CRISPR-Cas13a system for detecting rift valley fever virus and application
By combining the CRISPR-Cas13a system with RT-RAA technology, specific crRNA targeting the Rift Valley fever virus gene sequence was designed, solving the problems of cumbersome operation and low sensitivity of existing detection methods, and realizing high-sensitivity and rapid nucleic acid detection of Rift Valley fever virus.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- ACADEMY OF MILITARY MEDICAL SCIENCES
- Filing Date
- 2025-11-24
- Publication Date
- 2026-05-12
AI Technical Summary
Existing methods for detecting Rift Valley fever virus are cumbersome to operate, have low sensitivity, and are not suitable for rapid on-site detection, making it difficult to meet the needs for rapid, simple, and highly sensitive detection.
By using the CRISPR-Cas13a system combined with RT-RAA technology, specific crRNA targeting the Rift Valley fever virus gene sequence was designed, and the viral nucleic acid was detected by fluorescence quantitative PCR or lateral flow chromatography strips to achieve high-sensitivity detection.
It achieves highly sensitive detection of Rift Valley fever virus nucleic acid, with a sensitivity of 1 copy/μL, and is simple to operate and suitable for rapid on-site detection.
Smart Images

Figure CN122012806A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular diagnostic technology, specifically relating to a CRISPR-Cas13a system for detecting Rift Valley fever virus and its application. Background Technology
[0002] Rift Valley Fever Virus (RVFV) is an arthropod-borne virus belonging to the genus *Leptaviridae* of the family Papilioniidae in the order Bunyavirales. The RVFV genome consists of three enveloped, segmented, single-stranded negative-sense RNA segments named the L (Large Segment), M (Medium Segment), and S (Small Segment). The L segment encodes only one protein: RNA-dependent RNA polymerase. The M segment encodes four proteins: two glycoproteins, Gn and Gc, that form the viral envelope, and two non-structural proteins, NSm and a Gn / NSm fusion protein. The S segment encodes two proteins: the nucleoprotein gene NC and the non-structural protein gene NSs. Mosquitoes are the primary vectors of RVFV, primarily transmitting the virus through bites to host animals or humans. Transmission can also occur through direct contact with the blood of infected animals, breathing the air around slaughtered infected animals, and drinking raw milk from infected animals. Infection in the general population can cause mild symptoms such as fever, headache, back pain, dizziness, loss of appetite, and photophobia, as well as severe symptoms such as vision loss, severe headache, and mental confusion. The disease also leads to a mortality rate of 0.5% to 2% in adults and as high as 28% in infants and young children. Therefore, developing accurate, rapid, sensitive, and convenient detection technologies for Rift Valley fever virus is crucial for the prevention and control of Rift Valley fever.
[0003] Clustered regularly interspaced short palindromic repeats (CRISPR) and related proteins (Cas) constitute an acquired immune system, first discovered in archaea. Further research revealed that upon binding to target RNA, the Cas13a protein is activated, enabling the cleavage of non-target RNA. By attaching detectable target clusters to both ends of the non-target RNA, the target RNA can be indirectly detected through the detection of these target clusters—the CRISPR-Cas13a detection method.
[0004] Currently, there are three main methods for the clinical diagnosis of Rift Valley fever: serological immunoassay, nucleic acid detection, and virus isolation and culture. Virus isolation and culture is the most direct diagnostic method, but it is extremely cumbersome and complex. Compared to nucleic acid detection, immunological testing is cumbersome, has lower sensitivity, and takes longer, making it unsuitable for rapid on-site testing. PCR nucleic acid detection relies on a real-time PCR instrument, which is not ideal for screening in areas with limited medical resources. In summary, existing detection methods cannot simultaneously achieve rapid and convenient testing while maintaining high sensitivity. There is an urgent need to develop a rapid, convenient, highly sensitive, and highly specific detection method for Rift Valley fever virus detection. Summary of the Invention
[0005] Based on the technical problems existing in the prior art, the present invention provides a CRISPR-Cas13a system for detecting Rift Valley fever virus and its application; the detection method of the present invention, which combines RT-RAA detection technology with lateral flow chromatography test strips, has the technical advantages of simple operation, system stability and has been widely used in the field of clinical molecular diagnostics, achieving highly sensitive detection of the corresponding pathogen.
[0006] To achieve the above objectives, this invention is based on the principles of the CRISPR-Cas13a system and the selection of target sequences. Five crRNAs were designed according to the Rift Valley fever virus gene sequence, and the crRNA with the best activation effect on the CRISPR-Cas13a system was selected for Rift Valley fever virus nucleic acid detection.
[0007] The first objective of this invention is to provide a crRNA target for detecting Rift Valley fever virus, wherein the Rift Valley fever virus target sequence is SEQ ID NO.1.
[0008] A second objective of this invention is to provide a CRISPR-Cas13a system for detecting Rift Valley fever virus, the CRISPR-Cas13a system comprising Cas13a protein and crRNA, or a complex thereof; The crRNA includes an anchoring sequence for binding to the Cas13a protein and a guide sequence for targeting the Rift Valley fever virus target sequence, as shown in SEQ ID NO.1.
[0009] In some embodiments, the crRNA sequence is as shown in SEQ ID NO.2.
[0010] In some embodiments, the Cas13a protein is the LwCas13a protein.
