Application of bifidobacterium breve in preventing and / or improving pulmonary symptoms caused by influenza virus infection

Abstract

The invention discloses application of bifidobacterium breve in prevention and / or improvement of pulmonary symptoms caused by influenza virus infection. The invention provides application of Bifidobacterium breve in preparation of a composition for preventing and / or improving pulmonary symptoms caused by influenza virus infection, the Bifidobacterium breve FeiHeB16 strain has been preserved in China General Microbiological Culture Collection Center (CGMCC), the preservation number is CGMCC No.34753, and the preservation date is June 4, 2025. The invention further provides application of the Bifidobacterium breve FeiHeB16 strain in preparation of the composition for preventing and / or improving the pulmonary symptoms caused by the influenza virus infection, and the application of the Bifidobacterium breve FeiHeB16 strain in preparation of the composition for preventing and / or improving the pulmonary symptoms caused by the influenza virus infection in preparation of the composition for preventing and / or improving the pulmonary symptoms caused by the influenza virus infection. The invention creatively discovers that the Bifidobacterium breve FeiHeB16 strain can be used for effectively relieving various symptoms, caused by influenza virus infection, of the lung.

Description

Technical Field

[0001] This invention relates to the application of Bifidobacterium breve in the prevention and / or improvement of pulmonary symptoms caused by influenza virus infection, and belongs to the field of biotechnology. Background Technology

[0002] In recent years, various viruses have continued to evolve, constantly impacting the human immune system and leading to varying degrees of infection in different populations, especially susceptible individuals. Respiratory viral infections account for approximately 80% of respiratory illnesses. After entering the body through the respiratory tract, the virus multiplies within the respiratory mucosal epithelial cells, causing localized respiratory infections. Common respiratory viral infections include respiratory syncytial virus (RSV), influenza virus, adenovirus, coronavirus, and rhinovirus.

[0003] Influenza virus is a single-stranded RNA virus belonging to the Orthomyxoviridae family. It is highly variable in antigenicity and has strong pathogenicity, causing numerous global epidemics. Influenza virus infection can cause acute respiratory infection, manifesting as high fever, body aches, and significant fatigue; in severe cases, it can lead to death. A crucial factor determining the severity of the illness is the host's immune response, and the Toll-like receptor (TLR) signaling pathway plays a vital role in this process. TLRs are a class of pattern recognition receptors (PRRs), important molecules of the innate immune system. They are widely distributed, expressed not only in various immune cells but also in large quantities in the first line of defense of the innate immune system, such as the respiratory tract, intestinal epithelium, and vascular endothelium. To date, 13 types of TLRs have been identified in mammals, including 10 in humans (TLR1-TLR10), TLR11 which is only found in mice, and TLR12 and TLR13 which are found in rats and mice. TLRs can recognize multiple pathogen-associated molecular patterns (PAMPs), including nucleic acids, proteins, lipopolysaccharides, or synthetic analogs of invading pathogens. Once a PAMP is recognized, it transmits a signal to the corresponding downstream signaling pathway, activating the body's innate immunity to clear the invading pathogen.

[0004] There are two main pathways for TLR signal transduction: the Myeloid Differentiating Factor 88 (MyD88)-dependent TLR signal transduction pathway and the MyD88-independent signal transduction pathway. TLR3 primarily mediates the MyD88-independent TLR signaling pathway, while TLR4 can mediate both pathways simultaneously. In addition, TLR1, TLR2, TLR5, TLR6, TLR7, TLR8, TLR9, and TLR11 can all mediate the MyD88-dependent TLR signaling pathway.

[0005] The MyD88-dependent signaling pathway. MyD88 is a key adaptor protein in the TLR signaling pathway, composed of 196 amino acid residues. Its C-terminus is a TIR domain. When TLRs bind to their receptors, MyD88 can be activated via its TIR domain, TIR domain-containing adaptor protein (TIRAP), and the TIR domain at its C-terminus. Its N-terminus is a death domain (DD), which is the structural basis for binding to and activating the downstream adaptor molecule IL-1 receptor-associated kinase (IRAK). Activated IRAAK is then activated by structural modification of the E3 ubiquitination ligase-tumor necrosis factor receptor-associated factor 6 (TRAF6). Activated TRAF6 recruits transforming growth factor-β-activated kinase 1 (TAK1) and forms a complex with TAK1 binding proteins 1 and 2 (TAB1 / 2), thereby activating TAK1. Subsequently, it continues to activate the nuclear factor-kappa B (NF-κB) pathway and the mitogen-activated protein kinase (MAPK) pathway, and recruits interferon regulatory factor 7 (IRF7). After translocating into the cell nucleus, IRF7 initiates the transcription of the type I interferon (IFN-I) gene and further induces the expression of interferon-stimulated genes (ISGs), putting the body into an antiviral state.

