Responsive RNA delivery system for brain glioma and preparation method and application thereof

By combining engineered cell membrane nanovesicles with dual targeting recognition of Siglec-15 scFv and ANG-2, a multi-responsive RNA delivery system was constructed, solving the problems of blood-brain barrier penetration and tumor targeting in glioma treatment. This system achieves precise delivery and controllable release, significantly improving therapeutic efficacy.

CN122056849AActive Publication Date: 2026-05-19INST OF BIOMEDICAL ENG CHINESE ACAD OF MEDICAL SCI
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202610525939.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-21
Publication Date
2026-05-19
Estimated Expiration
2046-04-21

AI Technical Summary

Technical Problem

Current RNA interference technology faces challenges in treating gliomas, including difficulty in penetrating the blood-brain barrier, poor tumor targeting, low nucleic acid loading efficiency, insufficient in vivo stability, poor biosafety, and limited therapeutic efficacy.

Method used

By employing engineered cell membrane-derived nanovesicles, a multifunctional RNA delivery system is constructed through Siglec-15 scFv-mediated immune targeting recognition and ANG-2-mediated blood-brain barrier penetration, combined with a dual release mechanism of acid response and ROS response, to achieve precise targeting and controllable release.

Benefits of technology

It achieves precise targeted delivery to glioma lesions, significantly improves the delivery efficiency and therapeutic effect of nucleic acid drugs, reduces the risk of non-target accumulation and immune clearance, enhances gene silencing effect, and prolongs survival.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122056849A_ABST
    Figure CN122056849A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of biological medicines, in particular to a responsive RNA (Ribonucleic Acid) delivery system for brain glioma as well as a preparation method and application of the responsive RNA delivery system. Through fusion of blood-brain barrier penetrating peptide ANG-2 mediated cross-blood-brain barrier delivery and combination of Siglec-15 mediated immune targeting recognition, a dual targeting mechanism is constructed, a delivery system can be guided to accurately recognize a glioma focus, the enrichment amount of the delivery system in a focus area is remarkably increased, a foundation is laid for playing a role of a nucleic acid drug, and the application prospect is broad. The targeting and effectiveness of treatment are effectively improved, and damage to normal brain tissues is avoided. A dual stimulation release mechanism of acid response and active oxygen response can accurately respond to glioma focuses and endogenous stimulation in cells. Through the synergistic compatibility of the G0-C14 carrier and the charge reversal polylysine, the loading efficiency of the YTHDF2 siRNA is effectively improved, and meanwhile, the cycling stability of the nucleic acid medicine in vivo is enhanced.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to a responsive RNA delivery system for glioma, its preparation method, and its application. Background Technology

[0002] Gliomas are among the most common and aggressive primary malignant tumors of the central nervous system, with glioblastoma multiforme (GBM) having a particularly poor prognosis. Surgical resection, radiotherapy, and chemotherapy remain the most common treatments, but due to the tumor's invasive growth characteristics and the highly selective permeability restriction of the blood-brain barrier (BBB), it is difficult to completely remove the tumor lesions. Even with the combined use of surgery, radiotherapy, and chemotherapy, the median survival of glioblastoma patients remains low, and the clinical recurrence rate remains high.

[0003] In recent years, RNA interference (RNAi) technology has attracted widespread attention due to its high specificity and clinical advantages in silencing genes at undrugable targets. Among them, small interfering RNA (siRNA) has shown strong application potential by targeting and inhibiting genes related to tumor survival and immune escape. However, siRNA molecules are easily degraded by nucleases, have poor in vivo circulation stability, low cell membrane permeability, and are difficult to cross the blood-brain barrier (BBB) ​​and accumulate at tumor sites via passive diffusion, which seriously hinders their clinical translation. Existing non-viral vectors such as liposomes and polymer nanoparticles can protect and deliver nucleic acid drugs to some extent, but they still generally suffer from insufficient targeting selectivity, low cross-BBB efficiency, serious non-specific accumulation in vivo, and the risk of immunogenicity.

[0004] In the development and progression of gliomas, the tumor immune microenvironment (TIME) plays a crucial role in tumor biological behavior and treatment tolerance. Numerous studies have shown that tumor-associated macrophages (TAMs) extensively infiltrate gliomas, exhibiting a predominantly immunosuppressive phenotype. They promote tumor immune escape and treatment resistance by secreting immunosuppressive factors, inhibiting T cell activation, and enhancing tumor invasiveness. Siglec-15, a novel immunosuppressive molecule, is widely and highly expressed on the surface of gliomas and TAMs. It mediates tumor immune tolerance by inhibiting T cell proliferation and cytotoxic function, and is closely related to poor patient prognosis. In recent years, Siglec-15 has been considered a promising new immunotherapeutic target after PD-1 / PD-L1. However, systemic therapy targeting Siglec-15 still primarily relies on antibody drugs, which have limitations such as insufficient BBB crossing ability, low targeted enrichment efficiency, and insufficient local immune regulation.

[0005] In recent years, biomimetic delivery strategies based on engineered cell membrane-derived vesicles have gradually attracted attention. By engineering functional molecules on the cell membrane surface, specific target recognition capabilities can be introduced while maintaining the cell membrane's natural biocompatibility and immune escape properties, thereby improving the stability and targeting specificity of the delivery system in vivo. However, existing cell membrane vesicle delivery systems still have limitations in multi-level stimulus response regulation and immune-targeting function integration, and have not yet fully combined blood-brain barrier penetration strategies with tumor immune-targeting design. Their application in brain tumor treatment still has room for further improvement.

[0006] Therefore, there is an urgent need to develop a nucleic acid delivery system with high blood-brain barrier penetration, precise tumor immune target recognition, and sensitive stimulus-response release capability, so as to achieve precision treatment of gliomas. Summary of the Invention

[0007] This invention aims to at least solve one of the technical problems existing in the related art. Therefore, the first objective of this invention is to provide a method for preparing a responsive RNA delivery system for gliomas; the second objective is to provide a responsive RNA delivery system for gliomas; and the third objective is to provide applications of the responsive RNA delivery system for gliomas.

[0008] To achieve the first objective, the technical solution adopted by this invention is as follows: A method for preparing a responsive RNA delivery system for glioma includes the following steps: S100. Using engineered HEK293T cells with surface resistance to Siglec-15 scFv as raw materials, Siglec-15 scFv modified nanomembrane vesicles I were prepared. Among them, Siglec-15 scFv is a single-chain antibody fragment of sialic acid-binding immunoglobulin-like lectin-15; This step uses engineered cells as raw material, ensuring the uniformity and activity of Siglec-15 scFv on the membrane vesicle surface. Simultaneously, Siglec-15 scFv, as a single-chain antibody fragment targeting the tumor-associated immune target Siglec-15, can precisely recognize the Siglec-15 target on the surface of glioma cells, laying the foundation for subsequent targeted delivery. This design not only achieves the initial construction of immune targeting, enabling nanomembrane vesicles I to recognize glioma cells and initially solving the problems of poor targeting and easy accumulation in non-target organs in existing delivery systems, but also naturally retains the biocompatibility and immune escape characteristics of the cell membrane, avoiding the biotoxicity of artificially synthesized carriers; furthermore, pre-modifying the surface of engineered cells with Siglec-15 scFv ensures its targeted recognition efficiency.