[0011] A third objective of this invention is to provide a kit for detecting Rift Valley fever virus, comprising the aforementioned CRISPR-Cas13a system for detecting Rift Valley fever virus.
[0012] In some embodiments, the kit further includes RAA amplification primers for specifically amplifying the target sequence of Rift Valley fever virus; the RAA amplification primers consist of single-stranded DNA molecules shown in SEQ ID NO.4 and SEQ ID NO.5.
[0013] A fourth object of the present invention is to provide any of the following substances: A1) The crRNA mentioned above; A2) The Cas13a protein and crRNA mentioned above, or a complex formed by the two; A3) The primer pairs mentioned above.
[0014] The fifth object of the present invention is to provide any of the following applications: B1) The application of the above-described system, kit, or substance in the detection or auxiliary detection of Rift Valley fever virus or its nucleic acid; B2) The use of the above-described system, kit, or substance in the preparation of products for detecting or assisting in the detection of Rift Valley fever virus or its nucleic acid; B3) The application of the above-mentioned system, kit, or substance in detecting or assisting in the detection of whether the sample to be tested contains Rift Valley fever virus or its nucleic acid; B4) The application of the above-described system, kit, or substance in the preparation of products for detecting or assisting in the detection of whether a sample contains Rift Valley fever virus or its nucleic acid; B5) The application of the above-mentioned system, kit, or substance in screening or assisting in screening Rift Valley fever virus prevention and treatment drugs. B6) The use of the above-described system, kit, or substance in the preparation of products for screening or assisting in screening Rift Valley fever virus prevention and control drugs. B7) The use of the above-mentioned substances in the preparation of the above-mentioned kit.
[0015] The sixth object of the present invention is to provide an application for detecting crRNA targets of Rift Valley fever virus as described above, wherein the application is to prepare crRNA or to prepare RAA amplification primers for specifically amplifying the target sequence of Rift Valley fever virus or to prepare a positive control for detecting Rift Valley fever virus.
[0016] A seventh objective of this invention is to provide a method for detecting or assisting in the detection of Rift Valley fever virus, comprising the following steps: C1) Using the nucleic acid of the sample to be tested as a template, RAA amplification was performed using a primer pair consisting of single-stranded DNA molecules shown in SEQ ID NO.4 and single-stranded DNA molecules shown in SEQ ID NO.5 to obtain RAA products; C2) Prepare a CRISPR-Cas13a detection system containing the following components: the RAA product, Cas13a protein, the above-mentioned crRNA, reporter RNA, NTP, T7 RNA polymerase, and RNase inhibitor; water (ddH2O) is used as a negative control instead of the PCR product. C3) The reaction products are detected by the CRISPR-Cas13a detection system to determine whether the sample to be tested contains Rift Valley fever virus.
[0017] The above reactions are either reaction C3)-1 in the fluorescence system or reaction C3)-2 in the test strip system: C3)-1: The CRISPR-Cas13a detection system, wherein the RNA in the CRISPR-Cas13a detection system is a fluorescent reporter RNA, is placed in a real-time PCR instrument to react, and the fluorescence intensity is detected. The presence of Rift Valley fever virus in the test sample is determined based on the magnitude of the fluorescence intensity: at least 3 independent replicate experiments are set up, and the difference in the mean fluorescence value of each group at the 30th cycle is compared to see if it is significant (t-test, P<0.05). If the test sample is significantly different from the negative control group (using ddH2O as a template), the test sample contains or is a candidate for containing Rift Valley fever virus; otherwise, the test sample does not contain or is a candidate for not containing Rift Valley fever virus.
[0018] C3)-2: The CRISPR-Cas13a detection system is used for reaction, and the RNA in the CRISPR-Cas13a detection system is the reporter RNA detected by the test strip. The reaction product is detected by the test strip. The presence of Rift Valley fever virus in the test sample is determined by whether the "T" line disappears and the "C" line appears. If the "T" line of the test sample detection system disappears and the "C" line appears within the same detection time, the test sample contains or is a candidate for containing Rift Valley fever virus. Otherwise, the test sample does not contain or is a candidate for not containing Rift Valley fever virus.
[0019] In some embodiments, in step C1), the reaction conditions for RAA amplification are: 42°C for 30 minutes; in step C3)-1, the reaction conditions are: 37°C, with fluorescence intensity values read every 2 minutes for 30 readings; in step C3)-2, the reaction conditions are: 37°C for 30 minutes.
[0020] The eighth object of the present invention is to provide a CRISPR reaction system for detecting Rift Valley fever virus, the reaction system comprising an RT-RAA primer pair for amplifying Rift Valley fever virus, crRNA for recognizing Rift Valley fever virus, and a CRISPR reaction system.
[0021] A ninth object of the present invention is to provide applications of the CRISPR reaction system as described above, wherein the applications are any one or more of the following d1-d10: d1) Detection or auxiliary detection of Rift Valley fever virus; d2) Prepare products for detection or auxiliary detection of Rift Valley fever virus; d3) Detection or auxiliary detection of Rift Valley fever virus nucleic acid; d4) Prepare nucleic acid products for detection or auxiliary detection of Rift Valley fever virus; d5) Detection or auxiliary detection to determine whether the sample to be tested contains Rift Valley fever virus; d6) Prepare products for testing or auxiliary testing to determine whether the sample to be tested contains Rift Valley fever virus; d7) Detect or assist in the detection of whether the sample to be tested contains Rift Valley fever virus nucleic acid; d8) Prepare products for detection or auxiliary detection of whether the sample to be tested contains Rift Valley fever virus nucleic acid; d9) Screening or assisting in the screening of Rift Valley fever virus prevention and treatment drugs; d10) Prepare screening or assist screening of Rift Valley fever virus prevention and treatment drug products.