[0006] The MyD88-independent signaling pathway. Both TLR3 and TLR4 can mediate the MyD88-independent signaling pathway and induce the production of type I interferon. The TIR domain-containing adapter-inducing interferon-β (TRIF) is a key protein in this pathway, but there is a difference between the two: TLR3 can directly transduce signals downstream via TRIF, while TLR4 must interact with TRIF through a TRIF-related adapter molecule (TRAM) before it can further transduce signals downstream. Once activated, TRIF can, on the one hand, transmit signals sequentially to TRAF6 and TAK1, ultimately activating NF-κB and MAPK; on the other hand, TRIF can also bind to IκB kinase (IKKs) and TANK (TRAF family member-associated NF-κB activator, TANK), linking kinase 1 (TBK1), and then induce phosphorylation and activation of interferon regulatory factor 3 (IRF3), inducing IFN-β expression, ultimately leading to the expression of interferon-induced genes.

[0007] Probiotics can regulate the body's immunity by activating IFN-I related pathways through multiple levels of action. These mechanisms mainly involve immune regulation, microbiome interaction, and the gut-lung axis. Studies by Kim et al. have shown that palmitic acid, a metabolite of *Lactobacillus paracasei* MI29, can enhance IFN-I signaling and resist influenza virus infection in vivo, reduce weight loss, lung damage, and viral load in influenza virus-infected mice, thus protecting the host from influenza infection (cite reference 1).

[0008] Reference 2 discloses a strain of *Bifidobacterium breve* that can resist influenza infection by improving the degree of weight loss, blood parameters, respiratory tract inflammation status, and significantly enhancing antiviral proteins in the lungs of influenza mice. Reference 3 discloses a strain of *Bifidobacterium longum* that can beneficially modulate the immune response to respiratory viral infections and treat viral infections by regulating the interferon response to viruses.

[0009] References 2 and 3 have certain limitations. Reference 2 only explored the effect of a specific strain of *Bifidobacterium breve* on improving influenza virus infection symptoms and its influence on the expression of an antiviral protein, without investigating the specific mechanism by which this strain exerts its antiviral function. Furthermore, the functions of other strains of *Bifidobacterium breve* remain unknown. Reference 3 mainly focuses on the effect of a strain of *Bifidobacterium longum* in alleviating viral infection symptoms and its regulatory effect on host cytokines. It also does not delve into the deeper and upstream mechanisms by which probiotics alleviate viral infection symptoms. Therefore, how *Bifidobacterium longum* regulates the immune system upstream of the pathway remains unknown, and it cannot better guide the application of this strain in improving viral infection symptoms and immune regulation.

[0010] References

[0011] Cited literature 1: Kim S, Lee S, Kim M N. Newly isolated Lactobacillus paracasei strain modulates lung immunity and improves the capacity to copewith influenza virus infection[J]. Microbiome, 2023, 11(1):260.

[0012] Reference 2: CN110055185A

[0013] Reference 3: CN110352237A Summary of the Invention

[0014] The problem the invention aims to solve

[0015] The technical problem to be solved by the present invention is to provide the use of Bifidobacterium breve (FeiHeB16) strain in the preparation of compositions for the prevention and / or improvement of pulmonary symptoms caused by influenza virus infection, wherein Bifidobacterium breve (FeiHeB16) strain can effectively regulate innate immunity through the TLR7-MyD88-TRAF6 pathway to respond to pulmonary symptoms caused by influenza virus infection.

[0016] Solution for solving the problem

[0017] [1]. Use of Bifidobacterium breve in the preparation of compositions for the prevention and / or improvement of pulmonary symptoms caused by influenza virus infection, wherein the Bifidobacterium breve includes Bifidobacterium breve FeiHeB16 strain, which has been deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 34753 and deposit date of June 4, 2025.

[0018] [2]. According to the use described in [1], wherein the Bifidobacterium breve FeiHeB16 strain enhances the expression of at least one of TLR7, MyD88, and TRAF6 in lung tissue.

[0019] [3]. According to the use described in [1] or [2], wherein the Bifidobacterium breve strain FeiHeB16 upregulates the TLR7-MyD88-TRAF6 signaling pathway in lung tissue.

[0020] [4]. According to any one of [1]-[3], wherein the Bifidobacterium breve FeiHeB16 strain increases the expression of at least one of MxA, Oas1a, Irf7 and Rsad2 in lung tissue.

[0021] [5]. According to any one of [1]-[4], wherein the Bifidobacterium breve FeiHeB16 strain enhances the expression of IFN-I in lung tissue,

[0022] Preferably, the Bifidobacterium breve (FeiHeB16) strain enhances the expression of IFN-β in lung tissue.

[0023] [6]. According to any one of [1]-[5], wherein the pulmonary symptoms caused by the influenza virus infection include at least one of elevated lung index, pulmonary inflammation, and elevated pulmonary influenza virus load.

[0024] [7]. The use according to any one of [1]-[6], wherein the lung inflammation includes at least one of: thickening of alveolar septa, inflammatory cell infiltration of alveolar walls, damage to alveolar structure, and inflammatory cell infiltration in alveolar cavities.