[0009] S200, DSPE-TK-PEG 5000 - ANG-2 conjugate is inserted into the surface of nanomembrane vesicle I to obtain nanomembrane vesicle II that are simultaneously modified with Siglec-15 scFv and ANG-2; Embedding the conjugate onto the surface of the nanomembrane vesicle I enables the simultaneous loading of an immune-targeting ligand (Siglec-15scFv) and a blood-brain barrier-penetrating ligand (ANG-2), constructing a dual-function penetration-targeting system. Furthermore, the TK bond in the conjugate exhibits ROS responsiveness, allowing it to cleave within the high-ROS environment of glioma lesions, providing a trigger for subsequent nucleic acid drug release. ANG-2 specifically mediates the crossing of the blood-brain barrier by the nanomembrane vesicles, facilitating the delivery system's successful arrival at the glioma lesion region. The synergistic effect of the two ligands further enhances targeting precision, significantly improving the lesion accumulation capacity of the delivery system and reducing accumulation in non-target areas. Simultaneously, the TK bond remains stable under normal physiological conditions, ensuring that the delivery system does not prematurely detach during in vivo circulation, while it cleaves efficiently in the high-ROS environment of glioma lesions, balancing the responsiveness and stability of the delivery system and providing a reliable guarantee for subsequent drug release.

[0010] S300. Add the aqueous phase containing YTHDF2 siRNA dropwise to the organic phase containing G0-C14, stir until homogeneous, and obtain the primary complex. The G0-C14 carrier initially encapsulates YTHDF2 siRNA, which reduces the probability of nucleic acid degradation by nucleases during subsequent preparation and effectively improves nucleic acid stability. The formation of the primary complex also makes it easier for YTHDF2 siRNA to bind to subsequent charge-reversible polylysine, reducing the difficulty of self-assembly and ensuring the uniformity of the final nanoparticles. At the same time, it is compatible with the subsequent dual-response design and works synergistically with acid-responsive charge-reversible polylysine, providing strong support for the controlled release of nucleic acid drugs.

[0011] S400. The primary complex is added to an aqueous solution containing acid-responsive charge-reversible polylysine, and a self-assembly reaction is carried out to form nanoparticles III loaded with YTHDF2 siRNA. Polylysine possesses an acid-responsive charge-reversal design, enabling it to reverse its charge in response to the acidic conditions of the tumor microenvironment, providing a triggering mechanism for the targeted release of nucleic acid drugs. G0-C14 synergistically interacts with the acid-responsive charge-reversal polylysine to form a double-encapsulation structure, further enhancing nucleic acid loading efficiency and stability. This design, through the synergistic effect of the dual carriers, effectively improves the encapsulation efficiency of YTHDF2 siRNA, overcoming the technical shortcomings of existing carriers with weak loading capacity. The double-encapsulation structure also effectively protects YTHDF2 siRNA, preventing its degradation by nucleases in vivo and prolonging the circulation time of nucleic acids in vivo. The charge-reversal property of polylysine allows nanoparticle III to remain stable under normal physiological conditions, dissociating upon entering the acidic microenvironment of glioma, initially triggering the release of nucleic acid drugs and enhancing the specificity of gene silencing. Simultaneously, the positive charge of polylysine promotes the binding of nanoparticle III to the negatively charged glioma cell membrane, facilitating the entry of nucleic acid drugs into the cells to exert their effects, thereby improving intracellular delivery efficiency.

[0012] S500. Using the nanomembrane vesicles II and the nanoparticles III, a responsive RNA delivery system for glioma is prepared.

[0013] This responsive RNA delivery system for glioma integrates four major functions: blood-brain barrier penetration (ANG-2), tumor immune targeting (Siglec-15 scFv), dual release with acid and ROS responsiveness (polylysine acid response and TK bond ROS response), and efficient nucleic acid loading and protection (synergistic effect of G0-C14 and polylysine). It addresses the limitations of existing delivery systems with their single-function limitations and limited therapeutic effects. The membrane vesicle shell effectively avoids the clearance of nanoparticles III by the body's immune system, reducing non-specific accumulation while maintaining good biocompatibility and minimizing potential toxic side effects, providing a solid guarantee for clinical translation. Ultimately, the delivery system achieves precise crossing of the blood-brain barrier and targeted enrichment at glioma lesions. Under endogenous stimulation (acidity, high ROS) at the lesion, it can controllably release YTHDF2 siRNA, enhancing gene silencing effects and improving therapeutic specificity and efficacy. This provides a feasible carrier for combined gene therapy and immunomodulation therapy for glioma.

[0014] Further, in step S100, engineered HEK293T cells with surface-displaying anti-Siglec-15 scFv were constructed using a transfection method; The transfection method requires two lentiviral packaging vector plasmids, psPAX2 and pMD2.G, and one lentiviral expression vector plasmid, scFv-PCDH-CMV-EF1A-copGFP-T2A-PURO. The mass ratio of psPAX2, pMD2.G, and scFv-PCDH-CMV-EF1A-copGFP-T2A-PURO is 1:(1-2):(1.5-2.5). The transfected cells used in the transfection method were selected from HEK293T cells.

[0015] Further, in step S200, the DSPE-TK-PEG 5000 -ANG-2 conjugate with DSPE-TK-PEG 5000 It is prepared by coupling reaction using -Mal and ANG-2 as raw materials.

[0016] Further, in step S200, DSPE-TK-PEG 5000 The mass ratio of the -ANG-2 conjugate to the nanomembrane vesicle I is (15-25):1.

[0017] Further, in step S300, the solvent of the organic phase is selected from N,N-dimethylformamide.

[0018] Further, in step S400, the acid-responsive charge-reversible polylysine is mPEG. 113 -b-Plys 120 / CA; mPEG 113 -b-Plys 120 / CA represents polyethylene glycol-b-polylysine modified with aconitic anhydride.

[0019] Further, in step S500, the mass ratio of the nanomembrane vesicles II to the nanoparticles III is (1.5~2.5):1.

[0020] Furthermore, the method used to prepare Siglec-15 scFv modified nanomembrane vesicles I and the responsive RNA delivery system for gliomas is membrane extrusion.

[0021] To achieve the second objective, the technical solution adopted by this invention is as follows: The responsive RNA delivery system for glioma is prepared using any of the above-described methods for preparing a responsive RNA delivery system for glioma.