[0022] The tenth object of the present invention is to provide an integrated device for detecting Rift Valley fever virus, the integrated device being capable of carrying out the above-described reaction system or reagents of the above-described method, and optionally a readable carrier describing the corresponding method.
[0023] The method for detecting or assisting in the detection of Rift Valley fever virus provided by this invention can be used as both a non-disease diagnosis and treatment method and a disease diagnosis and treatment method. Specifically, the non-disease diagnosis and treatment method can be used, for example, to detect the presence of Rift Valley fever virus in cells before and after drug administration when screening Rift Valley fever virus prevention and treatment drugs at the cellular level.
[0024] Compared with the prior art, the present invention has the following technical advantages: 1. The detection technology based on RT-RAA in this invention has the advantages of simple operation, stable system and widespread application in the field of clinical molecular diagnostics.
[0025] 2. This invention combines RT-RAA technology with CRISPR-Cas13a-based nucleic acid detection technology. Through design, construction, and screening, it ultimately provides a target sequence for Rift Valley fever virus detection and a specific crRNA that can target this target sequence. This crRNA can achieve highly sensitive and specific detection of Rift Valley fever virus nucleic acid by activating Cas13a, with a sensitivity of 1 copy (1 copy / μL). Attached Figure Description
[0026] Figure 1 For use of 10 1Real-time fluorescence values of plasmid copies / µL for PCR+CRISPR fluorescence screening of crRNA.
[0027] Figure 2 For use of 10 1 Final fluorescence values of plasmid PCR+CRISPR fluorescence screening crRNA copies / µL (30th cycle).
[0028] Figure 3 For use of 10 1 Results of screening RAA primer combinations using plasmids of copies / µL and preliminarily screened crRNA.
[0029] Figure 4 For use of 10 1 Real-time fluorescence values of plasmids (copies / µL) and RAA primers used for initial screening for crRNA screening.
[0030] Figure 5 For use of 10 1 Final fluorescence values of plasmid copies / µL and RAA primer combination for initial screening of crRNA (30th cycle).
[0031] Figure 6 Real-time fluorescence values of conserved RVFV sequences at different concentrations were obtained using the optimal RAA primer combination and the optimal CRISPR-Cas13a for crRNA.
[0032] Figure 7 The final fluorescence values of different concentrations of conserved RVFV sequences were detected using the optimal RAA primer combination and the optimal crRNA CRISPR-Cas13a (cycle 30).
[0033] Figure 8 Test strip diagrams for detecting conserved RVFV sequences at different concentrations using the optimal RAA primer combination and the optimal CRISPR-Cas13a crRNA.
[0034] Figure 9 This is a test strip image showing that CRISPR-Cas13a, targeting a conserved sequence of RVFV, did not show cross-reactivity when detecting other pathogens.
[0035] Figure 10 To conduct three repeated experiments, 10 2 Real-time fluorescence values of 7 different viral nucleic acids (copies / µL) were used as a control experiment with ddH2O as a negative template.
[0036] Figure 11 For use of 10 2Final fluorescence values of 7 different viral nucleic acids (copies / µL) compared with ddH2O as a negative template control (30th cycle). Detailed Implementation
[0037] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0038] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0039] The reagents involved in the following examples and their sources are as follows: Recombinase-Mediated Chain Replacement Amplification (RAA) Kit (Hangzhou Zhongce, S001ZC), NTP Mix (BBI, B600057), RNase inhibitor (Murine RNase inhibitor, Novizan, R301-03), 2×Taq Master Mix (Novizan, P111-01), T7 RNA Polymerase (NEB, M0251L), T7 Transcription Kit (T7 Quick High-Yield RNA Synthesis kit, NEB, E2050S), Fluorescent Reporter RNA (RNaseAlert™ QC System v2, Thermo Fisher Scientific, 4479769), MgCl2 (Thermo Fisher Scientific, AM9530G), HEPES (Solepro, 15630-080), LwaCas13a protein (GenScript, Z03486), 2×Super Pfx MasterMix (Kangwei Century, CW2965M), anhydrous ethanol (Sinopharm Shanghai Laboratory, 20210809), chloroform (Sinopharm Shanghai Laboratory, 20200908), RNA Clean XP kit (BECKMANCOULTER, A63987), TrisDNA extraction phenol (Sollarbio, T0250), RNase-free ddH2O (Biomed, RA114-02), test strip reporter RNA (Tianyi Huiyuan, 203130347), CRISPR test strip (Hangzhou Zhongce, 211108004).
[0040] Nucleic acid was extracted from seven viruses: RVFV (Rift Valley fever virus), YFV (yellow fever virus), DENVⅠ (dengue virus type I), DENVⅡ (dengue virus type II), DENVⅢ (dengue virus type III), DENVⅣ (dengue virus type IV), and ZIKV (Zika virus).