[0025] [8]. According to any one of [1]-[7], wherein the pulmonary symptoms caused by the influenza virus infection are pulmonary symptoms caused by influenza virus infection in the subject.

[0026] [9]. According to the use described in [8], wherein the subject includes mammals;

[0027] Preferably, the subject includes a human being.

[0028]

[10] . Use according to any one of [1]-[9], wherein the influenza virus includes the H1N1 influenza virus.

[0029] The effects of the invention

[0030] This invention provides the use of Bifidobacterium breve (FeiHeB16) strain in the preparation of compositions for the prevention and / or improvement of pulmonary symptoms caused by influenza virus infection. This invention has the following beneficial effects:

[0031] (1) It can effectively alleviate various lung symptoms caused by influenza virus infection, such as reducing lung index, reducing lung inflammation response, and reducing lung viral load. (2) In animal experiments, it was confirmed that the Bifidobacterium breve FeiHeB16 strain upregulated the TLR7-MyD88-TRAF6 innate immune antiviral signaling pathway in lung tissue, activated the type I interferon response in mouse lungs, and significantly upregulated the expression of lung interferon-stimulated genes (ISGs) and the level of IFN-β.

[0032] Therefore, this invention has creatively discovered that the *Bifidobacterium breve* strain FeiHeB16 has the effect of preventing and alleviating lung symptoms caused by influenza virus infection, and has great application prospects. Attached Figure Description

[0033] Figure 1 This shows the change in body weight in mice after influenza virus infection. (The figure shows...) "This represents p < 0.05", "This means p < 0.01.

[0034] Figure 2 The figure shows the lung index of mice after influenza virus infection. "This represents p < 0.05", "This means p < 0.001.

[0035] Figure 3The image shows H&E-stained pathological sections (magnification 10x) and pathological scores. The figure shows… "This means p < 0.01. Figure 3 (a) in the text represents the blank group; Figure 3 (b) in the table represents the H1N1 influenza virus infection group; Figure 3 (c) represents the Bifidobacterium breve FeiHeB16 intervention group; Figure 3 (d) represents the intervention group of Bifidobacterium longum subsp. BB16M6; Figure 3 (e) in the figure represents the Bifidobacterium breve BB22M22 intervention group; Figure 3 (f) in the figure represents the pathological score.

[0036] Figure 4 This represents the viral load in the mouse lungs. (See figure "...") "This means p < 0.01", "This means p < 0.001.

[0037] Figure 5 This represents the expression level of antiviral signaling pathway markers in mouse lung tissue. The figure shows… "This represents p < 0.05", "This means p < 0.01", "This means p < 0.001. Figure 5 (a) represents the expression level of TLR7; Figure 5 (b) represents the expression level of MyD88; Figure 5 (c) represents the expression level of TRAF6.

[0038] Figure 6 The figure shows the IFN-β level and ISG expression in mouse lung tissue. "This represents p < 0.05", "This means p < 0.01", "This means p < 0.001.

[0039] Figure 6 (a) represents the IFN-β level; Figure 6 In the table, (b) represents the expression level of MxA; Figure 6 In the table, (c) represents the expression level of Oas1a; Figure 6 In the figure, (d) represents the expression level of Rsad2; Figure 6 (e) in the figure represents the expression level of Irf7.

[0040] Preservation of biological materials

[0041] A strain of *Bifidobacterium breve*, FeiHeB16, has been taxonomically named *Bifidobacterium breve*. This strain is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 34753, on June 4, 2025, at the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. Detailed Implementation

[0042] Various exemplary embodiments, features, and aspects of the present invention will be described in detail below. The term "exemplary" as used herein means "serving as an example, embodiment, or illustration." Any embodiment described herein as "exemplary" is not necessarily to be construed as superior to or better than other embodiments.

[0043] Furthermore, to better illustrate the present invention, numerous specific details are set forth in the following detailed embodiments. Those skilled in the art should understand that the present invention can be practiced without certain specific details. In other instances, methods, means, apparatus, and steps well known to those skilled in the art have not been described in detail in order to highlight the spirit of the present invention.

[0044] Unless otherwise stated, all units used in this specification are international standard units, and all numerical values ​​and ranges appearing in this invention should be understood to include systematic errors that are unavoidable in industrial production.

[0045] In this specification, the word "may" has two meanings: to perform a certain process and not to perform a certain process.

[0046] In this specification, references to "some specific / preferred embodiments," "other specific / preferred embodiments," "implementation," etc., refer to specific elements (e.g., features, structures, properties, and / or characteristics) related to that embodiment, which are included in at least one of the embodiments described herein and may or may not be present in other embodiments. Furthermore, it should be understood that these elements may be combined in any suitable manner in various embodiments.

[0047] In this specification, the range of values ​​referred to as "value A to value B" refers to the range including the endpoint values ​​A and B.

[0048] In some aspects of the invention, the use of Bifidobacterium breve (FeiHeB16) strain in the preparation of compositions for the prevention and / or improvement of pulmonary symptoms caused by influenza virus infection is provided.