[0022] To achieve the third objective, the technical solution adopted by this invention is as follows: Application of a responsive RNA delivery system for glioma, and preparation of anti-glioma drugs using the responsive RNA delivery system for glioma.

[0023] The above-described one or more technical solutions in the embodiments of the present invention have at least one of the following technical effects: The present invention provides a responsive RNA delivery system for glioma and its preparation method. This technical solution addresses the technical problems of existing glioma nucleic acid delivery systems, such as difficulty in penetrating the blood-brain barrier, poor tumor targeting, low nucleic acid loading efficiency, insufficient in vivo stability, poor biosafety, and limited therapeutic efficacy. Through multi-mechanism synergistic design, it achieves several improvements, as detailed below: First, it effectively overcomes the delivery bottleneck of the blood-brain barrier, achieving precise targeting and efficient accumulation of glioma lesions. This invention constructs a dual-targeting mechanism by fusing the blood-brain barrier-penetrating peptide ANG-2 to mediate cross-blood-brain barrier delivery, and combining it with Siglec-15-mediated immune targeting recognition. This solves the core problems of existing delivery systems, such as difficulty in crossing the blood-brain barrier and easy accumulation in non-target organs. It can guide the delivery system to accurately identify glioma lesions, significantly increase the accumulation of the delivery system in the lesion area, lay the foundation for the effectiveness of nucleic acid drugs, effectively improve the targeting and efficacy of treatment, and avoid damage to normal brain tissue.

[0024] Second, a dual-stimulus response release mechanism is constructed to achieve controllable release and efficient action of nucleic acid drugs. This invention innovatively designs a dual-stimulus release mechanism based on acid response and reactive oxygen species (ROS) response. It can accurately respond to endogenous stimuli within glioma lesions and cells (tumor microenvironment acidity, elevated ROS levels), triggering the delivery system to specifically release YTHDF2siRNA. This avoids premature release and inactivation of nucleic acid drugs in non-target areas in vivo, while ensuring precise drug action at the lesion site, significantly enhancing gene silencing effects, and solving the technical defects of existing delivery systems such as uncontrollable release and low gene silencing efficiency.

[0025] Third, the synergistic effect of the vector was optimized to improve nucleic acid loading and delivery efficiency. The synergistic combination of the G0-C14 vector and charge-reversed polylysine effectively improved the loading efficiency of YTHDF2 siRNA, while enhancing the circulation stability of nucleic acid drugs in vivo, reducing the probability of nucleic acid degradation by nucleases, and significantly improving intracellular delivery efficiency. This promoted the entry of nucleic acid drugs into glioma cells to exert their effects, further strengthening the gene silencing effect and improving the specificity of nucleic acid therapy. This overcomes the problems of weak loading capacity, easy degradation in vivo, and low intracellular delivery efficiency of existing vectors.

[0026] Fourth, it enhances biocompatibility and cyclic stability, reducing the risk of immune clearance. This invention uses engineered cell membrane-derived vesicles as delivery carriers. Through engineered modification of functional molecules on the cell membrane surface, it achieves specific recognition of tumor-related immune targets while retaining the carrier's good biocompatibility and immune escape characteristics. This effectively reduces the immune clearance rate and non-specific tissue accumulation of the nanodelivery system in vivo, significantly improving the in vivo cyclic stability and biosafety of the delivery system. It solves the technical problems of existing nanodelivery systems being easily cleared by the in vivo immune system, having poor biocompatibility, and having potential toxic side effects, providing a safety guarantee for clinical translational applications.

[0027] Fifth, this invention enables synergistic treatment through multiple mechanisms, enhancing the therapeutic effect and survival benefits of glioma. The multi-responsive nucleic acid delivery system constructed in this invention can synergistically achieve three core functions: precise crossing of the blood-brain barrier, targeted regulation of the tumor immune microenvironment, and drug release triggered by endogenous tumor stimuli, forming a synergistic effect of gene therapy and immune regulation. Validated in mouse orthotopic GL261 glioma models and postoperative recurrence models, this system can significantly inhibit tumor growth and effectively prolong the survival of model animals, demonstrating excellent therapeutic effects and survival benefits. It solves the technical challenges of existing glioma treatments, such as single-method approaches, high postoperative recurrence rates, and limited therapeutic efficacy, providing a novel technical solution and application carrier for combined gene therapy and immune regulation for glioma.

[0028] Sixth, this invention provides a scalable technology platform to promote the development of targeted delivery technology for central nervous system tumors. This invention not only solves the core problems of low efficiency in glioma nucleic acid drug delivery and difficulty in targeted delivery of central nervous system tumors, but also provides a scalable technology platform for the design, development, and translational application of targeted delivery vectors for central nervous system tumors.

[0029] This invention provides a new solution to overcome the key technical problem of limited efficiency in nucleic acid drug delivery for gliomas, and also provides a scalable technical platform for the design and translational application of targeted delivery vectors for central nervous system tumors.

[0030] Additional aspects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. Attached Figure Description

[0031] Figure 1 This is the expression of Siglec-15 scFv in S15ab-293T cells provided in Example 1 of the present invention.

[0032] Figure 2 The results of dynamic light scattering (DLS) and zeta potential of S15ab-NVs, siNPs and si@S15ab-TPA provided in Embodiment 1 of the present invention are shown.

[0033] Figure 3 This describes the DLS particle size and zeta potential of the si@S15ab-TPA delivery system provided in Embodiment 1 of the present invention under different pH conditions.

[0034] Figure 4 This is a flow cytometry result graph of different treatment groups provided in Example 1 of the present invention.

[0035] Figure 5 These are laser confocal microscopy (CLSM) imaging results of GL261 cells and RAW264.7 cells in different treatment groups provided in Example 1 of this invention.

[0036] Figure 6 This invention provides flow cytometry detection of CD4 in different treatment groups provided in Example 2 of this invention. + Results of changes in the proportion of T cells.

[0037] Figure 7 The different treatment groups provided in Example 2 of this invention were used to detect CD8 by flow cytometry. + Results of changes in the proportion of T cells.

[0038] Figure 8This is the quantitative detection result of IFN-γ (interferon-γ) secretion levels in different treatment groups provided in Example 2 of this invention.

[0039] Figure 9 The different treatment groups provided in Example 2 of this invention were used to detect tumor cell apoptosis using flow cytometry and LDH release assay.

[0040] Figure 10 This is the quantitative detection result of FN-γ (interferon-γ) secretion levels in different treatment groups provided in Example 3 of the present invention.

[0041] Figure 11 This is a mouse fluorescence imaging (FL) result image provided in Example 4 of the present invention.

[0042] Figure 12 This invention examines the bioluminescence imaging of tumors in mice from different treatment groups provided in Example 5. Figure 13 This invention provides Example 5, which describes the flow cytometry analysis of macrophage polarization status in different treatment groups.