[0041] Example 1: Rift Valley fever virus nucleic acid detection kit and detection method based on CRISPR-Cas13a system (I) Rift Valley fever virus nucleic acid detection kit based on CRISPR-Cas13a system I. Preparation of crRNA Five crRNAs were designed from the conserved sequence of Rift Valley fever virus RVFV (SEQ ID NO.3): RVFV-crRNA1, RVFV-crRNA2, RVFV-crRNA3, RVFV-crRNA4, and RVFV-crRNA5. The target sequences corresponding to each RVFV-crRNA sequence are as follows: The target sequences for RVFV-crRNA1 are as follows: ttctatggttgggccctgttgtgtcttt, located at positions 133-160 of the RVFV S gene (GeneID: MG659986.1); the target sequence for RVFV-crRNA2 is as follows: ctcatgcaccatcgtcctagtcacgagg, located at positions 161-188 of the RVFV S gene (GeneID: MG659986.1); the target sequence for RVFV-crRNA3 is as follows: agttcgcttgcgattctctgatttcta, located at positions 186-213 of the RVFV S gene (GeneID: MG659986.1); and the target sequence for RVFV-crRNA4 is as follows: agaattcccataccgagtcggacttgga (SEQ ID NO.1), located at positions 133-160 of the RVFV S gene (GeneID: MG659986.1). The target sequence for RVFV-crRNA5 is as follows: ccagcaaagccttttcagagacttattg, located at positions 278-305 of the RVFV S gene (GeneID: MG659986.1). The synthesis method of the above crRNA is as follows: 1. Primer sequence synthesis Synthesize the sequences in Table 1.
[0042] Table 1. Primer sequences
[0043] 2. PCR amplification The sequence synthesized in step 1 above was diluted to 10 μM with ddH2O to prepare the PCR reaction system. The PCR reaction system is shown in Table 2.
[0044] Table 2. PCR amplification system
[0045] PCR reaction conditions: 95℃ for 5 min heat denaturation; 35 cycles of 95℃ for 30 s, 55℃ for 30 s, and 72℃ for 30 s; automatic extension at 72℃ for 10 min; storage of PCR products at 4℃. Five PCR products were obtained by amplification using the RVFV-gRNA primer pairs shown in Table 1.
[0046] 3. Purification of PCR products The five PCR products obtained in step 2 were purified using phenol extracted from TrisDNA. The specific steps are as follows: 700 μL of phenol extracted from TrisDNA was added to an equal volume of chloroform, vortexed, briefly centrifuged, and the supernatant was discarded. 600 μL of the phenol-chloroform mixture was added to 200 μL of the PCR product, mixed, and centrifuged at 12,000 rpm for 10 min. The supernatant was transferred to a new 1.5 mL centrifuge tube, and anhydrous ethanol was added to make the supernatant-ethanol ratio 3:7. The tube was centrifuged at 12,000 rpm for 10 min, and the supernatant was discarded. 200 μL of 75% ethanol was added, and the tube was centrifuged at 12,000 rpm for 10 min, and the supernatant was discarded (this step was performed three times). The resulting precipitate was air-dried at room temperature (approximately 10 min) to obtain the five purified PCR products.
[0047] The above 5 purified PCR products were added to 40 μL of RNase-free water, and the concentration was detected using an ultra-micro spectrophotometer. The products were then stored at -80℃.
[0048] 4. Transcription Take 1 μg of the five purified PCR products obtained in step 3 and use them to transcribe crRNA using the T7 transcription kit (NEB). The crRNA transcription system is shown in Table 3.
[0049] Table 3. crRNA transcription system
[0050] After mixing the above crRNA transcription system, transcribe at 37°C for 12 hours.
[0051] The transcribed crRNA sequences were named RVFV-crRNA1, RVFV-crRNA2, RVFV-crRNA3, RVFV-crRNA4, and RVFV-crRNA5. The RVFV-crRNA4 sequence is as follows: GGGATTTAGACTACCCCAAAAACGAAGGGGACTAAAACtccaagtccgactcggtatgggaattct (SEQ ID NO.2). In this sequence, positions 1-38 are the anchoring sequences for binding to the Cas13a protein, and positions 39-66 of SEQ ID NO.2 are the guide sequences for targeting the RVFV target sequence.
[0052] The target sequence of RVFV-crRNA4 is as follows: agaattcccataccgagtcggacttgga (SEQ ID NO.1), located at positions 223-250 of the RVFV S gene (GeneID: MG659986.1). The prepared RVFV-crRNA4 was used for subsequent CRISPR-Cas13a detection.
[0053] 5. crRNA purification The specific steps are as follows: Vortex the magnetic beads (RNA Clean XP) to mix. Add 36 μL of magnetic beads and 100 μL of isopropanol to 20 μL of transcription product. Mix the magnetic beads and transcription system by pipetting 10 times and incubate at room temperature for 10 min. Place the reaction system on a magnetic rack and incubate for 10 min to separate the magnetic beads. Gently aspirate the liquid from the system, avoiding aspirating the magnetic beads. Add 200 μL of 70% ethanol (prepared with RNase-free ddH2O water) to the magnetic beads and incubate at room temperature for 30 s. Aspirate the ethanol. Repeat this process to wash the magnetic beads, for a total of 3 times. Air dry the system at room temperature to remove the ethanol, approximately 10 min. Add 30 μL of RNase-free ddH2O water, pipette and vortex 10 times, let stand for 5 min, then place on a magnetic rack until the system is clear. Aspirate the supernatant and transfer it to a 1.5 mL centrifuge tube. Measure the concentration of the purified crRNA using a micro spectrophotometer. Dilute to 100 ng / μL and aliquot at -80℃ for use.