[0049] In some embodiments, the *Bifidobacterium breve* strain FeiHeB16 is derived from fecal samples of healthy infants in Wuxi City, Jiangsu Province. Sequencing analysis of this strain, with the sequence obtained and compared using NCBI Standard Nucleotide BLAST, revealed that this strain exhibited 99.80% homology with *Bifidobacterium breve* strain 2530. Therefore, this strain was identified as *Bifidobacterium breve* and named *Bifidobacterium breve* strain FeiHeB16.

[0050] In this specification, the Bifidobacterium breve strain FeiHeB16 is also referred to simply as Bifidobacterium breve FeiHeB16.

[0051] In one embodiment of the present invention, using a mouse model infected with influenza virus, the *Bifidobacterium breve* FeiHeB16 strain was verified to have the effect of preventing and / or improving lung symptoms caused by influenza virus infection. The *Bifidobacterium breve* FeiHeB16 strain can effectively alleviate various lung symptoms caused by viral infection, such as increased lung index and pulmonary inflammatory response (e.g., ...). Figures 1-3 (As shown).

[0052] In one embodiment of the present invention, the *Bifidobacterium breve* strain FeiHeB16 can significantly reduce the viral load in the lungs after influenza virus infection (e.g., ...). Figure 4 (As shown).

[0053] In one embodiment of the present invention, the *Bifidobacterium breve* FeiHeB16 strain can prevent and / or improve pulmonary symptoms (such as those caused by influenza virus infection) by upregulating the TLR7-MyD88-TRAF6 antiviral signaling pathway, activating the host type I interferon (IFN-I) response, and thereby promoting the expression of interferon-stimulated genes (ISGs). Figures 5-6 (As shown).

[0054] In some embodiments, the Bifidobacterium breve FeiHeB16 strain increases the expression of at least one of TLR7, MyD88, and TRAF6 in lung tissue, thereby preventing and / or improving lung symptoms caused by influenza virus infection.

[0055] As used in this invention, "TLR7" stands for Toll-like receptor 7.

[0056] As used in this invention, "MyD88" represents Myeloid differentiating factor 88.

[0057] As used in this invention, "TRAF6" stands for tumor necrosis factor receptor-associated factor 6 (TNF receptor-associated factor 6).

[0058] In some embodiments, the *Bifidobacterium breve* FeiHeB16 strain upregulates the TLR7-MyD88-TRAF6 signaling pathway in lung tissue.

[0059] In some embodiments, the Bifidobacterium breve FeiHeB16 strain can increase the expression of interferon-stimulated genes (ISGs) related proteins in lung tissue, thereby preventing and / or improving lung symptoms caused by influenza virus infection.

[0060] In some specific implementations, ISG-related proteins include MxA, Oas1a, Irf7, and Rsad2.

[0061] In some specific embodiments, the Bifidobacterium breve FeiHeB16 strain increases the expression of at least one of MxA, Oas1a, Irf7 and Rsad2 in lung tissue.

[0062] As used in this invention, "MxA" represents Myxovirus resistant protein A.

[0063] As used in this invention, “Oas1a” refers to 2′,5′-Oligoadenylate synthetase 1.

[0064] As used in this invention, "Irf7" stands for Interferon regulatory factor 7.

[0065] As used in this invention, "Rsad2" represents the radical S-adenosyl methionine domain containing 2.

[0066] In some embodiments, the Bifidobacterium breve FeiHeB16 strain increases the expression of IFN-I in lung tissue, thereby preventing and / or improving lung symptoms caused by influenza virus infection.

[0067] In some specific embodiments, the Bifidobacterium breve FeiHeB16 strain enhances the expression of IFN-β in lung tissue.

[0068] In some embodiments, the pulmonary symptoms caused by the influenza virus infection include at least one of elevated lung index, lung inflammation, and elevated influenza virus load in the lungs.

[0069] In some embodiments, the lung inflammation includes at least one of: thickening of alveolar septa, inflammatory cell infiltration of alveolar walls, damage to alveolar structure, and inflammatory cell infiltration within alveolar cavities.

[0070] In some embodiments, the pulmonary symptoms caused by the influenza virus infection are pulmonary symptoms caused by influenza virus infection in the subject.

[0071] In this specification, "subject" or "host" refers to a human or non-human animal, including mammals. Examples include primates (such as humans and monkeys), cattle, sheep, goats, alpacas, horses, dogs, cats, rabbits, rats, and mice. "Subject" or "host" includes therapeutic and non-therapeutic types. "Subject" or "host" also includes experimental animal models or animals used to produce biomolecules expressing therapeutic diseases, i.e., "non-therapeutic hosts" or "non-therapeutic subjects."

[0072] In some specific implementations, the subjects include mammals.

[0073] In some preferred embodiments, the subject includes a human being.

