Associated faecalis and application thereof

Abstract

The invention relates to associated faecalis and application thereof, the associated faecalis is preserved in Guangdong Microbial Culture Collection Center on November 10, 2025, and the preservation number is GDMCC No: 67255. The strain is high in self-aggregation capability, beneficial to adhesion to intestinal tracts and high in customization capability; the strain shows a good safety characteristic and has relatively strong gastrointestinal tract environment adaptability; the strain has remarkable antioxidant activity; the strain can generate gamma-aminobutyric acid, is helpful for improving the metabolic state of a host and regulating the neurological function, and has the probiotic effects of regulating lipid, resisting inflammation and improving the metabolic state of the host, namely improving sleep; besides, the bile salt hydrolase of the strain is remarkable in activity, contributes to bile acid metabolism and promotion of cholesterol excretion, has the effects of reducing and regulating blood fat, and can improve obesity, hyperglycemia, hyperlipidemia and non-alcoholic fatty liver disease.

Description

Technical Field

[0001] This application relates to the field of microbial technology, and in particular to a strain of coccidia and its application. Background Technology

[0002] Microorganisms are widely distributed in various microenvironments of the human body, including the skin, mouth, respiratory tract, and gastrointestinal tract, playing a vital role in maintaining host health and homeostasis. Probiotics are live microorganisms that, when ingested in adequate amounts, can provide health benefits to the host. Currently, most probiotic research focuses on classic species such as Lactobacillus and Bifidobacterium; however, the human gut microbiota is rich in diversity and ecologically complex, and many potentially valuable probiotics remain unexplored and unutilized. With the deepening research into gut health and metabolic diseases, functional probiotics have become a current research hotspot.

[0003] Coprococcus These bacteria are typical butyrate-producing bacteria, but currently, they have been successfully cultured, their safety verified, and their systemic functional evaluated. Coprococcus comes The extremely limited number of strains restricts their application in the food, health, and pharmaceutical fields.

[0004] Bile salt hydrolase (BSH) is a key enzyme produced by intestinal microorganisms. Its main function is to hydrolyze the glycine or taurine portion of bile acids, converting them into free bile acids. It plays an important role in lipid metabolism, cholesterol homeostasis regulation, and host-microbe interactions, and is associated with metabolic diseases such as obesity and diabetes. Strains possessing high bile salt hydrolase activity can play a positive role in the prevention and treatment of hyperlipidemia and related metabolic diseases. No *Faecalibacterium* strains with exceptionally high bile salt hydrolase activity have yet been identified.

[0005] Gamma-aminobutyric acid (GABA) is an important inhibitory neurotransmitter widely found in vertebrates, plants, and microorganisms. It has effects such as lowering blood pressure, improving sleep, improving liver, kidney, and brain function, enhancing food flavor, moisturizing skin, and anti-oxidation. It is also a precursor to nylon-4 and is widely used in the food, pharmaceutical, and cosmetic industries. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of the prior art and provide a strain of coccidia and its applications. The first objective of this invention is to provide a strain of concomitant cocci.

[0007] A second objective of this invention is to provide the application of the aforementioned associated coccidia in the preparation of antioxidant microbial agents.

[0008] A third objective of this invention is to provide the application of the aforementioned associated cocci in the preparation of bacterial agents for the synthesis of γ-aminobutyric acid.

[0009] A fourth object of the present invention is to provide the use of the aforementioned associated cocci in the synthesis of γ-aminobutyric acid.

[0010] A fifth objective of this invention is to provide the use of the aforementioned concomitant cocci in the preparation of microbial agents that improve metabolic status or sleep.

[0011] A sixth object of the present invention is to provide the use of the aforementioned associated fecal cocci in the preparation of a bacterial agent with bile salt hydrolase activity.

[0012] A seventh object of the present invention is to provide the use of the aforementioned concomitant cocci in the preparation of a bacterial agent for improving obesity, hyperglycemia, hyperlipidemia, or non-alcoholic fatty liver disease.

[0013] An eighth object of the present invention is to provide the use of the aforementioned associated cocci in the preparation of microbial agents with anti-inflammatory activity.

[0014] A ninth object of the present invention is to provide the application of the culture medium of the aforementioned concomitant cocci in products with anti-inflammatory activity. To achieve the above objectives, the present invention is implemented through the following technical solution: This invention claims protection for a strain of *Concomitant cocci* (… Coprococcus comes HQY061 was deposited on November 10, 2025, at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC No: 67255, at the address of 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0015] This invention also claims protection for the following applications: The application of the aforementioned associated fecal cocci in the preparation of antioxidant bacterial agents.

[0016] The application of the aforementioned associated fecal cocci in the preparation of bacterial agents for the synthesis of γ-aminobutyric acid.

[0017] The application of the aforementioned associated fecal cocci in the synthesis of γ-aminobutyric acid.

[0018] The application of the aforementioned coexisting fecal cocci in the preparation of microbial agents that improve metabolism or sleep.