[0054] The above crRNA sequence was used for the following CRISPR-Cas13a detection of Rift Valley fever virus.
[0055] II. Preparation of plasmid standards 1. Plasmid sequence Plasmid-RVFV is a recombinant plasmid obtained by inserting the following sequence from the Rift Valley fever virus S gene: atcaagtatatcatggattactttcctgtgatatctgttgatttgcagagtggtcgtcgtgttgtgtcagtggagtacattagaggtgatggtcctcccaggataccttattctatggttgggccctgttgtgtctttctcatgcaccatcgtcctagtcacgaggttcgcttgcgattctctgatttctacaatgtcggagaattcccataccgagtcggacttggagactttgcatcaaacgttgcacctccaccagcaaagccttttcagagacttattgatctaAtaggccatatgactcttagtgatttcacaaggttccccaatct (SEQ ID NO.3) into the pUC57 vector (Beijing Tianyi Huiyuan Company).
[0056] Beijing Tianyi Huiyuan Company extracted 5 μg of recombinant plasmid.
[0057] According to the formula: copies / μL = 6.02 × 10 23 × (ng / μL) ×10 -9 / (DNA Length × 660), the above 5 μg of recombinant plasmid was diluted with 100 μL of water to obtain a copy number of 1.68 × 10. 10 Plasmid-RVFV copies / μL.
[0058] 2. Dilution The above plasmids were serially diluted 10-fold to obtain plasmid standards of different concentrations.
[0059] III. Design of RAA Amplification Primers and Obtaining RAA Amplification Products 1. Design of RAA amplification primers Primers designed according to reference (PMID:27246147) are RVFV Virus-specific RAA primers for CRISPR detection. These primers have a T7 transcription sequence (AATTCTAATACGACTCACTATAGGG) at the 5' end, allowing the double-stranded DNA (dsDNA) obtained from RAA amplification to be recognized and transcribed by T7 RNA polymerase. The primer sequences are shown in Table 4 and were synthesized by Beijing Tianyi Huiyuan Co., Ltd.
[0060] Table 4. Primers for RVFV-RAA amplification
[0061] 2. Obtaining RAA amplification products Using plasmid standards as templates, RAA amplification was performed using primers designed in step 1 to obtain RAA amplification products. The RAA amplification system is shown in Table 5.
[0062] Table 5. RAA amplification system
[0063] Add 47.5 μL of the mixed solution to the basic reaction unit containing the lyophilized powder, and allow the lyophilized powder to fully reconstitute. Add 2.5 μL of B Buffer (a component of the RAA amplification kit) to the cap of each reaction tube, close the cap, briefly collect, and mix thoroughly. Incubate the reaction tubes at 42°C for 30 minutes to obtain the RAA amplification product.
[0064] (II) A method for detecting Rift Valley fever virus nucleic acid based on the CRISPR-Cas13a system I. Preparation of plasmid PCR + CRISPR-Cas13a fluorescence detection system 1. Based on the principles of PCR primer design and reference (PMID: 32160714), upstream and downstream primers for plasmid PCR were designed. A T7 promoter sequence (AATTCTAATACGACTCACTATAGGG) was introduced at the 5′ end of the upstream primer to facilitate subsequent transcription. The upstream primer, RVFV-PCR-F, has the sequence AATCTAATACGACTCACTATAGGGtcctgtgatatctgttgatttgca (where 1-25 are the T7 promoter sequence). The downstream primer, RVFV-PCR-R, has the sequence ggaaccttgtgaaatcactaagagt. Both primers were synthesized by Beijing Tianyi Huiyuan Company.
[0065] 2. Obtaining plasmid PCR products The sequence synthesized in step 1 above was diluted to 10 μM with ddH2O, and the plasmid PCR reaction system was prepared according to Table 6. Table 6. Plasmid PCR System
[0066] Plasmid PCR reaction conditions: 95℃ for 3 min heat denaturation; 95℃ for 15 s, 60℃ for 15 s, 72℃ for 20 s, for a total of 35 cycles; 72℃ for automatic extension for 5 min; PCR products stored at 4℃.
[0067] 3. Take 5 μL of the plasmid PCR amplification product obtained above as a template and prepare the CRISPR-Cas13a detection system according to Table 7 below.
[0068] Table 7 CRISPR-Cas13a fluorescence detection system
[0069] PCR tubes containing the reaction system shown in Table 7 above were placed in a real-time PCR instrument. The excitation wavelength of the channel was set to 490 nm, the emission wavelength to 520 nm, and the temperature to 37 °C. The values were read every 2 minutes for a total of 30 readings over 60 minutes to detect changes in fluorescence intensity in the system.
[0070] Result determination: If, within the same detection time, the mean fluorescence intensity value of the test sample detection system is significantly different from the mean fluorescence intensity value of the negative control (ddH2O), then the test sample contains or is a candidate for containing Rift Valley fever virus; otherwise, the test sample does not contain or is a candidate for not containing Rift Valley fever virus. II. Preparation of the RAA+CRISPR-Cas13a fluorescence detection system Using primers RVFV-RAA-F2 and RVFV-RAA-R1 from section 3.1 above, the nucleic acid of the test sample was amplified using RAA to obtain the RAA amplification product; Take 5 μL of the RAA amplification product obtained above as a template and prepare the CRISPR-Cas13a detection system according to Table 8 below.