[0074] In some embodiments, the influenza virus includes the H1N1 influenza virus. In one embodiment of the invention, the Bifidobacterium breve FeiHeB16 strain is present in the composition in at least one of the following forms: live bacteria, culture, or microbial preparation.

[0075] In this invention, the term "culture" refers to a liquid or solid product (at least a portion of the substance within a culture container, such as supernatant) that has grown a microbial community after artificial inoculation and cultivation. That is, it is a product obtained by growing and / or amplifying microorganisms, which can be a biologically pure culture of microorganisms, or it can contain a certain amount of culture medium, metabolites, or other components produced during the cultivation process, or it can be a supernatant obtained by centrifugation.

[0076] In some embodiments, the culture is a product obtained by growing and / or amplifying microorganisms or a supernatant (cell-free supernatant) obtained by centrifuging the product.

[0077] In some embodiments, the microbial preparation of the present invention is a liquid, which may be a suspension or a culture. Furthermore, the microbial preparation may also contain a solvent, including but not limited to water or culture medium.

[0078] Furthermore, the microbial preparation may also contain a protectant (e.g., a lyophilization protectant), which includes, but is not limited to, skim milk powder, trehalose, monosodium glutamate, and / or glycerol.

[0079] In other embodiments, the microbial preparation of the present invention is a semi-solid, wherein the solid can be a bacterial sludge. The bacterial sludge refers to bacterial cells containing a small amount of moisture.

[0080] In some other embodiments, the microbial preparation of the present invention is a solid, which may be a lyophilized powder or the like.

[0081] In some embodiments, those skilled in the art can select an appropriate amount of Bifidobacterium breve FeiHeB16 strain contained in the composition based on factors such as the type of composition.

[0082] In some embodiments, the viable count of the *Bifidobacterium breve* FeiHeB16 strain in the composition is not less than 1 × 10⁻⁶. 6 CFU / mL or 1×10 6 Colony-forming units per gram (CFU / g).

[0083] In addition to the essential components described above, the compositions of this invention may include other optional ingredients depending on the needs of the final product, such as:

[0084] The product contains milk or protein components. The milk components include dairy products such as fresh milk, milk powder, whey protein, or cheese derived from raw cow (sheep) milk. The protein components may be derived from plant proteins, such as soy protein or peanut protein.

[0085] Plants or plant extracts, including fruits such as fig, pomegranate, kiwi, orange, tangerine, pineapple, strawberry, apple, rubber, grape, pear, cherry, blueberry, blackberry, blackcurrant, cranberry, raspberry, melon, amla, and bilberry, or their extracts; fruits and vegetables such as onion, cucumber, tomato, cauliflower, carrot, spinach, kale, Brussels sprouts, garlic, basil, and oregano, or their extracts; grains such as rice (indica, japonica, glutinous rice), cereals (wheat, barley, oats, rye), corn, sorghum, millet, foxtail millet, yellow millet, buckwheat, soybean, broad bean, pea, mung bean, red bean, and kidney bean, or their extracts; nuts such as walnut, pistachio, cashew, hazelnut, almond, apricot kernel, pine nut, peanut, sunflower seed, chestnut, macadamia nut, and ginkgo, or their extracts; and coffee or its extracts.

[0086] Animal-derived ingredients, including meat products from cattle, sheep, fish, or poultry.

[0087] The fat component may include at least one of saturated fatty acids, polyunsaturated fatty acids, monounsaturated fatty acids, OPO structured lipids, DHA, EPA, ARA, and phospholipids. More specifically, the fat includes safflower seed oil, walnut oil, peanut oil, corn oil, soybean oil, argan oil, olive oil, tea oil, sacha inchi oil, coconut oil, perilla oil, deep-sea fish oil, cocoa butter, palm oil, tallow, cream, lard, medium-chain triglycerides, or lecithin, etc.

[0088] Functional additives include vitamins (one or more of vitamin A, beta-carotene, vitamin D3, vitamin E, vitamin K1, vitamin B1, vitamin B2, vitamin B6, vitamin B12, vitamin C, pantothenic acid, folic acid, niacin, choline, inositol, and biotin), starch, modified starch, amino acids (L-lysine-L-glutamic acid, L-glutamic acid, L-arginine, L-tryptophan, L-glutamine, taurine, L-valine, L-isoleucine, or L-leucine, etc.), traditional Chinese medicine or its extracts, and dietary fiber (inulin, konjac flour, galactooligosaccharides, fructooligosaccharides, isomaltooligosaccharides, soybean polysaccharides, cyclodextrin, resistant dextrin, or soybean fiber, etc.).

[0089] Micronutrient supplements may include metal ion salts of organic acids, such as one or more of the following: calcium citrate, L-calcium lactate, calcium hydrogen phosphate, potassium gluconate, sodium citrate, ferrous gluconate, potassium iodide, zinc gluconate, sodium selenite, copper gluconate, chromium sulfate, manganese gluconate, and magnesium gluconate.