[0043] Figure 14 This invention provides Example 5, which describes the flow cytometry detection of CD8 in tumor tissues using different treatment groups. + Cytotoxic T cell infiltration status.

[0044] Figure 15 This invention provides Example 5, which describes the flow cytometry detection of CD4 in tumor tissues using different treatment groups. + Helper T cell infiltration status.

[0045] Figure 16 These are histopathological sections of major organs stained with H&E provided in Example 6 of this invention.

[0046] Figure 17 The results are the serum biochemical index detection results provided in Example 6 of this invention. Detailed Implementation

[0047] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below in conjunction with specific embodiments. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention. The following embodiments are used to illustrate this invention, but cannot be used to limit the scope of this invention.

[0048] In the following embodiments, unless otherwise specified, the experimental methods used are conventional methods, and the materials and reagents used are commercially available, unless otherwise specified, and are carried out in accordance with the techniques or conditions described in the literature in this field or in accordance with the product instructions.

[0049] Example 1 I. Preparation of lentiviral expression vector plasmids.

[0050] The scFv gene was constructed into the PCDH-CMV-EF1A-copGFP-T2A-PURO vector to form the lentiviral expression vector plasmid scFv-PCDH-CMV-EF1A-copGFP-T2A-PURO.

[0051] Overlapping extension primers were designed and synthesized based on the target single-chain antibody (scFv) gene sequence. The primer nucleotide sequences are shown in SEQ ID NO.1 to SEQ ID NO.18, the sequencing primer sequences are shown in SEQ ID NO.19 to SEQ ID NO.20, and the full-length sequence of the target single-chain antibody gene is shown in SEQ ID NO.21.

[0052] Primer 1 (SEQ ID NO.1) is shown below: CTCCATAGAAGATTCTAGAGCTAGCGAATTCATGGGATGGAGCTGCATCATCCTGTTCCTGGTGGCCACCGCCACCGGA; Primer 2 (SEQ ID NO.2) is shown below: CGCCAGGCTTCACCAGTTCAGCTCCTGGCTGCTGCAGCTGCACCTGGCTGTGCACTCCGGTGGCGGTGGC; Primer 3 (SEQ ID NO.3) is shown below: TGGTGAAGCCTGGCGCTAGCGTGAAGATGAGCTGCAAGGCCTCCGGCTACACCTTCACCTCCTACTGGAT; Primer 4 (SEQ ID NO.4) is shown below: GTAGATATCTCCGATCCATTCCAGTCCCTGGCCGGGTCTCTGGATCACCCAGGTGATCCAGTAGGAGGTG; Primer 5 (SEQ ID NO.5) is shown below: ATCGGAGATATCTACTGTGGCTCCGACACCATGCACTACAACGAGAAGTTTAAGAATAAGGCCACCCTGA; Primer 6 (SEQ ID NO. 6) is shown below: TCGCTGGTCAGGCTGGACAGCTGCATGTAGGCGGTAGAGCTGCTGGTGTCCACTGTCAGGGTGGCCTTAT; Primer 7 (SEQ ID NO.7) is shown below: CAGCCTGACCAGCGAGGACTCTGCTGTGTACTACTGCGCCAGGTGGTGGGATTACGGCAGCCTTACGAC; Primer 8 (SEQ ID NO. 8) is shown below: GCTAGAAACTGTCAGGGTGGTGCCCTGGCCCCAGTAATCGAAGTAGTCGTAAGAGCTGCC; Primer 9 (SEQ ID NO. 9) is shown below: CTGACAGTTTCTAGCGGCGGCGGCGGATCTGGAGGAGGAGGAAGCGGAGGAGGAGGTTCTGACATCAAGATGACCCAGAG; Primer 10 (SEQ ID NO.10) is shown below: GGCCTTACATGTGATGGTCACTCTCTCTCCCAGGGAGGCGTACATGGAGCTAGGGCTCTGGGTCATCTTG; Primer 11 (SEQ ID NO.11) is shown below: ATCACATGTAAGGCCAGCCAGGACATCAATAGCTACCTGTCCTGGTTCCAGCAGAAGCCTGGCAAGAGCC; Primer 12 (SEQ ID NO.12) is shown below: GCTAAATCTAGAAGGCACGCCATCCACCAGCCTGTTGGCCCTGTAGATCAGGGTCTTTAGGGCTCTTGCCAGGCT; Primer 13 (SEQ ID NO.13) is shown below: CCTTCTAGATTTAGCGGCTCCGGCAGCGGCCAGGATTACAGCCTGACAATCTCCAGCCTGGAGTACGAGGATATGGGCA; Primer 14 (SEQ ID NO.14) is shown below: ATCTCCAGCTTGGTGCCGCCGCCAAATGTGTAGGGGAACTCATCGTACTGCAGACAGTAGTAGATGCCCATATCCCGT; Primer 15 (SEQ ID NO.15) is shown below: CACCAAGCTGGAGATCAAGAGAGGCGGAGGCGGAAGCGGAGGCGGAGGAAGCGGCGGAGGAGGATCCAACGCTGTGGGA; Primer 16 (SEQ ID NO.16) is shown below: CGCTGATCACCACCACCTTGAAAGGCAGGGAGTGGGGCACCACGATCACCTCCTGTGTATCCTGTCCCACAGCGTTGGA; Primer 17 (SEQ ID NO.17) is shown below: TGGTGGTGATCAGCGCCATCCTGGCCCTGGTTGTGCTGACAATCATCAGCCTGATCATCCTGATCATGCTGTGGCAGAA; Primer 18 (SEQ ID NO.18) is shown below: GCACCGGAGCGATCGCAGATCCTTCGCGGCCGCTCAATGGTGATGGTGATGGTGCCTGGGCTTCTTCTGCCACAGCATG; Primer 19 (SEQ ID NO.19) is shown below: CGCAAATGGGCGGTAGGCGTG; Primer 20 (SEQ ID NO.20) is shown below: GCCAGTACACGACATCACTT; The scFv gene (SEQ ID NO.21) is shown below:

[0053] The construction process is as follows: (I) Preparation of the full-length scFv gene by overlapping extension PCR reaction.

[0054] Step 1: First round of PCR reaction (primer splicing).

[0055] The reaction system is shown in the table below:

[0056] The reaction conditions are shown in the table below:

[0057] Step 2: Second round of PCR reaction (full-length amplification).

[0058] The reaction system is shown in the table below:

[0059] The reaction conditions are shown in the table below:

[0060] Step 3: Gel recovery and purification.

[0061] The products from the second round of PCR reaction were purified by gel extraction using an agarose gel extraction kit to obtain the full-length scFv gene fragment. Electrophoresis analysis of the obtained full-length scFv gene fragment was performed to verify that the product bands met the criteria of uniqueness and clear bands.

[0062] (ii) Vector double enzyme digestion linearization.

