGAGAAAGCTCAAGCTGAAATCAAAGTGGTTCTTGGGAAACAGTCGCATATTCAAGAGTCCGATATCCCAAAATTGCCTTATTTGCGGGCAATTATCAAAGAAACATTGCGTCTACACCCTCCTACTGTATTCCTCCTAC Example 2: Correlation analysis between phenotype and genotype in a genetic population To investigate the distribution differences of different flesh color types (white flesh type and red flesh type) in target genotypes (G:G, C:G) and to verify whether there is a statistical association between flesh color type and genotype, 184 genetic population samples were sequenced and statistically analyzed (Table 1). The samples were F1 offspring of crosses between red flesh and white flesh parents.

[0031] Table 1. Phenotypes and genotypes of F1 hybrid offspring Based on the sequence information of the SNP sites described in Example 1, KASP primers were designed using MassARRAY Assay Design SUITE V2.0 software, as shown in Table 2. The detected SNP sites and complete dragon fruit young stem tissue samples were submitted to Jisihuiyuan Biotechnology Co., Ltd. for KASP genotyping. The primers and probes were then combined to prepare a detection kit.

[0032] Table 2 KSAP primers Among them, chr03_4354096-F1 corresponds to SEQ ID NO.2, chr03_4354096-F2 corresponds to SEQ ID NO.3, and chr03_4354096-R corresponds to SEQ ID NO.4.

[0033] The number and proportion of "G:G" and "C:G" genotypes within each phenotype were calculated, and the results are shown in Table 3 below: Table 3. Statistical analysis of different phenotypes and genotypes in the genetic population. Chi-square test was used to verify whether "flesh color type" and "genotyping" are independent (i.e., whether they are related).

[0034] Hypothesis testing: Null hypothesis (H0): Flesh color type and genotype are independent of each other, and there is no statistically significant difference in genotype distribution between the two groups; Alternative hypothesis (H1): Flesh color type and genotype are not independent, and there is a statistically significant difference in genotype distribution between the two groups; Significance level (α): 0.05 (i.e., 95% confidence level).

[0035] Statistical difference: The chi-square test results showed that χ²: 172.1924, df: 3, P: 4.28e-37, rejecting the null hypothesis, indicating that there is a highly significant statistical difference in the distribution of pulp color in the target genotype (G:G / C:G).

[0036] Phenotype-genotype preference ( Figure 2 The white meat samples were highly enriched with the G:G genotype (98.63%), and the C:G genotype was very rare (1.37%); the red meat samples were highly enriched with the C:G genotype (98.53%), and the G:G genotype was very rare (1.47%); the pink meat samples were highly enriched with the C:G genotype (96.77%), and the G:G genotype was very rare (3.23%).

[0037] Genotype-phenotype preference ( Figure 3 In the C:G genotype, red-fleshed samples accounted for 68.37%, pink-fleshed samples accounted for 30.61%, white-fleshed samples accounted for only 1.02%, and bicolor-fleshed samples accounted for 0%; in the G:G genotype, white-fleshed samples accounted for 83.72%, red-fleshed samples accounted for 1.16%, pink-fleshed samples accounted for 1.16%, and bicolor-fleshed samples accounted for only 13.95%.

[0038] Association strength: The "reverse preference" feature between the two genotype distributions is significant. Figure 3 This suggests a strong association between this genotype and meat color type (white meat vs. red / pink meat), indicating that this genotype is one of the important genetic markers affecting meat color phenotype.

[0039] Example 3: Correlation analysis between phenotype and genotype in natural populations To investigate the distribution differences of different flesh color types (white flesh type and red flesh type) in the target genotypes (G:G, C:G) and to verify whether there is a statistical association between flesh color type and genotype, a statistical analysis was further performed on 96 natural population samples (Table 4). The samples were different varieties with red flesh and white flesh.

[0040] Table 4. Phenotypes and genotypes of different varieties The number and proportion of genotypes within each phenotype were calculated, and the results are shown in Table 5 below: Table 5. Statistics of different phenotypes and genotypes in natural populations. Chi-square test was used to verify whether "flesh color type" and "genotyping" are independent (i.e., whether they are related).