[0090] Any acceptable excipients, including but not limited to solvents, antioxidants, antibacterial agents, thickeners, diluents, cosolvents, stabilizers, emulsifiers, fillers, disintegrants, lubricants, coating materials, anti-caking agents, flavoring agents, sweeteners, food flavorings, food colorings, etc.

[0091] The present invention does not specifically limit the type of the above-described compositions.

[0092] In some embodiments, the composition is a food product, such as a food composition.

[0093] In some embodiments, the composition is a nutritional food, a functional food, or a health food.

[0094] In some embodiments, the food products described in this invention may be infant formula, baby food, children's formula, children's snacks, formula milk powder for pregnant women, milk powder for middle-aged and elderly people, or nutritional or dietary supplements.

[0095] In some embodiments, the composition is a food additive.

[0096] In some embodiments, the composition is a drug, such as a pharmaceutical composition.

[0097] In this specification, "pharmaceutical composition" means containing one or more of the *Bifidobacterium breve* FeiHeB16 strains described herein, as well as other components such as physiological / pharmaceutical-grade carriers and excipients. The purpose of the pharmaceutical composition is to facilitate administration to the organism, thereby promoting the absorption of the active ingredient and the exertion of its biological activity.

[0098] In some embodiments of the present invention, the drug contains Bifidobacterium breve FeiHeB16 strain, a drug carrier, and / or pharmaceutical excipients.

[0099] In this specification, the term "pharmaceutical acceptable" (or "pharmacologically acceptable", "medicinal") means a molecular entity or composition that, when appropriate, does not produce an adverse reaction, allergic reaction, or other adverse reaction when administered to animals or humans. As used herein, the term "pharmaceutical acceptable carrier" includes any and all solvents, dispersion media, coatings, antimicrobial agents, isotonic agents and absorption delay agents, buffers, excipients, binders, lubricants, gels, surfactants, etc., that can be used as a medium for pharmaceutically acceptable substances.

[0100] In some embodiments, the composition is a probiotic product.

[0101] In some specific implementations, the probiotic product is a probiotic product with good intestinal adaptability, and the product contains the above-mentioned Bifidobacterium breve FeiHeB16 strain, the above-mentioned culture, or the above-mentioned microbial preparation.

[0102] In some exemplary embodiments, the probiotic product may be a probiotic powder.

[0103] In some preferred embodiments, the viable count of the *Bifidobacterium breve* FeiHeB16 strain in the composition (e.g., probiotic products, milk powder, etc.) is approximately 1 × 10⁻⁶. 7 CFU / mL or 1×10 7 CFU / mL or higher, 1×10 8 CFU / mL or 1×10 8 CFU / mL or higher, or 1×10 9 CFU / g or 1×10 9 CFU / mL or higher, for example, 2.5 × 10⁻⁶. 9 CFU / g or 2.5×10 9 CFU / mL, 5×10 9 CFU / g or 5×10 9 CFU / mL, 2.5×10 10 CFU / g or 2.5×10 10 CFU / mL, 5×10 10 CFU / g or 5×10 10 CFU / mL and 2.5×10 11 CFU / g or 2.5×10 11 CFU / mL, 5×10 11 CFU / g or 5×10 11 CFU / mL, etc.

[0104] In some exemplary embodiments, the viable count of the *Bifidobacterium breve* FeiHeB16 strain in the composition (e.g., probiotic products, milk powder, etc.) is approximately 1 × 10⁻⁶. 6 CFU / g or 1×10 6 CFU / mL up to 5×10 11 CFU / g or 5×10 11 CFU / mL.

[0105] The present invention does not particularly limit the specific form of the composition for different composition categories; for example, it may be in powder or liquid form.

[0106] The present invention does not specifically limit the target population of the composition; for example, the composition can be used for infants, children, adolescents or adults.

[0107] In some specific embodiments, the composition of the present invention may be infant formula, baby food, children's formula, children's snacks, formula milk powder for pregnant women, milk powder for middle-aged and elderly people, or nutritional or dietary supplements.

[0108] In other specific embodiments, the composition of the present invention may be a powdered reconstituteable food (solid beverage, instant coffee, cereal powder, nut powder or lotus root powder, etc.), baked goods (bread, cake or biscuit baked goods, etc.), beverages (carbonated beverages, fruit and vegetable juice beverages, functional beverages, tea beverages, milk beverages or alcoholic beverages, etc.), candy (gel candy, hard candy, compressed candy, etc.), milk and dairy products (fresh milk, milk powder, whey powder, fermented milk, cheese or condensed milk, etc. derived from fresh cow (sheep) milk), pasta products (noodles, instant noodles, steamed buns, dumplings or wontons, etc.), etc.

[0109] In some other specific embodiments, the composition of the present invention is an oral preparation, including but not limited to tablets, pills, granules, powders, teas, capsules, or oral liquids.