[0063] 1 μg of the empty vector plasmid PCDH-CMV-EF1A-copGFP-T2A-PURO was digested with EcoRI and NotI to obtain the linearized empty vector plasmid. The digestion system (37℃, 60 min) is shown in the table below:

[0064] (III) Recombination of connections.

[0065] The purified full-length scFv gene fragment was recombinated and ligated with a linearized vector. The ligation system (the ligation system was incubated in a 52℃ water bath for 40 min, then removed and left at room temperature for 5 min to allow the reaction system temperature to naturally decrease) is shown in the table below:

[0066] (iv) Transformation and screening of positive clones.

[0067] The recombinant ligation product was added to competent cells, and after 10 min on ice, the cells were heat-shocked at 42°C for 90 s, followed immediately by 3 min on ice. Then, 800 μL of antibiotic-free LB medium was added, and the cells were incubated at 37°C for 1 h. After incubation, the cultured sample was centrifuged to remove part of the supernatant and concentrated. The concentrated bacterial solution was then spread on antibiotic LB plates and incubated upside down at 37°C overnight.

[0068] Single colonies were picked from the overnight plates and colony PCR was performed using primers 1 and 18. The colony reaction system is shown in the table below:

[0069] The reaction conditions are shown in the table below:

[0070] Positive clones were identified by electrophoresis. Three positive clones were randomly selected and cultured overnight in a single tube at 37°C in a shaker. The plasmid was then extracted and sequenced using primers 19 and 20. The sequencing results showed that the scFv gene sequence was 100% identical, and the recombinant expression vector, namely the lentiviral expression vector plasmid scFv-PCDH-CMV-EF1A-copGFP-T2A-PURO, was successfully constructed.

[0071] II. Constructing stably transfected HEK293T cells.

[0072] The lentiviral packaging vector plasmids psPAX2 and pMD2.G and the lentiviral expression vector plasmid scFv-PCDH-CMV-EF1A-copGFP-T2A-PURO were transfected into HEK293T cells at a mass ratio of 1:1.5:2, as follows: 40 μL of PEI transfection reagent HY-K2014 was thoroughly mixed with psPAX2 (5 μg), pMD2.G (7.5 μg), and scFv-PCDH-CMV-EF1A-copGFP-T2A-PURO (10 μg). After standing for 5 min, serum-free Gibco medium (1 mL) was added, mixed, and stood for 15 min. This mixture was then added to HEK293T cells that had been starved for 1 h. Viral supernatants were collected 48 h and 72 h after transfection. The collected viral supernatants were then added to mouse mesenchymal stem cell (MSC) lines in good growth condition. Two days after viral transfection, a two-week selection process using puromycin (1 μg / ml) was initiated to isolate single clones, named S15ab-293T. The expression of Siglec-15 scFv in these cells was as follows: Figure 1 As shown in the figure, this figure verifies the efficient and stable expression of Siglec-15 scFv in cells from two dimensions: fluorescence phenotype and cell population ratio. Figure A shows a fluorescence microscope image (scale bar is 200 μm), and Figure B shows the results of flow cytometry analysis.

[0073] III. Preparation of Siglec-15 scFv modified nanomembrane vesicles and unmodified nanomembrane vesicles.

[0074] The collected S15ab-293T cells were resuspended in sterile PBS buffer at a cell density of 1.5 × 10⁻⁶ cells / year. 7 Cells / mL were then extruded sequentially through polycarbonate membranes of different pore sizes (10μm, 4μm, 1μm, 400nm) using a micro extruder for 10–20 extrusion operations (to ensure uniform nanovesicle size) to obtain Siglec-15 scFv modified nanomembrane vesicles, denoted as S15ab-NVs.

[0075] Unmodified 293T cells (without Siglec-15 scFv) were resuspended in sterile PBS buffer at a cell density of 1.5 × 10⁻⁶ cells / year. 7 Cells / mL were then used to extrude the cell suspension sequentially through polycarbonate membranes of different pore sizes (10μm, 4μm, 1μm, 400nm) 10–20 times (to ensure uniform nanovesicle size) to obtain unmodified nanomembrane vesicles, denoted as NVs.

[0076] IV. Preparation of nanomembrane vesicles with different modification types.

[0077] SPEE-TK-PEG 5000 -Mal and the ANG-2 peptide containing free thiol (Cys) were prepared into 10 mM and 12 mM stock solutions using anhydrous dimethyl sulfoxide (DMSO) and 0.01 M PBS buffer (pH 6.8), respectively.

[0078] Under a nitrogen atmosphere, take DSPE-TK-PEG 5000 -Mal stock solution (10 μL) and ANG-2 stock solution (10 μL) were added to PBS buffer (pH 6.8) (978 μL). The mixture was stirred and reacted for 2 h at room temperature and in the dark. After the reaction was completed, the mixture was centrifuged and washed three times at 4 °C and 5000 × g for 10 min each time to remove unreacted ANG-2 peptide and DMSO, thus obtaining the DSPE-TK-PEG5000-ANG-2 conjugate.

[0079] SPEE-TK-PEG 5000- ANG-2 conjugate was intercalated into the surface of Siglec-15 scFv-modified nanomembrane vesicles. The two were mixed at a mass ratio of 20:1 and thoroughly mixed. After incubation at 37°C for 30 min, the ANG-2 was functionalized on the vesicle surface by utilizing the spontaneous insertion of the hydrophobic alkyl chain of the DSPE molecule into the vesicle phospholipid bilayer. After incubation, the ANG-2 was functionalized on the vesicle surface by centrifugation at 4°C and 5000×g for 10 min using a 10 kDa ultrafiltration centrifuge tube and washing three times to obtain acid-responsive nanomembrane vesicles with surface modification against both Siglec-15 scFv and ANG-2, denoted as S15ab-NVs-TPA.

[0080] SPEE-TK-PEG 5000 The material was embedded into the surface of Siglec-15 scFv-modified nanomembrane vesicles. The two were mixed at a mass ratio of 20:1 and thoroughly mixed. After incubation at 37°C for 30 min, the mixture was centrifuged at 4°C and 5000×g for 10 min each time using a 10 kDa ultrafiltration centrifuge tube and washed 3 times to obtain ROS-responsive material and Siglec-15 scFv-resistant nanomembrane vesicles, denoted as S15ab-NVs-TP.

[0081] SPEE-TK-PEG 5000 - ANG-2 conjugate was inserted into the surface of unmodified NVs. The two were mixed at a mass ratio of 20:1 and thoroughly mixed. After incubation at 37°C for 30 min, the ANG-2 was functionalized on the vesicle surface by utilizing the spontaneous insertion of the hydrophobic alkyl chain of the DSPE molecule into the vesicle phospholipid bilayer. After incubation, the 10 kDa ultrafiltration centrifuge tube was centrifuged at 4°C and 5000×g for 10 min each time, and washed 3 times to obtain nanomembrane vesicles with only ANG-2 modified on the surface, denoted as NVs-TPA.