[0019] The application of the aforementioned associated fecal cocci in the preparation of bacterial agents with bile salt hydrolase activity.

[0020] The application of the aforementioned concomitant fecal cocci in the preparation of bacterial agents for improving obesity, hyperglycemia, hyperlipidemia, or non-alcoholic fatty liver disease.

[0021] The application of the aforementioned associated fecal cocci in the preparation of bacterial agents with anti-inflammatory activity.

[0022] Preferably, the bacterial agent is a drug or a probiotic solid beverage.

[0023] Preferably, the microbial agent contains appropriate excipients.

[0024] This invention claims protection for the use of the culture medium of the associated fecal cocci in products with anti-inflammatory activity, wherein the culture medium may or may not contain the associated fecal cocci.

[0025] Compared with the prior art, the present invention has the following beneficial effects: This invention isolates and purifies a strain of *Concomitant Fecal Entella* with multiple biological activities from the feces of healthy adolescents. This strain exhibits high self-aggregation ability, facilitating intestinal adhesion and strong customization; it demonstrates good safety characteristics and strong adaptability to the gastrointestinal environment (showing strong tolerance to acidic pH, bile salts, hypertonic conditions, and simulated gastrointestinal fluids); it possesses significant antioxidant activity; it produces γ-aminobutyric acid (GABA), which helps improve host metabolic status and regulate nerve function, exhibiting probiotic effects such as lipid regulation, anti-inflammation, and improved host metabolic status (i.e., improved sleep); furthermore, this strain has significant bile salt hydrolase (BSH) activity, which aids in bile acid metabolism and promotes cholesterol excretion, exhibiting lipid-lowering and lipid-regulating effects, and can improve obesity, hyperglycemia, hyperlipidemia, and non-alcoholic fatty liver disease. Attached Figure Description

[0026] Figure 1 The images show colony diagrams and Gram staining of the associated fecal cocci HQY061 on an agar plate.

[0027] Figure 2 The complete genome sequence of the associated fecal cocci is shown.

[0028] Figure 3 Phylogenetic tree constructed for the whole genome of the associated fecal cocci HQY061.

[0029] Figure 4 The results show that the associated fecal cocci HQY061 does not hemolyze and that positive strains exhibit hemolysis.

[0030] Figure 5 A represents the probiotic properties of the associated fecal cocci HQY061; A represents the OD at different temperatures. 600 B represents the viable bacterial concentration at different pH levels; C represents the viable bacterial concentration at different NaCl concentrations; D represents the survival rate in simulated gastric fluid at different pH levels; E represents the survival rate in simulated intestinal fluid at different pH levels; F represents the survival rate at different bile salt concentrations; G represents the strain's self-aggregation ability; H represents the DPPH free radical scavenging rate.

[0031] Figure 6 The yield of γ-aminobutyric acid from the associated fecal cocci HQY061.

[0032] Figure 7 To assess the anti-inflammatory activity of the associated fecal cocci HQY061. Detailed Implementation

[0033] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; the materials and reagents used, unless otherwise specified, are commercially available.

[0034] Example 1: Isolation, screening, and identification of associated fecal cocci HQY061 I. Experimental Methods (1) Isolation and screening of associated fecal cocci HQY061 Collect fecal samples from healthy adolescents and add them to sterile saline solution (the sterile saline solution was pre-treated in an anaerobic environment for 24 hours, the same below) to prepare the stock solution. Add 500 μL of the stock solution to 3.5 mL of sterile saline solution and vortex to prepare 10... -1 Diluent; repeat the same procedure until diluted to 10. -2 10 -3 10 -4 10 -5 Dilution gradient: Take 100 μL of each dilution and spread it evenly on anaerobic GAM agar plates using a spreader. Place the plates under strictly anaerobic conditions (80% N2, 10% H2, 10% CO2, the same below) and incubate at 37°C for 24 h.

[0035] On plates with colony counts between 30 and 300, observe the morphology of the strains under an oil immersion optical microscope and select colonies with the following characteristics (characteristic colonies): tiny (~1 mm), round, raised, smooth, opaque, grayish-white colonies with a creamy texture.

[0036] Using a sterile inoculation loop, a portion of the characteristic colony was picked and Gram-stained. The associated fecal cocci were Gram-positive, so the pure, Gram-positive colonies were retained.

[0037] The obtained pure colonies that were Gram-positive were picked up with a sterile inoculation loop and streaked onto GAM agar plates for purification. The colonies were then anaerobically cultured at 37°C for 48 h.

[0038] A single colony of HQY061 was obtained. A single colony was picked and expanded in GAM liquid medium at an inoculum size of 5%, and cultured anaerobically overnight at 37°C. The overnight culture was then transferred to sterile anaerobic cryovials containing cryoprotectant and stored at -80°C.