[0071] The negative control is to replace the RAA product in Table 8 with ddH2O while keeping other reagent components unchanged.
[0072] Table 8. CRISPR-Cas13a fluorescence detection system
[0073] PCR tubes containing the reaction systems shown in Table 8 above were placed in a real-time PCR instrument. The excitation wavelength of the channel was set to 490 nm, the emission wavelength to 520 nm, and the temperature to 37 °C. The values were read every 2 minutes for a total of 30 readings over 60 minutes to detect changes in fluorescence intensity in the system.
[0074] Result determination: If, within the same detection time, the mean fluorescence intensity value of the test sample detection system is significantly different from the mean fluorescence intensity value of the negative control (ddH2O), then the test sample contains or is a candidate for containing Rift Valley fever virus; otherwise, the test sample does not contain or is a candidate for not containing Rift Valley fever virus. III. Preparation of the CRISPR-Cas13a test strip detection system Using primers RVFV-RAA-F2 and RVFV-RAA-R1 from section 3.1 above, the nucleic acid of the test sample was amplified using RAA to obtain the RAA amplification product; Take 5 μL of the RAA amplification product obtained above as a template and prepare the CRISPR-Cas13a detection system according to Table 9 below.
[0075] The negative control is to replace the RAA product in Table 9 with ddH2O while keeping other reagent components unchanged.
[0076] Table 9. CRISPR-Cas13a test strip detection system
[0077] Cap the reaction tube containing the reaction system shown in Table 9, invert it 5-6 times to mix, and centrifuge at low speed for 10 seconds. Place the reaction tube at 37°C for 30 minutes. After the reaction is complete, add the entire reaction system (50 μL) to the sample well of the CRISPR test paper.
[0078] Result Interpretation: After the reaction system is applied to the test strip, the results should be interpreted 2-5 minutes later. If no "T" line appears on the test strip but a "C" line does, the sample contains or is a candidate for Rift Valley fever virus. If both a "T" line and a "C" line appear on the test strip, the sample does not contain or is a candidate for Rift Valley fever virus. If no "C" line appears on the test strip, the test strip is invalid and needs to be replaced and the experiment repeated.
[0079] (III) Optimization of the conditions for detecting Rift Valley fever virus nucleic acid based on the CRISPR-Cas13a system I. Screening of Optimal RAA Primers and Optimal crRNA 1. The diluted concentration prepared using (I) is 10. 1 Using a plasmid standard of copies / μL as a template, plasmid PCR amplification was performed using the method described in Table 6 of Section I in (II) above to obtain the plasmid PCR amplification product.
[0080] Take 5 μL of the PCR amplification product of the above plasmid, and perform fluorescence detection using the method in Table 7 of Section 1 of (II) and the five types of crRNA prepared in Section 1 of (I). The results are as follows. Figure 1 , Figure 2 As shown.
[0081] Figure 1 The fluorescence of crRNA4 showed the fastest rate of increase.
[0082] Figure 2As shown: After 60 minutes of the 30th cycle, all five crRNA groups showed significant differences from the negative control group. The fluorescence values of crRNA1 (4473.33±89.64 RFU), crRNA2 (4066±46.25 RFU), crRNA3 (3447.33±43.27 RFU), crRNA4 (7432±344.53 RFU), and crRNA5 (3581.67±22.02 RFU) were significantly higher than those of the other four crRNA groups and the negative control group. Therefore, crRNA4 was selected as the initial screening crRNA for the next step of the experiment.
[0083] 2. The diluted concentration prepared using (I) is 10. 1 Using a plasmid standard of copies / μL as a template, the upstream and downstream primers of RAA were combined in pairs (F1R1, F1R2, F1R3, F2R1, F2R2, F2R3, F3R1, F3R2, F3R3) and amplified according to the method in Table 5 of Section 3 in (I).
[0084] Take 5 μL of the amplified product and perform fluorescence detection according to the method in Table 8 of section (II). The crRNA is RVFV-crRNA4. The results are as follows. Figure 3 As shown.
[0085] Figure 3 As shown: In the three repeated experiments, the first, second and third times all showed high fluorescence values of F2R1. Based on the results of the three experiments, F2R1 was selected as the RAA primer for initial screening and further experiments were carried out.
[0086] 3. The diluted concentration prepared using (I) is 10. 1 Using a plasmid standard of copies / μL as a template, the RAA primer F2R1 selected from the initial screening was amplified according to the method in Table 5 of Section 3 of Part I.
[0087] Take 5 μL of the amplified product and the five crRNAs prepared in (I) 1, and perform fluorescence detection according to the method in Table 8 of (II). The results are as follows. Figure 4 , Figure 5 As shown.
[0088] Figure 4 The results showed that crRNA4 exhibited the fastest fluorescence rise rate and the highest fluorescence value.