[0082] V. Nanoparticles containing YTHDF2 siRNA and those not containing siRNA.

[0083] Aqueous phase (20 μM, 2.5 μL) containing YTHDF2 siRNA was added dropwise to organic phase (5 mg / mL, 2.5 μL) containing GO-C14 (N,N-dimethylformamide, 5 mg / mL), and stirred until homogeneous to obtain a primary complex. This primary complex was then added to acid-responsive charge-reversible polylysine mPEG. 113 -b-Plys 120 In an aqueous solution of / CA (1 mg / mL, 25 μL), nanoparticles encapsulating YTHDF2 siRNA were formed through a self-assembly reaction, denoted as siNPs; The sequence of YTHDF2 siRNA (SEQ ID NO.22) is shown below: CCACCGUUCCAUUAAGUAUTT.

[0084] mPEG 113 -b-Plys 120 / CA was prepared according to the following references: Zhou Y., Liang Q., Wu X., et al. siRNA Delivery against MyocardialIschemia Reperfusion Injury Mediated by Reversibly Camouflaged BiomimeticNanocomplexes. Adv Mater 35, e2210691 (2023).

[0085] An organic phase containing G0-C14 (solvent: N,N-dimethylformamide) (5 mg / mL, 2.5 μL) was added to acid-responsive charge-reversible polylysine mPEG. 113 -b-Plys 120 In an aqueous solution of / CA (1 mg / mL, 25 μL), nanoparticles without siRNA were formed through a self-assembly reaction, denoted as ScriNPs.

[0086] VI. Preparation of different types of delivery systems.

[0087] S15ab-NVs-TPA and siNPs were mixed at a mass ratio of 2:1. After thorough mixing, the suspension was extruded through polycarbonate membranes of different pore sizes (10μm, 4μm, 1μm, 400nm) 10–20 times to construct a responsive RNA delivery system for gliomas with blood-brain barrier penetration capability and ROS-responsive targeting characteristics, denoted as si@S15ab-TPA.

[0088] S15ab-NVs-TP and siNPs were mixed at a mass ratio of 2:1. After thorough mixing, the suspension was extruded 10–20 times through polycarbonate membranes with different pore sizes (10 μm, 4 μm, 1 μm, 400 nm) to obtain membrane vesicles without ANG-2 modification but with DSPE-TK-PEG intercalated. 5000 The ROS-responsive RNA delivery system is denoted as si@S15ab-TP.

[0089] S15ab-NVs and siNPs were mixed at a mass ratio of 2:1. After thorough mixing, the suspension was extruded through polycarbonate membranes of different pore sizes (10μm, 4μm, 1μm, 400nm) 10 to 20 times to obtain a ROS-responsive RNA delivery system modified only with anti-Siglec-15 scFv membrane vesicles, denoted as si@S15ab.

[0090] NVs and siNPs were mixed at a mass ratio of 2:1. After thorough mixing, the suspension was extruded through polycarbonate membranes with different pore sizes (10μm, 4μm, 1μm, 400nm) 10 to 20 times to obtain an unmodified ROS-responsive RNA delivery system for membrane vesicles, denoted as si@NV.

[0091] NVs and ScriNPs were mixed at a mass ratio of 2:1. After thorough mixing, the suspension was extruded through polycarbonate membranes with different pore sizes (10μm, 4μm, 1μm, 400nm) 10 to 20 times to obtain a delivery system of unmodified membrane vesicles without siRNA loading, denoted as Scri@NV.

[0092] NVs-TPA and ScriNPs were mixed at a mass ratio of 2:1. After thorough mixing, the suspension was extruded through polycarbonate membranes of different pore sizes (10μm, 4μm, 1μm, 400nm) 10–20 times to obtain a delivery system with ANG-2 modified membrane vesicles but without siRNA loading, denoted as Scri@NV-TPA, which served as a control for subsequent testing.

[0093] DLS results and zeta potential of S15ab-NVs, siNPs, and si@S15ab-TPA, as follows: Figure 2 As shown; Figure A shows the dynamic light scattering patterns of different nanoparticles. From this figure, we can see that the particle size of S15ab-NVs is about 130 nm, the particle size of siNPs is about 150 nm, and the particle size of si@S15ab is about 175 nm.

[0094] Figure B shows the zeta potential of different substances in PBS buffer (pH 7.4). From this figure, we can see that: the potential of S15ab-NVs is about -22mV, which is strongly negatively charged and is the typical charge of the natural cell membrane / vesicle; the potential of siNPs is about +10mV, which is positively charged, indicating that the cationic carrier successfully complexed the negatively charged siRNA, and the overall charge was reversed; the potential of si@S15ab-TPA is about -11mV, which has become weakly negatively charged again.

[0095] To further evaluate the pH-responsive charge reversal behavior of si@S15ab-TPA, the si@S15ab-TPA delivery system was incubated in PBS buffer at pH 7.4 and pH 6.8, respectively, and the DLS particle size and zeta potential were measured. The results are as follows: Figure 3 As shown; Figure A shows the DLS results of si@S15ab-TPA after incubation with PBS buffer at pH 7.4 and 6.8, respectively. From this figure, it can be seen that the particle size is different under physiological conditions (pH 7.4) and weakly acidic environment (pH 6.8). Under weakly acidic environment, the particle size changes from about 175 nm under physiological conditions to about 147.5 nm. Figure B shows the zeta potential of si@S15ab-TPA after incubation with PBS buffer at pH 7.4 and 6.8, respectively. The figure shows that the zeta potential changed from -11mV under physiological conditions to about 6.5mV under weakly acidic conditions. This result indicates that the breaking of CA bonds in acidic environments leads to the exposure of protonated amino groups, thereby mediating surface charge reversal and promoting membrane instability and responsive dissociation of the nanoplatform, which is beneficial for subsequent intracellular siRNA delivery.

[0096] Test Example 1 I. Testing the ability of si@S15ab-TPA to cross the blood-brain barrier: First, an in vitro blood-brain barrier (BBB) ​​model was established. Brain microvascular endothelial cells (bEnd.3) were seeded onto the upper membrane surface of a Transwell chamber and cultured until a dense monolayer structure was formed. The integrity of the barrier model was confirmed by transepithelial electrical resistance testing. GL261 cells were then seeded into the lower layer of the Transwell chamber. Subsequently, different DiO-labeled delivery systems (1 mg / mL) were added to the upper Transwell chamber for incubation. After 12 hours of incubation, GL261 cells from the lower chamber were collected to test the penetration efficiency of different delivery systems. The results were analyzed by flow cytometry. Figure 4 As shown in the figure, the signal intensity detected by si@S15ab-TPA in the lower chamber is significantly higher than that of other control groups. This result indicates that si@S15ab-TPA has good in vitro BBB penetration ability.