[0039] (2) Identification of HQY061 strain Genomic DNA was extracted from strain HQY061 using a bacterial genome extraction kit. The upstream primer was 27F (AGAGTTTGATCCTGGCTCAG), and the downstream primer was 1492R (TACGGCTACCTTGTTACGACTT). The 16S rDNA sequence was amplified to obtain PCR products. The PCR products were then sequenced.

[0040] The PCR reaction system consisted of: 20 μL PCR Mix, 0.8 μL each of upstream and downstream primers, 2 μL DNA template, and 16.4 μL ddH2O.

[0041] The PCR reaction conditions were: 96℃ for 5 min; 96℃ for 30 s, 56℃ for 30 s, 72℃ for 1 min, 35 cycles; 72℃ for 5 min.

[0042] The PCR products were analyzed using 1.0% agarose gel electrophoresis to observe the banding characteristics. The PCR products were then sent to Sangon Biotech Co., Ltd. for sequencing.

[0043] The HQY061 bacterial precipitate was sent to Shenzhen Egene Co., Ltd. for whole genome sequencing.

[0044] The 16S rDNA sequence of strain HQY061 was obtained by sequencing, and its species was preliminarily identified by NCBI-BLAST alignment. The whole genome sequences of other strains of this strain were downloaded from the NCBI database. First, single-copy genes of all strains were identified using GTDB-TK, then multiple sequence alignment was performed, and a phylogenetic tree was constructed using Fasttree software. The phylogenetic tree branches of the seven most closely related *Concomitant cocci* strains were then magnified.

[0045] II. Experimental Results After anaerobic culture, this strain forms tiny, smooth, grayish-white raised colonies on GAM plates. Figure 1 A). Gram staining and microscopic examination confirmed it to be Gram-positive cocci, mostly arranged in pairs or short chains (A). Figure 1 (B) The colony morphology and Gram staining are similar to those in the text. Coprococcus comes The results were consistent. Sequencing yielded the 16S rDNA sequence of strain HQY061, which, through NCBI-BLAST alignment, was preliminarily identified as *Aspergillus faecalis*. Whole-genome sequencing results showed that the entire genome of *Aspergillus faecalis* HQY061 consists of a single circular chromosome and lacks plasmids. Figure 2 Phylogenetic tree analysis showed that HQY061 was located on the basal branch of the core gene tree, alongside other genes. C comes The formation of distinct, independent branches indicates that it possesses certain phylogenetic differentiation characteristics. HQY061 is its closest type strain. C comes The average nucleotide identity (ANI) of ATCC27758 was 98.18%. Figure 3 ).

[0046] Therefore, the obtained strain HQY061 was named *Concomitant Fecal Oxygenae* (Factococcus faecium). Coprococcus comes HQY061 was deposited on November 10, 2025, at the Guangdong Provincial Microbial Culture Collection Center (GDMCC), with accession number GDMCC No: 67255, at the address of 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0047] Example 2: Antibiotic resistance assessment of associated fecal cocci HQY061 I. Experimental Methods The associated fecal cocci obtained in Example 1 was activated and cultured in GAM broth at 37°C for 12 h, and the bacterial suspension was diluted to approximately 6 × 10⁻⁶. 5 CFU / mL (using GAM broth that has been anaerobic for 24 hours prior). 50 μL of bacterial suspension was added to each well and inoculated into 96-well plates containing different antibiotic gradients. After 48 hours of incubation, turbidity was measured at 600 nm in each well. The minimum inhibitory concentration (MIC) was defined as the lowest antibiotic concentration required to completely inhibit the visible growth of *Concomitant fecal cocci* HQY061. All experiments were performed in triplicate. MIC determination was based on the safety thresholds recommended by the EFSA (European Food Safety Authority).

[0048] This embodiment selects the following commonly used antibiotics for antibiotic resistance analysis: Gentamicin, kanamycin, streptomycin, clindamycin, vancomycin, ampicillin, erythromycin, chloramphenicol, and tetracycline.

[0049] The Resistance Gene Identifier (RGI, Version 6.0.0), Comprehensive Antibiotic Resistance Database (CARD, Version 4.0.0), ResFinder (Version 4.0), and AMRFinderPlus (Version 3.10.42) were used to search for antibiotic resistance genes in whole-genome sequencing data.

[0050] II. Experimental Results Genomic analysis revealed only one suspected tetracycline resistance gene in HQY061. Resistance results are shown in Table 1. The results indicate that the associated cocci HQY061 obtained in Example 1 exhibited minimum inhibitory concentrations (MICs) below the safety limits set by the European Food Safety Authority (2012) for all tested antibiotics, including tetracycline.

[0051] Table 1: Drug resistance of associated fecal cocci HQY061

[0052] Plasmids are mobile extrachromosomal genetic elements in bacteria that mediate the rapid horizontal transfer of drug resistance genes between different bacteria. In this case, whole-genome sequencing revealed no plasmids in the strain's genome, suggesting that its drug resistance genes are likely located on the chromosome. Since chromosomal gene transfer is far less frequent than plasmid-mediated transfer, this significantly reduces the risk of the strain's drug resistance spreading to other strains.