[0110] Example

[0111] The embodiments of the present invention will be described in detail below with reference to examples. However, those skilled in the art will understand that the following examples are for illustrative purposes only and should not be considered as limiting the scope of the invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer are followed. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0112] The culture media involved in the following examples are as follows:

[0113] mMRS liquid medium: peptone 10 g / L, beef extract 10 g / L, glucose 20 g / L, anhydrous sodium acetate 2 g / L, yeast extract 5 g / L, diammonium hydrogen citrate 2 g / L, K2PO4·3H2O 2.6 g / L, MgSO4·7H2O 0.5 g / L, MnSO4·H2O 0.25 g / L, Tween 80 1 mL / L, L-cysteine ​​0.5 g / L; pH 6.8.

[0114] mMRS solid medium: Add 20 g / L agar to the mMRS (MRS containing L-cysteine) liquid medium.

[0115] The preparation method of Bifidobacterium breve cells involved in the following examples is as follows:

[0116] Bifidobacterium breve was streaked onto mMRS solid medium and cultured anaerobically at 37°C for 48 hours to obtain single colonies. A single colony was picked and inoculated into 5 mL of mMRS liquid medium and cultured anaerobically at 37°C for 18 hours to activate it. This activation was repeated for two generations to obtain an activated solution. The activated solution was inoculated into MRS liquid medium at a rate of 2% (v / v) and cultured anaerobically at 37°C for 18 hours to obtain a bacterial suspension. The bacterial suspension was centrifuged at 5000 rpm for 15 minutes, and the supernatant was discarded to obtain Bifidobacterium breve cells.

[0117] The following examples illustrate the processing and statistical analysis of experimental data: Continuous variable data are expressed as "mean ± standard error of mean" (Mean ± SEM). The Shapiro-Wilk test was used to analyze whether the experimental data conformed to a normal distribution, and the Brown-Forsythe test was used to test whether the data conformed to homogeneity of variance. If the data were normally distributed and had homogeneity of variance, one-way analysis of variance (ANOVA) was used, with the Tukey test used as a post-hoc test. If the data were not normally distributed or had unequal variances, the Kruskal-Wallis test was used, with Dunn's test used as a post-hoc test. A p-value < 0.05 was used as the threshold to determine the significance of differences between groups.

[0118] Example 1: Isolation and Identification of Strains

[0119] The specific steps are as follows:

[0120] 1. Separation and identification

[0121] Take 0.5 mL of stool sample from a healthy infant and add it to 4.5 mL of sterile saline for serial dilution. Divide the sample into two portions, each 100 μL, with a dilution gradient of 10. -4 10 -5 10 -6 The diluted solution was plated on mMRS solid medium with added mupirocin at pH 6.8, and anaerobically incubated at 37°C for 48 h. The colony morphology was observed and recorded.

[0122] Different morphological colonies were picked from the solid culture medium and streaked for isolation. After anaerobic culture at 37℃ for 48 h, different morphological single colonies were picked from the solid culture medium again and streaked for isolation until pure single colonies with consistent morphology were obtained.

[0123] Pure colonies from the solid culture medium were inoculated into 5 mL of liquid culture medium and anaerobically cultured at 37℃ for 18 h. 1 mL of bacterial solution was placed in a sterile centrifuge tube, centrifuged at 5000 r / min for 15 min, and the upper culture medium was discarded. The bacterial sludge was resuspended in 30% glycerol solution and stored at -80℃.

[0124] The isolated strains were identified using PCR amplification of 16S rDNA. The sequencing results were then compared with the NCBI standard Nucleotide BLAST sequence, yielding three Bifidobacterium strains: *Bifidobacterium breve* FeiHeB16, BB22M22, and *Bifidobacterium longum* subsp. BB16M6.

[0125] 2. 16S rDNA sequence of Bifidobacterium breve FeiHeB16 (SEQ ID NO: 1)

[0126]

[0127] Note that "N" represents any one of A, G, C, and T.

[0128] Example 2: Effect of Bifidobacterium on body weight of mice infected with influenza virus

[0129] The experimental protocol for screening the antiviral effects of infant-derived probiotics based on a mouse model of influenza virus infection is as follows:

[0130] I. Bacterial strain culture and preparation of oral bacterial suspension

[0131] Bacterial culture from the preservation tube was streaked onto an mMRS plate using a sterile inoculation loop. The plates were then incubated upside down at 37°C for 48 h. Next, single colonies were selected and inoculated into mMRS liquid medium. After incubation at 37°C for 18 h, the culture was activated for three generations with a 2% inoculation rate. A portion of the culture was collected and the bacterial concentration was calculated using the pour plate count method. The remaining culture was centrifuged at 8000 × g at 4°C for 10 min, the supernatant was discarded, and the cells were collected in glycerol tubes and stored at -80°C. Based on the counting results, the cells were washed with 0.9% physiological saline, and the bacterial concentration was adjusted to 5 × 10⁻⁶. 9 CFU / mL (colony-forming units per milliliter) is used for subsequent experiments.