[0041] Hypothesis testing: Null hypothesis (H0): Flesh color type and genotype are independent of each other, and there is no statistically significant difference in genotype distribution between the two groups; Alternative hypothesis (H1): Flesh color type and genotype are not independent, and there is a statistically significant difference in genotype distribution between the two groups; Significance level (α): 0.05 (i.e., 95% confidence level).

[0042] Statistical differences: The chi-square test results showed that χ²: 61.2483, df: 6, P: 2.51e-11, rejecting the null hypothesis, indicating that there is a highly significant statistical difference in the distribution of pulp type in the target genotype (C:G / C:C / G:G).

[0043] Phenotype-genotype preference ( Figure 4 The red meat group was significantly enriched with the C:G and C:C genotypes (totaling 98.33%), and almost entirely lacked the G:G genotype; the white meat group was significantly enriched with the G:G genotype (76.00%), while the C:G and C:C genotypes accounted for less than 30%; the pink meat samples were highly enriched with the C:G genotype (77.78%) and CC genotype (22.22%), and lacked the G:G genotype.

[0044] Genotype-phenotype preference ( Figure 5In the C:G genotype, red-fleshed samples accounted for 77.36%, pink-fleshed samples accounted for 13.21%, white-fleshed samples accounted for only 7.55%, and bicolor-fleshed samples accounted for 1.89%; in the G:G genotype, white-fleshed samples accounted for 90.48%, red-fleshed samples accounted for 4.76%, no pink-fleshed samples were found, and bicolor-fleshed samples accounted for only 4.76%; in the C:C genotype, red-fleshed samples accounted for 81.82%, pink-fleshed samples accounted for 9.09%, white-fleshed samples accounted for 9.09%, and bicolor-fleshed samples were found.

[0045] Association strength: The "reverse preference" feature between the two genotype distributions is significant. Figure 5 This suggests a strong association between this genotype and meat color type (white meat / red meat), and this genotype is one of the important genetic markers affecting meat color phenotype.

[0046] In summary, whether in genetic or natural populations, the genotypes of the SNP loci described in this invention are significantly associated with fruit pulp staining. Specifically, the white-fleshed type is mainly associated with the G:G genotype, while the red and pink-fleshed types are mainly associated with the C:G and C:C genotypes, respectively.

[0047] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to the above embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A SNP molecular marker associated with the color trait of dragon fruit pulp, characterized in that, The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, and the SNP is a single nucleotide variant with C>G at position 150 from the 5' end of SEQ ID NO.

1.

2. A primer set for detecting the SNP molecular marker of claim 1, characterized in that, The nucleotide sequences of the primer set are shown in SEQ ID NO.2~4.

3. A kit for detecting the SNP molecular marker of claim 1, the kit comprising the primer set of claim 2.

4. The kit according to claim 3, characterized in that, The kit also contains enzymes and dNTPs for PCR reactions.

5. A genetic breeding method for screening the color trait of dragon fruit flesh, characterized in that, The method includes the following steps: detecting the genotype of the SNP molecular marker described in claim 1, and selecting individuals with different genotypes as parents according to the breeding objectives.

6. The method according to claim 5, characterized in that, The method for detecting the genotype of the SNP molecular marker of claim 1 includes the following steps: (1) extracting genomic DNA from the dragon fruit resource population to be tested; (2) using the primer set of claim 2 or the kit of claim 3 to detect the genotype of the dragon fruit to be tested; (3) determining the genotype of the molecular marker of claim 1 of the dragon fruit to be tested based on the detection results.

7. A method for predicting the color trait of dragon fruit pulp using molecular markers, characterized in that, The method includes the following steps: detecting the genotype of the SNP molecular marker described in claim 1, and predicting the color of dragon fruit flesh based on the detected genotype results.

8. The method according to claim 7, characterized in that, The method for detecting the genotype of the SNP molecular marker of claim 1 includes the following steps: (1) extracting genomic DNA from the dragon fruit sample to be tested; (2) using the primer set of claim 2 or the kit of claim 3 to detect the genotype of the dragon fruit to be tested; (3) determining the genotype of the molecular marker of claim 1 of the dragon fruit to be tested based on the detection results.

9. The application of the SNP molecular marker as described in claim 1 in breeding related to the color trait of dragon fruit flesh or in predicting the color of dragon fruit flesh.

10. The application of the primer set of claim 2 or the kit of claim 3 in breeding related to the color trait of dragon fruit flesh or in predicting the color of dragon fruit flesh.

Images