[0053] Based on comprehensive genomic and phenotypic data, HQY061 meets the requirements for probiotic use in terms of antibiotic safety.

[0054] Example 3: Detection of hemolytic and virulence factors of associated fecal cocci HQY061 I. Experimental Methods If bacteria produce hemolysin during their metabolism, it can dissolve red blood cells, leading to diseases such as anemia. Therefore, it is necessary to confirm that the associated fecal cocci HQY061 does not exhibit hemolysis; virulence factors play an important role in bacterial colonization, immune evasion, and pathogenesis.

[0055] The associated fecal cocci HQY061 obtained in Example 1 was revived in GAM medium and anaerobically cultured at 37°C for 16 hours. Using Staphylococcus aureus ATCC12598 as a positive control, the associated fecal cocci HQY061 and Staphylococcus aureus ATCC12598 obtained in Example 1 were inoculated onto Columbia blood agar plates using inoculation loops and anaerobically cultured at 37°C for 24 hours. After confirming the absence of contamination, the morphology of each colony was observed and photographed to confirm the presence or absence of hemolytic zones.

[0056] The genome sequence of the associated cocci HQY061 obtained in Example 1 was submitted to the VFDB database to retrieve the virulence genes it carries.

[0057] II. Experimental Results Hemolysis test results as follows Figure 4 As shown, when the positive control strain Staphylococcus aureus ATCC12598 was inoculated onto Columbia blood agar plates, it formed a hemolytic ring, which could completely lyse red blood cells, indicating β-hemolysis. The associated fecal cocci HQY061 obtained in Example 1 grew milky white colonies, and no hemolytic zone was observed, indicating that the associated fecal cocci HQY061 obtained in Example 1 has no ability to damage blood cells.

[0058] Comparison with the VFDB database showed that the HQY061 genome does not contain any virulence-related genes or hemolysin homologs.

[0059] In summary, the associated fecal cocci HQY061 obtained in Example 1 does not have potential pathogenicity and has the safety of a probiotic.

[0060] Example 4: Environmental tolerance (susceptibility) of associated fecal cocci HQY061 I. Temperature tolerance (sensitivity) 1. Experimental Methods One mL of activated *Concomitant cocci* HQY061 bacterial suspension obtained in Example 1 was inoculated into 19 mL of GAM liquid medium and anaerobically cultured at 4, 15, 30, 37, and 45 °C for 24 hours. The OD values ​​were measured using a microplate reader. 600 The absorbance at a certain temperature was measured to investigate the growth of bacteria at different temperatures.

[0061] 2. Experimental Results The results are as follows Figure 5 As shown in Figure A, the *H. coli* HQY061 obtained in Example 1 grew best at 37 °C (OD600 = 0.71 ± 0.01). Growth was poor at 4, 15, 30, and 45 °C, indicating that its optimal growth temperature is close to human body temperature.

[0062] II. pH tolerance (sensitivity) 1. Experimental Methods One mL of activated *H. coli* HQY061, the bacterial suspension obtained in Example 1, was placed in 19 mL of GAM liquid medium at pH values ​​of 2.0, 3.0, 5.0, 7.0, and without adjustment. After anaerobic incubation at 37°C for 24 hours, the number of surviving bacteria was measured using a microbial cell counter.

[0063] 2. Experimental Results In the pH tolerance test, unadjusted GAM liquid medium was used as the control group. Results are as follows: Figure 5As shown in B, the results indicate that when the pH drops to 5.0, the number of viable bacteria in HQY061 (7.85 ± 0.03) log CFU / mL decreases compared to the control group, but the survival rate is still high. In the strongly acidic environment of pH 2.0, although its growth is significantly inhibited, the number of viable bacteria after 24 hours can still reach (7.20 ± 0.20) log CFU / mL.

[0064] Therefore, it can be seen that the associated fecal cocci HQY061 obtained in Example 1 has strong acid resistance and can survive in the gastrointestinal environment and play the role of probiotics.

[0065] III. NaCl concentration tolerance (sensitivity) 1. Experimental Methods The activated *Concomitant Fecal Cholecystis* HQY061 bacterial suspension obtained in Example 1 was centrifuged at 8000 rpm and 4°C for 10 min. The supernatant was discarded, and the bacterial pellet was collected. The pellet was washed twice with sterile, anaerobic PBS and resuspended to a final volume of 1.0 × 10⁻⁶. 8 CFU / mL. 1 mL of the resuspension was inoculated into 19 mL of GAM liquid medium containing 0–10% NaCl (w / v). After incubation at 37°C for 24 hours, the number of surviving bacteria was determined using a microbial cell counter.