[0089] Figure 5The results showed that, after comparing the fluorescence values of the 30th cycle, the fluorescence values of crRNA1 (15229.33±1286.47 RFU), crRNA2 (22620±692.47 RFU), crRNA3 (21995±313.08 RFU), crRNA4 (29249.33±1062.44 RFU), and crRNA5 (23572±1404.63 RFU) were significantly higher than those of the other four crRNA groups and the negative control group. Therefore, crRNA4 was selected as the optimal crRNA for the next step of the experiment.
[0090] Example 2: Sensitivity detection of Rift Valley fever virus nucleic acid based on CRISPR-Cas13a system.
[0091] Using serially diluted plasmid standards as templates, plasmids containing different concentrations of the RVFV gene fragment were detected according to the method in Example 1 to test the sensitivity of the method of the present invention. The specific steps are as follows: 1. The plasmid standard obtained in step (a) of Example 1 was serially diluted with water to obtain plasmid solutions containing different concentrations of RVFV gene fragments: 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 copy / μL, 10 -1 copies / μL.
[0092] 2. Perform RAA amplification according to the method in step (I) of Example 1, using RVFV-RAA-F2 and RVFV-RAA-R1 (optimal primers) to obtain RAA amplification products.
[0093] 3. CRISPR fluorescence detection: Take 5 μL of the LRAA amplification product and detect Rift Valley fever virus nucleic acid using the CRISPR-Cas13a fluorescence system according to step (II) of Example 1. Simultaneously, use the amplification product with water as a template as a negative control. The crRNA is RVFV-crRNA4 (optimal crRNA). The CRISPR-Cas13a detection results are as follows... Figure 6 , Figure 7 As shown.
[0094] Figure 6 The graph shows the detection curves of conserved RVFV sequences at different concentrations using the optimal RAA primer combination and the optimal crRNA CRISPR-Cas13a.
[0095] Figure 7 Indicated: Compare the fluorescence value at the 30th cycle, 10 4 -10 0 Compared with the negative control, the fluorescence intensity of the samples was significantly different, indicating that the CRISPR-Cas13a detection system of the present invention has a sensitivity of 1 copy (10 copies / μL) for detecting RVFV nucleic acid.
[0096] 4. CRISPR test strip detection The plasmid standard obtained in step (a) of Example 1 was serially diluted with water to obtain plasmid solutions containing different concentrations of RVFV gene fragments: 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 copy / μL, 10 -1 copies / μL.
[0097] RAA amplification was performed according to the method in step (I) of Example 1, using primers RVFV-RAA-F2 and RVFV-RAA-R1 (optimal primers), to obtain RAA amplification products.
[0098] Take 5 μL of RAA amplification product and detect RVFV nucleic acid using the CRISPR-Cas13a system according to step (II) of Example 1. Simultaneously, use ddH2O as a template for the amplification product as a negative control. The crRNA is RVFV-crRNA4. The RAA-CRISPR test strip results are as follows: Figure 8 As shown.
[0099] Figure 8 Indication: When using RVFV-crRNA4 to detect RVFV nucleic acid, at 10 4 -10 0 The "T" line disappears and the "C" line appears in the copies / μL group, 10 -1 Both copies / μL and the T and C lines were visible in the negative control group, therefore, 10 were determined to be positive. 4 -10 0 The copies / μL group was positive, 10 -1 The RAA-CRISPR test strip showed a sensitivity of 1 copy (μL) for detecting RVFV nucleic acid, with the negative control group being negative.
[0100] Example 3: Specific detection of Rift Valley fever virus nucleic acid based on CRISPR-Cas13a system The nucleic acids of seven viruses—RVFV (Rift Valley fever virus), YFV (yellow fever virus), DENV I (dengue virus type I), DENV II (dengue virus type II), DENV III (dengue virus type III), DENV IV (dengue virus type IV), and ZIKV (Zika virus)—were detected according to the method in Example 1 (II) to verify the specificity of the method of the present invention. The specific steps are as follows: 1. Each in 10 2 Nucleic acids from seven viruses—RVFV (Chikungunya virus), YFV (Yellow Fever virus), DENV I (Dengue virus type I), DENV II (Dengue virus type II), DENV III (Dengue virus type III), DENV IV (Dengue virus type IV), and ZIKV (Zika virus)—were amplified using the RAA method described in step (I) of Example 1, yielding RAA amplification products. Primers RVFV-RAA-F2 and RVFV-RAA-R1 were used.
[0101] 2. Take 5 μL of RAA amplification product and detect RVFV nucleic acid using the CRISPR-Cas13a system according to step (II) of Example 1. Simultaneously, use the amplification product with ddH2O as a template as a negative control. The crRNA is RVFV-crRNA4. The CRISPR-Cas13a detection results are as follows: Figure 9 , Figure 10 and Figure 11 show Figure 9 As shown: When using RVFV-crRNA4 to detect different viral nucleic acids, only the RVFV group showed the disappearance of the "T" line and the appearance of the "C" line, while the other groups and the negative control group showed both the "T" line and the "C" line.
[0102] Figure 10 The experiment was repeated three times, with 7 different viral nucleic acids and ddH2O as negative templates used as control experiments. RVFV showed obvious curves and fluorescence kinetic values.
[0103] Figure 11 As shown: when comparing the fluorescence values of the 30th cycle, the fluorescence intensity of the seven different viruses showed significant statistical differences compared with the negative control.
[0104] comprehensive Figure 9 , Figure 10 and Figure 11As a result, the method for detecting Rift Valley fever virus sites based on the CRISPR-Cas13a system of the present invention has high specificity and no cross-reaction occurs during the detection process.