[0097] Figure A shows the fluorescence intensity histogram of different nanoparticles, and Figure B shows the average fluorescence intensity (MFI) bar chart.

[0098] II. The ROS-triggered targeted ligand exposure behavior of different delivery systems was evaluated through in vitro cell binding experiments, as follows: The experiment was set up in four groups: si@S15ab-TP+H2O2, si@S15ab-TP, si@NV and si@S15ab. The dosage added to each group was 10.0 µg / mL, calculated as S15ab-NVs or NVs. The delivery system was fluorescently labeled with DiO, while GL261 cells or RAW264.7 cells were labeled with DiD (2µM). The binding of the delivery system to the cell membrane was observed using CLSM imaging. The results are as follows: Figure 5 As shown in the figure, since the si@NV surface does not contain Siglec-15 scFv, it shows almost no obvious binding signal with the surface of GL261 cells or RAW264.7 cells. In contrast, si@S15ab carrying Siglec-15 scFv can effectively bind to the cell membrane surface. Furthermore, the binding ability of the si@S15ab-TP group formed after the introduction of DSPE-TK-PEG5000 is significantly reduced, indicating that the PEG layer has an effective spatial shielding effect on scFv. When H2O2 is added to simulate the high ROS microenvironment of tumors, the TK bond breaks, causing the PEG shielding layer to fall off, and the cell binding ability of si@S15ab-TP is significantly restored, proving that this nanosystem can achieve responsive exposure of Siglec-15 scFv under ROS stimulation. Image A shows a CLSM imaging of GL261 cells, and image B shows a CLSM imaging of RAW264.7 cells.

[0099] Test Example 2 An in vitro co-culture system of tumor cells and T cells was established to evaluate the regulatory effect of the nanosystem on T cell immune function. Five experimental groups were set up: Control group: T cells activated by combined stimulation with CD3 / CD28 antibodies, serving as a positive control to reflect the level of immune function when T cells are fully activated; PBS group: Tumor cells were treated with PBS only and then co-cultured with T cells as a blank control group to simulate the natural inhibitory state of T cells by the tumor microenvironment; Scri@NV group: Tumor cells treated with Scri@NV were co-cultured with T cells as a negative control. The dose was 10.0 µg / mL (in NVs). si@NV group: Tumor cells were treated with si@NV at a dose of 10.0 µg / mL (in NVs). si@S15ab group: Tumor cells were treated with si@S15ab at a dose of 10.0 µg / mL (S15ab-NVs). Experimental group, The YTHDF2 siRNA dose was 50 nM, and CD4 was detected by flow cytometry. + Changes in the proportion of T cells, results as follows: Figure 6 As shown; Figure A shows the flow scatter plots for different treatment groups; Figure B shows the CD4 values ​​for different treatment groups. + A bar chart showing the statistical proportion of cells; CD8 detection by flow cytometry + Changes in the proportion of T cells, results as follows: Figure 7 As shown; Figure A shows the flow scatter plots for different treatment groups; Figure B shows the CD8 values ​​for different treatment groups. + A bar chart showing the statistical proportion of cells; from Figure 6 and Figure 7 It can be seen that compared with the PBS, Scri@NV, and si@NV groups, the si@S15ab treatment group had lower CD4 counts. + and CD8 + The proportion of T cells increased significantly, suggesting that this nanosystem can effectively relieve the inhibition of T cells by tumor cells and promote the activation of effector T cells.

[0100] The IFN-γ secretion level in the culture supernatant was detected by ELISA, and the results are as follows: Figure 8 As shown in the figure, the release of IFN-γ in the si@S15ab treatment group was significantly increased, indicating that the T cell immune response was effectively activated.

[0101] Simultaneously, tumor cell apoptosis was detected by flow cytometry and LDH release assay, and the results were as follows: Figure 9 As shown in the figure, the proportion of tumor cell apoptosis in the si@S15ab treatment group increased significantly, indicating that the nanosystem can enhance the T cell-mediated tumor cell killing effect. Figure A shows a flow scatter plot of different treatment groups, and Figure B shows a bar chart of LDH release rates of different treatment groups.

[0102] Test Example 3 Four experimental groups were set up as follows: PBS: Tumor cells were treated with PBS alone and then co-cultured with T cells as a blank control group to simulate the natural inhibitory effect of the tumor microenvironment on T cells. Scri@NV: Tumor cells treated with Scri@NV were co-cultured with T cells as a negative control. The dose was 10.0 µg / mL (in NVs). si@NV group: Tumor cells were treated with si@NV at a dose of 10.0 µg / mL (NVs) and YTHDF2 siRNA at a dose of 50 nM. si@S15ab group: Tumor cells were treated with si@S15ab at a dose of 10.0 µg / mL (S15ab-NVs) and YTHDF2 siRNA at a dose of 50 nM.

[0103] To clarify the regulatory role of si@S15ab in the tumor immune microenvironment, macrophages were co-incubated with different treatment groups, and the expression of immune markers on the macrophage surface was detected by flow cytometry. The results are as follows: Figure 10 As shown in the figure, the proportion of pro-inflammatory M1 macrophages in the si@S15ab treatment group was significantly increased, while the proportion of anti-inflammatory M2 macrophages was correspondingly decreased. This result confirms that si@S15ab can effectively promote macrophage phenotype polarization towards M1. Figure A shows the flow scatter plots for different treatment groups, and Figure B shows the CD86 values ​​for different treatment groups. + A bar chart showing the statistical proportion of cells.

[0104] Test Example 4 By constructing a GL261-Luc orthotopic glioblastoma mouse model, we verified the tumor targeting ability and blood-brain barrier penetration efficiency of si@S15ab-TPA in the orthotopic brain tumor model. After the tumor stabilized, different delivery systems (siNPs, si@S15ab-TPA and si@S15ab) were injected via tail vein. The dosage for each treatment group was 0.284 mg / kg based on YTHDF2 siRNA and 7.4 mg / kg based on S15ab-NVs. The distribution and accumulation of the delivery system in mice were dynamically monitored using a small animal in vivo fluorescence imaging system. The results are as follows: Figure 11 As shown in the figure, compared with other control delivery systems, si@S15ab-TPA showed more significant signal enrichment in the brain tumor region, indicating that the nanosystem can efficiently cross the blood-brain barrier and specifically accumulate in tumor tissue. In the figure, BL is the baseline, which refers to the autoluminescence signal at the tumor site in mice before injection, representing the location of the tumor; FL stands for fluorescence imaging, 2h refers to 2 hours after injection, and 12h refers to 12 hours after injection.

[0105] Test Example 5 The in vivo antitumor effect of si@S15ab-TPA in an orthotopic brain tumor model was evaluated by constructing a GL261-Luc orthotopic glioblastoma mouse model.