[0066] 2. Experimental Results The results are as follows Figure 5 The C value in the figure shows that after culturing the associated fecal cocci HQY061 obtained in Example 1 in GAM broth containing different concentrations of NaCl for 24 hours, the highest survival count of the associated fecal cocci HQY061 obtained in Example 1 was observed in the 0.3% NaCl group, reaching (9.05 ± 0.01) log CFU / mL.

[0067] As can be seen, the survival count of *F. coli* HQY061 gradually decreased with increasing NaCl concentration. However, even under 10% NaCl conditions, the survival count of *F. coli* HQY061 obtained in Example 1 remained at (7.00 ± 0.10) lg CFU / mL. The results show that the associated fecal cocci obtained in Example 1 has significant salt tolerance and can maintain its activity under high osmotic pressure, indicating that it is very suitable for survival in salt-rich environments such as fermented foods and the gastrointestinal tract.

[0068] Example 5: Tolerance assessment of the digestive tract associated with *Faecalibacterium falciparum* HQY061 I. Experimental Methods 1. Processing of gastric and intestinal fluids The pH value of human gastric juice is between 1.5 and 2.0, and it can usually reach 3.0 to 4.0 after being diluted by food. Therefore, the tolerance of artificial gastric juice (SGF) is assessed using pH=2.0, 3.0 and 4.0.

[0069] Simulated gastric juice (SGF) was prepared by dissolving 3 mg of pepsin in 1 mL of 0.5% physiological saline (w / v) at pH values ​​of 2.0, 3.0, and 4.0.

[0070] Simulated intestinal fluid (SIF) was prepared by dissolving 1 mg / mL trypsin in a phosphate buffer solution at pH 8.0. The solution was filtered through a 0.22 μm filter.

[0071] The activated fecal cocci obtained in Example 1 were added to SGF or SIF at a 5% inoculum, mixed for 60 seconds, and then anaerobically incubated at 37°C for 2 hours and 4 hours, respectively. The culture medium was then collected.

[0072] 2. Bile salt treatment Bile salts are sodium or potassium salts formed by the combination of bile acids secreted by hepatocytes and glycine or taurine. To assess the tolerance of *Faecalibacterium cladocarba* HQY061 obtained in Example 1 to different concentrations of bile salts, 1 mL of *Faecalibacterium cladocarba* HQY061 bacterial culture was inoculated into 19 mL of GAM liquid medium containing 0.1%, 0.2%, 0.3%, 0.4%, and 0.5% (w / v) bile salts. The cultures were incubated at 37 °C for 24 hours.

[0073] 3. Detection of surviving bacteria After each experiment, a microbial cell counter was used to measure the surviving bacteria and calculate the survival rate (%). Survival rate (%) = (N...) Final / N Initial ) ×100%.

[0074] II. Experimental Results The results are as follows Figure 5 As shown in Figure D, after incubating the associated fecal cocci HQY061 obtained in Example 1 with simulated gastric juice (SGF) for 2 hours, the survival rates in SGF at pH 4.0 and 3.0 were 96.71 ± 1.86% and 94.46 ± 1.40%, respectively; after incubation for 4 hours, the survival rates in SGF at pH 4.0 and pH 3.0 were 81.66 ± 2.94% and 88.23 ± 3.34%, respectively. Furthermore, in the highly acidic pH 2.0 SGF, the survival rates after 2 hours and 4 hours still reached 57.75 ± 2.25% and 44.65 ± 2.28%, respectively.

[0075] The results are as follows Figure 5 As shown in E, in the simulated intestinal fluid tolerance test, the survival rate of HQY061 in SIF remained between 86% and 109%, without a significant decrease, indicating that this strain can adapt well to the weakly alkaline environment of the intestine and has the ability to resist intestinal enzymatic digestion.

[0076] Results of bile salt tolerance, such as Figure 5 As shown in F, the survival rates of *Aspergillus faecalis* HQY061 after 4 hours in GAM liquid medium supplemented with 0.1%, 0.2%, 0.3%, 0.4%, and 0.5% bile salts were 60.07 ± 8.59%, 55.45 ± 1.74%, 48.72 ± 8.52%, 49.01 ± 2.71%, and 51.03 ± 3.40%, respectively. Compared with the initial values ​​at 0 hours, *Aspergillus faecalis* in all treatment groups showed good tolerance, indicating its strong bile salt tolerance and ability to adapt to adversity.

[0077] Example 6: Self-aggregation ability of associated fecal cocci HQY061 I. Experimental Methods The ability of probiotics to self-aggregate and co-aggregate reflects their ability to stably colonize the gut and exert their effects.

[0078] The PBS suspension of *Concomitant Fecal Species* HQY061 obtained in Example 1 was adjusted to OD600=1.0, dispensed into test tubes, vortexed for 30 s, and then anaerobically incubated at 37 ℃ for 24 hours. The supernatant was collected at 0, 2, 4, 6, 8, and 24 hours, and its absorbance was measured at 600 nm to test its self-aggregation ability.