[0105] The sequence involved in this invention, SEQ ID NO.1, is the RVFV-crRNA4 target sequence: agaattcccataccgagtcggacttgga; The sequence SEQ ID NO.2 is RVFV-gRNA4: GGGATTTAGACTACCCCAAAAACGAAGGGGACTAAAACtccaagtccgactcggtatgggaattct; SEQ ID NO.3 is the conserved sequence of Rift Valley fever virus: atcaagtatatcatggattactttcctgtgatatctgttgatttgcagagtggtcgtcgtgttgtgtcagtggagtacattagaggtgatggtcctcccaggataccttattctatggttgggccctgttgtgtctttctcatgcaccatcgtcctag tcacgaggttcgcttgcgattctctgatttctacaatgtcggagaattcccataccgagtcggacttggagactttgcatcaaacgttgcacctccaccagcaaagccttttcagagacttattgatctaAtaggccatatgactcttagtgatttcacaaggttccccaatct; The sequence SEQ ID NO.4 is RVFV-RAA-F2: AATTCTAATACGACTCACTATAGGGctgttgatttgcagagtggtcgtcgtgttg; The sequence SEQ ID NO.5 is RVFV-RAA-R1:agattggggaaccttgtgaaatcactaaga.
[0106] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the technical principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
[0107] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. A crRNA target for detecting Rift Valley fever virus, characterized in that, The target sequence of the Rift Valley fever virus is SEQ ID NO.
1.
2. A CRISPR-Cas13a system for detecting Rift Valley fever virus, characterized in that, The CRISPR-Cas13a system includes the Cas13a protein and crRNA, or a complex of the two; the crRNA includes an anchoring sequence for binding to the Cas13a protein and a guide sequence for targeting Rift Valley fever virus; the Rift Valley fever virus target sequence is shown in SEQ ID NO.
1.
3. The CRISPR-Cas13a system according to claim 2, characterized in that: The crRNA sequence is shown in SEQ ID NO.
2.
4. The CRISPR-Cas13a system according to claim 2 or 3, characterized in that: The Cas13a protein is the LwCas13a protein.
5. A kit for detecting Rift Valley fever virus, comprising the CRISPR-Cas13a system for detecting Rift Valley fever virus as described in any one of claims 2-4.
6. The reagent kit according to claim 5, characterized in that: The kit also includes RAA amplification primers for specifically amplifying the target sequence of Rift Valley fever virus; the RAA amplification primers consist of single-stranded DNA molecules shown in SEQ ID NO.4 and SEQ ID NO.
5.
7. Any of the following substances: A1) The crRNA as described in any one of claims 2-4; A2) The Cas13a protein and crRNA as described in any one of claims 2-4, or a complex thereof; A3) The primer pair as described in claim 6.
8. Any of the following applications: B1) The use of the CRISPR-Cas13a system according to any one of claims 2-4, the kit according to claim 5 or 6, or the substance according to claim 7 in the detection or auxiliary detection of Rift Valley fever virus or its nucleic acid; B2) The use of the CRISPR-Cas13a system according to any one of claims 2-4, the kit according to claim 5 or 6, or the substance according to claim 7 in the preparation of products for detecting or assisting in the detection of Rift Valley fever virus or its nucleic acid; B3) The use of the CRISPR-Cas13a system of any one of claims 2-4, the kit of claim 5 or 6, or the substance of claim 7 in detecting or assisting in the detection of whether a sample contains Rift Valley fever virus or its nucleic acid; B4) The use of the CRISPR-Cas13a system of any one of claims 2-4, the kit of claim 5 or 6, or the substance of claim 7 in the preparation of products for detecting or assisting in the detection of whether a sample to be tested contains Rift Valley fever virus or its nucleic acid; B5) The use of the CRISPR-Cas13a system according to any one of claims 2-4, the kit according to claim 5 or 6, or the substance according to claim 7 in screening or assisting in screening drugs for the prevention and treatment of Rift Valley fever virus; B6) The use of the CRISPR-Cas13a system according to any one of claims 2-4, the kit according to claim 5 or 6, or the substance according to claim 7 in the preparation of products for screening or assisting in screening drugs for the prevention and treatment of Rift Valley fever virus; B7) Use of the substance of claim 7 in the preparation of the kit of claim 5 or 6.
9. A method for detecting or assisting in the detection of Rift Valley fever virus, comprising the following steps: C1) Using the nucleic acid of the sample to be tested as a template, RAA amplification was performed using a primer pair consisting of single-stranded DNA molecules shown in SEQ ID NO.4 and single-stranded DNA molecules shown in SEQ ID NO.5 to obtain RAA products; C2) Prepare a CRISPR-Cas13a detection system containing the following components: the RAA product, the Cas13a protein as described in any one of claims 2-4, the crRNA as described in any one of claims 2-4, reporter RNA, NTP, T7 RNA polymerase, and RNase inhibitor; water is used instead of the PCR product as a negative control. C3) The CRISPR-Cas13a detection system is reacted, and the reaction products are detected to determine whether the sample to be tested contains Rift Valley fever virus.
10. The method according to claim 9, characterized in that: In step C1), the reaction conditions for RAA amplification are: reaction at 42°C for 30 minutes.