[0106] Five experimental groups were set up: PBS, si@NV (dose of 10.0 µg / mL based on NVs, YTHDF2 siRNA dose of 0.284 mg / kg), Scri@NV-TPA, si@NV-TPA (dose of 10.0 µg / mL based on NVs), and si@S15ab-TPA (dose of 10.0 µg / mL based on S15ab-NVs, YTHDF2 siRNA dose of 0.284 mg / kg).

[0107] In a GL261-Luc orthotopic brain tumor mouse model, different delivery systems were administered via tail vein injection, and tumor bioluminescence imaging was measured at 8, 11, 14, 17, 20, and 23 days post-injection. The results are as follows: Figure 12 As shown in the figure, it can be seen that compared with the PBS group, the tumor bioluminescence signal in the si@S15ab-TPA treatment group was significantly reduced, indicating that tumor growth was significantly inhibited.

[0108] To further investigate its anti-tumor effects, this invention uses flow cytometry to examine the tumor immune microenvironment. The results show that... Figure 13 , Figure 14 and Figure 15 As shown.

[0109] Figure 13 The graph shows the polarization status of macrophages as detected by flow cytometry. Compared to other control groups, the si@S15ab-TPA treatment group showed a higher concentration of pro-inflammatory M1 macrophages (CD11b) in tumor tissue. + F4 / 80 + CD86 + The proportion of ) has increased significantly; Figure A shows a flow scatter plot of different treatment groups, and Figure B shows a quantitative statistical bar chart of different treatment groups.

[0110] Figure 14 It is a flow cytometry method for detecting CD8 in tumor tissue. + The figure shows the cytotoxic T cell infiltration status: CD8 in the si@S15ab-TPA treatment group. + The T cell infiltration rate reached 50.3%, significantly higher than other groups, indicating that this nanosystem can effectively break the immunosuppression of the tumor microenvironment and significantly enhance CD8. + Infiltration of cytotoxic T cells; Figure A shows a flow scatter plot of different treatment groups, and Figure B shows a quantitative statistical bar chart of different treatment groups.

[0111] Figure 15 It is a flow cytometry method for detecting CD4 in tumor tissue. +The figure shows the presence of helper T cell infiltration: CD4 in the si@S15ab-TPA treatment group. + The proportion of T cells was significantly higher in the group than in other groups; Figure A shows a flow scatter plot of different treatment groups, and Figure B shows a quantitative statistical bar chart of different treatment groups.

[0112] Test Example 6 To systematically evaluate the in vivo biosafety of the si@S15ab-TPA delivery system, this invention evaluates it from both histological and serum biochemical perspectives.

[0113] First, on day 7 post-treatment, histopathological analysis was performed on major organs of the mice, including the heart, liver, spleen, lungs, and kidneys. Figure 16 As shown in the figure, it can be seen that no obvious pathological changes were observed in the major organs of the PBS and si@S15ab-TPA treatment groups, and there were no abnormal manifestations such as inflammatory infiltration, tissue necrosis or structural disorder. This result preliminarily confirms that si@S15ab-TPA has no obvious toxic side effects on important organs.

[0114] In addition, liver and kidney function parameters were examined, including alanine aminotransferase (ALT), aspartate aminotransferase (AST), creatinine (CREA), blood urea nitrogen (BUN), and uric acid (UA). The results are as follows: Figure 17 As shown in the figure, all indicators are within the normal range, and the si@S15ab-TPA delivery system will not cause acute liver and kidney damage.

[0115] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for preparing a responsive RNA delivery system for glioma, characterized in that, Includes the following steps: S100. Using engineered HEK293T cells with surface resistance to Siglec-15 scFv as raw materials, Siglec-15 scFv modified nanomembrane vesicles I were prepared. Among them, Siglec-15 scFv is a single-chain antibody fragment of sialic acid-binding immunoglobulin-like lectin-15; S200, DSPE-TK-PEG 5000 - ANG-2 conjugate is inserted into the surface of nanomembrane vesicle I to obtain nanomembrane vesicle II that are simultaneously modified with Siglec-15 scFv and ANG-2; S300. Add the aqueous phase containing YTHDF2 siRNA dropwise to the organic phase containing G0-C14, stir until homogeneous, and obtain the primary complex. S400. The primary complex is added to an aqueous solution containing acid-responsive charge-reversible polylysine, and a self-assembly reaction is carried out to form nanoparticles III loaded with YTHDF2 siRNA. S500. Using the nanomembrane vesicles II and the nanoparticles III, a responsive RNA delivery system for glioma is prepared.

2. The method for preparing a responsive RNA delivery system for glioma as described in claim 1, characterized in that, In step S100, engineered HEK293T cells with surface resistance to Siglec-15 scFv were constructed using transfection. The vectors required for the transfection method include two lentiviral packaging vector plasmids, psPAX2 and pMD2.G, and one lentiviral expression vector plasmid, scFv-PCDH-CMV-EF1A-copGFP-T2A-PURO. The mass ratio of psPAX2, pMD2.G, and scFv-PCDH-CMV-EF1A-copGFP-T2A-PURO is 1:(1-2):(1.5-2.5). The transfected cells used in the transfection method were selected from HEK293T cells.

3. The method for preparing a responsive RNA delivery system for glioma as described in claim 1, characterized in that, In step S200, the DSPE-TK-PEG 5000 -ANG-2 conjugate with DSPE-TK-PEG 5000 It is prepared by coupling reaction using -Mal and ANG-2 as raw materials.

4. The method for preparing a responsive RNA delivery system for glioma as described in claim 1, characterized in that, In step S200, DSPE-TK-PEG 5000 The mass ratio of the -ANG-2 conjugate to the nanomembrane vesicle I is (15-25):

1.

5. The method for preparing a responsive RNA delivery system for glioma as described in claim 1, characterized in that, In step S300, the solvent of the organic phase is selected from N,N-dimethylformamide.

6. The method for preparing a responsive RNA delivery system for glioma as described in claim 1, characterized in that, In step S400, the acid-responsive charge-reversible polylysine is mPEG. 113 -b-Plys 120 / CA; mPEG 113 -b-Plys 120 / CA represents polyethylene glycol-b-polylysine modified with aconitic anhydride.

7. The method for preparing a responsive RNA delivery system for glioma as described in claim 1, characterized in that, In step S500, the mass ratio of the nanomembrane vesicle II to the nanoparticle III is (1.5~2.5):

1.

8. The method for preparing a responsive RNA delivery system for glioma as described in claim 1, characterized in that, The method used to prepare Siglec-15 scFv modified nanomembrane vesicles I and to prepare a responsive RNA delivery system for glioma was membrane extrusion.

9. A responsive RNA delivery system for glioma, characterized in that, It was prepared using the preparation method of the responsive RNA delivery system for glioma as described in any one of claims 1 to 8.

10. Application of a responsive RNA delivery system for glioma, characterized in that, A medicament for the treatment of gliomas was prepared using the responsive RNA delivery system for gliomas as described in claim 9.