[0079] Aggregation rate (%) = (1 - real-time OD) 600 / Initial OD 600 ) × 100% II. Experimental Results The results are as follows Figure 5 As shown in G, in the self-aggregation experiment, the self-aggregation rate of the associated fecal cocci HQY061 obtained in Example 1 reached 16.94 ± 0.50% in 2 hours, 59.44 ± 3.38% in 6 hours, and then slowly increased, finally reaching 81.29 ± 1.18% in 24 hours.

[0080] It is evident that the associated fecal cocci HQY061 obtained in Example 1 exhibits outstanding self-aggregation ability, strong adhesion, and the ability to stably colonize in the intestine.

[0081] Example 7 Antioxidant capacity of associated cocci HQY061 I. Experimental Methods The antioxidant activity of *Concomitant cocci* HQY061 obtained in Example 1 was evaluated by assessing its DPPH free radical scavenging ability. The DPPH (1,1-diphenyl-2-picrylhydrazine) used in the experiment is a stable free radical, and its scavenging rate reflects the antioxidant capacity.

[0082] The operation steps are as follows: Prepare a 0.2 mmol / L DPPH ethanol solution (diluted with anhydrous ethanol from a 5 mmol / L DPPH stock solution), store protected from light, and use immediately. The activated fecal cocci from Example 1 were resuspended in PBS, and the concentrations of the resuspensions were adjusted to obtain different concentrations (1×10⁻⁶). 5 1×10 6 1×10 7 and 1×10 8 The samples were taken as follows: 1 mL of the sample (CFU / mL) and its cell-free supernatant (CFS) were mixed with 1 mL of DPPH solution. React at 30°C for 30 minutes under dark conditions; After the reaction was completed, the sample was centrifuged at 8000 rpm for 10 minutes. The supernatant was then measured at a wavelength of 517 nm. The DPPH free radical scavenging rate (%) = [1 - (A1 - A2) / A3] × 100%, where: A1 is the absorbance of the sample + DPPH + ethanol; A2 is the background absorbance of the sample + ethanol (without DPPH); and A3 is the absorbance of the blank control DPPH + ethanol (without sample).

[0083] II. Experimental Results The results are as follows Figure 5 As shown by H in the figure, when the bacterial cell concentration reaches 10... 8 At CFU / mL, its DPPH scavenging rate was 30.61 ± 2.39%. Notably, its cell-free supernatant (CFS) exhibited stronger antioxidant activity, with a scavenging rate of 82.85 ± 2.30%.

[0084] The results show that the associated fecal cocci HQY061 obtained in Example 1 indicates that HQY061 not only has antioxidant capacity in its cells, but its secreted metabolites also have significant antioxidant activity. This suggests that HQY061 may have good potential to resist oxidative damage when passing through the gastrointestinal tract or undergoing food processing.

[0085] Example 8: The ability of associated cocci HQY061 to synthesize γ-aminobutyric acid I. Experimental Methods Gamma-aminobutyric acid (GABA) is an important inhibitory neurotransmitter that has been shown to have multiple physiological functions, including regulating blood pressure, improving sleep, reducing anxiety, and promoting neuroprotection. Its presence in gut microbial metabolites further links it to potential mechanisms of brain-gut axis regulation and host health. The ability of the associated *Faecalibacterium faecalis* HQY061 obtained in Example 1 to produce GABA was tested to evaluate its potential probiotic functions in regulating blood pressure, improving sleep, reducing anxiety, and promoting neuroprotection.

[0086] The specific method is as follows: The *H. coli* HQY061 obtained in Example 1 was inoculated into GAM medium and activated three times consecutively. The seed culture, which was in the logarithmic phase after the third activation, was inoculated into GAM liquid medium at a 5% inoculum and cultured anaerobically at 37°C. At 24 h of culture, 1 mL of fermentation broth was collected. After centrifugation, the supernatant was discarded, and the bacterial cells were resuspended in 1 mL of PBS, lysed, and centrifuged again. The supernatant was filtered through a 0.22 μm filter membrane and used for sample preparation. To eliminate interference from the blank medium, sterilized blank GAM liquid medium was used as a control.

[0087] The cell-free fermentation supernatant of the strain was diluted with ultrapure water at a ratio of 1:10, filtered through a 0.22 μm filter membrane, and 100 μL of the supernatant was transferred to a vial for HPLC detection and analysis.

[0088] HPLC Method: The chromatogram was performed using a U3000 HPLC system equipped with an Athena C18-WP column. The mobile phases were: Phase A, acetonitrile:water (4:1, v / v); Phase B, 0.05 M sodium acetate solution (pH 6.5) containing 3% acetonitrile. The gradient elution program, by volume, was as follows: 0-14 min, A:B linearly changed from 8:92 to 15:85; 14-29 min, A:B changed from 15:85 to 34:66; 29-29.1 min, A:B rapidly recovered to 8:92; 29.1-34 min, column equilibration was performed while maintaining A:B at 8:92. The column temperature was maintained at 40°C, and the detection wavelength was 254 nm.

[0089] II. Experimental Results The results are as follows Figure 6As shown, the γ-aminobutyric acid (GABA) yield of the *Associated Factococcus* strain HQY061 obtained in Example 1 was 376.81 ± 6.45 μg / mL, and GABA was not detected in the blank GAM medium. The results indicate that *Associated Factococcus* strain HQY061 obtained in Example 1 can synthesize and secrete GABA under in vitro conditions. Strain HQY061 has been confirmed to effectively synthesize GABA. This characteristic demonstrates its potential probiotic value in regulating nervous system function, relieving anxiety, and improving sleep, providing an important basis for its development into related functional microbial preparations.

[0090] Example 9: Bile salt hydrolase activity of associated fecal cocci HQY061 I. Experimental Methods Bile salt hydrolase can break down one molecule of glycinecholic acid into one molecule of free bile acid and one molecule of glycine. Bile salt hydrolase activity (BSH) can be assessed by measuring its ability to convert conjugated bile acids into free bile acids. Strain B420, a commercially available strain with lipid-lowering effects, possesses bile salt hydrolase activity and was used as a control.

[0091] The specific method is as follows: The associated fecal cocci HQY061 and the commercially available strain *Bifidobacterium animalis* subsp. *lactamase* B420 obtained in Example 1 were inoculated into GAM medium for three consecutive activations. The seed culture in the logarithmic phase after the third activation was inoculated at a rate of 5% into 19 mL of GAM liquid medium containing sodium glycocholate and cultured at 37°C. Samples were taken at 12 h and 24 h to determine bacterial density and pH. 1 mL of fermentation broth from 0, 12, and 24 h was added to 10 μL of 6 M HCl to terminate BSH activity. The acidified fermentation broth was ultrasonically disrupted, centrifuged, and the supernatant was collected. The supernatant was filtered through a 0.22 μm filter membrane, and 200 μL of the filtrate was added to 800 μL of pure methanol. The mixture was allowed to stand for 5 min, vortexed for 5 min, ultrasonicated for 5 min, centrifuged, and 100 μL of the supernatant was bottled for analysis. The amount of bile acid produced was determined using LC-MS / MS.

[0092] Specific LC-MS / MS method: The chromatographic column used was a Waters ACQUITY UPLC HSS C18 column (3.0 × 100 mm, 1.7 μm); mobile phase A was water containing 0.1% formic acid, and mobile phase B was methanol containing 0.1% formic acid; the flow rate was 0.4 mL / min; the column temperature was 45°C; the injection volume was 1 μL; and the elution method was gradient elution. The elution gradient is shown in Table 2. Table 2 Gradient elution methods

[0093] The high-resolution mass spectrometer used was the AB Sciex QTRAP 6500+; the electrospray ionization (ESI) source was used; the detection method was negative ion mode acquisition; the scanning mode was MRM; and the ion source temperature was 500℃.

[0094] II. Experimental Results The results are shown in Table 3. After 12 hours of cultivation, the bile acid concentration produced by the single strain of *H. coli* HQY061 obtained in Example 1 was (2.27±0.03)×10⁻⁶. -7 The bile acid yield of HQY061 was 20.74% higher than that of the reference strain B420. Although the bile acid yield of both strains decreased after 24 hours, the bile acid yield of HQY061 was still 16.33% higher than that of B42.

[0095] Table 3: Activities of bile salt hydrolytic enzymes

[0096] Example 10 Anti-inflammatory activity of associated cocci HQY061 I. Experimental Methods The associated fecal cocci obtained in Example 1 was inoculated into GAM liquid medium at a strain inoculation rate of 5%, and fermented for 24 h to obtain the fermented bacterial solution.

[0097] A portion of the fermented bacterial broth was centrifuged to collect the supernatant and precipitate. The bacterial cell precipitate was lysed, and the supernatant was collected. The fermentation supernatant was extracted with ethyl acetate at a 1:1 volume ratio, and the solvent was removed by rotary evaporation to form a solid. The bacterial cell lysate was also extracted with ethyl acetate at a 1:1 volume ratio, and the solvent was removed by rotary evaporation to form a solid. These four treatments were then used for cellular anti-inflammatory testing. The supernatant and bacterial cell lysate were filtered through a 0.22 µm filter membrane, sterilized, and aliquoted for storage, avoiding repeated freeze-thaw cycles. RAW264.7 cells were selected, and an LPS-induced cellular inflammation model was used. The inflammatory cells were then treated with the four different methods to determine anti-inflammatory activity. A positive control, dexamethasone, was added.

[0098] Grouping and processing are shown in Table 4.

[0099] Table 4:

[0100] The specific method is as follows: Cells were cultured in high-glucose DMEM complete medium containing 10% fetal bovine serum (10000 U / mL penicillin and 10000 μg / mL streptomycin) at 37°C with 5% CO2. Cell status was observed daily and the medium was changed as needed. When changing the medium, the old medium was discarded first, the cells were washed three times with PBS at 37°C, and then fresh complete medium was added.

[0101] The effects of four different forms of liquid and LPS on the activity of RAW264.7 macrophages were determined. The customer-provided stock solution was used as the highest concentration, and incubation was performed at a volume of 10 µL. Simultaneously, the stock solution was serially diluted twofold to obtain eight concentrations, one control, and one blank. During incubation, a low-serum medium containing 1% FBS and free of antibiotics was used. Each treatment was repeated in triplicate, with the blank medium serving as a control, for a total of 9 × 3 = 27 treatments. LPS was used as the highest concentration, and then diluted six times downwards at six different concentrations, with three replicates for each treatment, for a total of 6 × 3 = 18 treatments. After 24 hours of culture, the cell viability of RAW264.7 macrophages was measured using the CCK8 assay to determine if the samples were toxic to the cells. If so, serial dilutions and replicates were required.

[0102] The effects of eight concentrations of LPS on NO secretion from RAW264.7 macrophages were determined. Eight concentration gradients of LPS were established, with three replicates for each concentration. A blank culture medium was used as a control group. After 24 h of treatment, the supernatant of the culture medium was aspirated and placed in a sterile centrifuge tube. After centrifugation at 12000g for 5 min, 80 μl of the supernatant was collected and 80 μl of a 1:1 mixture of Griess A and B was added. After shaking for 10 min, the absorbance (OD) value at 540 nm was measured using a microplate reader. A standard curve was plotted using sodium nitrite as a standard.

[0103] The effects of four different bacterial solutions on a RAW264.7 macrophage inflammation model were determined. An appropriate LPS concentration was selected for RAW264.7 cell inflammation modeling. Cells were cultured in a low-serum, antibiotic-free medium. Four different bacterial solutions were used for anti-inflammatory treatment, with one positive control added (dexamethasone as a positive control). Each treatment was repeated in triplicate, with a blank medium as a control, for a total of 6 × 3 = 18 treatments. After 24 hours of treatment, the NO content in cells was measured using Griess reagent to evaluate the anti-inflammatory effects of the four bacterial solutions.

[0104] II. Experimental Results The results are as follows Figure 7As shown, by constructing a classic lipopolysaccharide (LPS)-induced inflammation model of RAW264.7 macrophages, the in vitro inflammatory response was successfully simulated. With dexamethasone as an authoritative positive control, the anti-inflammatory activity of the fermentation products and their different forms of extracts was rigorously evaluated.

[0105] The nitrate (NO) detection data from the experiment clearly and strongly demonstrate that the fermentation products of this strain do indeed possess significant anti-inflammatory biological functions. Of particular note is that the solid component (sample 2) obtained after ethyl acetate extraction of the fermentation supernatant showed a significantly better inhibitory effect on the secretion of the inflammatory mediator NO than dexamethasone, a widely used positive control drug in clinical practice. This fully demonstrates its great potential as a novel anti-inflammatory active substance.

[0106] Furthermore, the extracts of cell lysates (sample 4) and cell lysates (sample 3) also exhibited a clear anti-inflammatory trend. These results not only provide authoritative and classic in vitro evidence for the anti-inflammatory activity of the fermentation products, but also suggest that the active substances mainly exist in the fermentation supernatant in a lipid-soluble form.

[0107] In summary, the fermentation products (cells and supernatant) of the associated cocci obtained in Example 1 have a good anti-inflammatory effect.

Claims

1. A strain of coccidia ( Coprococcus comes ), characterized in that, It was deposited at the Guangdong Provincial Center for Microbial Culture Collection on November 10, 2025, with accession number GDMCC No: 67255.

2. The application of the associated coccidia as described in claim 1 in the preparation of antioxidant bacterial agents.

3. The use of the associated coccidia as described in claim 1 in the preparation of a bacterial agent for synthesizing γ-aminobutyric acid.

4. The use of the associated cocci as described in claim 1 in the synthesis of γ-aminobutyric acid.

5. The use of the associated coccidia as described in claim 1 in the preparation of microbial agents that improve metabolism or sleep.

6. The use of the associated fecal cocci as described in claim 1 in the preparation of a bacterial agent with bile salt hydrolase activity.

7. The use of the associated fecal cocci of claim 1 in the preparation of a bacterial agent for improving obesity, hyperglycemia, hyperlipidemia or non-alcoholic fatty liver disease.

8. The use of the associated coccidia as described in claim 1 in the preparation of a bacterial agent with anti-inflammatory activity.

9. The application according to any one of claims 2 to 7, characterized in that, The bacterial agent is a drug or a probiotic solid beverage.

10. The use of the culture medium of *Concomitant cocci* as described in claim 1 in a product with anti-inflammatory activity, characterized in that, The culture medium may or may not contain the associated fecal cocci.

Images