[0132] II. Animal Experiment Design

[0133] Three-week-old female C57BL / 6J mice were selected for the experiment. Mice had free access to food and water. After a one-week acclimatization period, the mice were randomly divided into five groups (n=10 per group): a blank group, an A / FM1 / 47 (H1N1) influenza virus infection group, a *Bifidobacterium breve* FeiHeB16 intervention group, a *Bifidobacterium breve* BB22M22 intervention group, and a *Bifidobacterium longum* subsp. *longum* BB16M6 intervention group. From day 8 to 28, mice in the blank group and the virus infection group were administered 200 μL of PBS solution by gavage. The three probiotic intervention groups were administered 200 μL of probiotic solution by gavage. The dosage per mouse was 1 × 10⁻⁶ mg / day. 9 CFU. From day 22 to 28, except for the control group, the other four groups of mice were anesthetized on day 22 and administered a sublethal dose (1×10⁻⁶ CFU). 3 Intranasal infection was performed using influenza A / FM1 / 47 (H1N1) in PBS containing PFU (Plaque Forming Unit). Mice were anesthetized with isoflurane on day 29, and blood was collected from the eyeballs. Mice were then euthanized by dislocation for sampling. The experimental protocol and procedures were approved by the Animal Ethics Committee of Yangzhou University (No. 202406009).

[0134] Mice were infected with influenza virus on day 22 of the experiment, and their weight was measured daily until day 29 when the mice were sacrificed. The results are as follows: Figure 1 As shown, compared with the control group, mice in the H1N1 group began to lose weight continuously from the second day after infection. Within a week after infection, the three Bifidobacterium groups had varying degrees of alleviating effect on influenza-induced weight loss. At the time of mouse sacrifice, the weight loss rates of mice in the *Bifidobacterium breve* FeiHeB16 group and the *Bifidobacterium longum* subspecies BB16M6 group (11.33% and 11.99%, respectively) were significantly lower than those in the H1N1 group (16.57%), while the alleviating effect of *Bifidobacterium breve* BB22M22 was not significant. This indicates that the intervention effect of Bifidobacterium is strain-specific, and that *Bifidobacterium breve* FeiHeB16 is more effective than the other two strains.

[0135] Example 3: Effect of Bifidobacterium on Lung Index of Influenza Virus in Mice

[0136] The animal experiment protocol is the same as steps one and two in Example 2. On day 22, after mice were infected with the influenza virus, their weight was measured daily until day 29 when the mice were sacrificed. Lung tissue was removed and weighed after mouse sacrifice, and the lung weight / body weight ratio (g / g) was calculated to obtain the lung index (%). The lung index results are as follows... Figure 2 As shown, compared with the control group, the H1N1 group mice experienced a significant increase in lung index (the ratio of lung weight to body weight) due to lung inflammation after infection (p < 0.001). However, after intervention with *Bifidobacterium breve* FeiHeB16, the lung index of the mice decreased significantly compared with the infection model group (p < 0.05), indicating that the increase in lung index caused by viral infection in mice was significantly alleviated. In contrast, intervention with *Bifidobacterium breve* BB22M22 and *Bifidobacterium longum* BB16M6 only showed a certain degree of alleviation in the increase in lung index after viral infection in mice. This indicates that the intervention effect of Bifidobacteria on the lung index of mice infected with H1N1 influenza virus is strain-specific, and *Bifidobacterium breve* FeiHeB16 is more effective than the other two strains.

[0137] Example 4: Effects of Bifidobacterium on Lung Inflammatory Response in Influenza Virus-Infected Mice

[0138] The animal experimental protocol was the same as steps one and two in Example 2. After euthanasia, the left lung lobe of mice was harvested, fixed with 4% paraformaldehyde, then embedded in paraffin, and sectioned to a thickness of 5 micrometers (μm). After HE staining, destaining, clearing, and mounting, microscopic images were acquired using a digital scanner (Pannoramic, 3DHISTECH, Hungary) and pathological scoring was performed. A blinded scoring method was used, with the scoring system based on the degree of lung tissue destruction, epithelial cell layer damage, and polymorphonuclear cell infiltration.

[0139] Pathological scoring criteria (Reference: Liu Guoxing, Huang Yuanming, Cheng Miao, et al. Effects of H1N1 influenza virus infection on lung injury and gut microbiota in mice [J]. Disease Surveillance, 2021, 36(7): 689-695.):

[0140] 0 points—Intact alveolar walls without thickening, inflammatory infiltration, or congestion; 1 point—Mild diffuse inflammatory cell infiltration (neutrophils) in the alveolar walls, with no significant thickening; 2 points—Significant and widespread inflammatory cell infiltration (neutrophils and monocytes), with slight thickening of the alveolar walls (1-2 times); 3 points—Severe inflammatory cell infiltration, with alveolar walls thickened to 3-5 times in some areas; 4 points—Severe inflammatory cell infiltration, with significant thickening of the alveolar walls, and 25%-50% lung tissue consolidation; 5 points—Severe inflammatory cell infiltration, with significant thickening of the alveolar walls, and >50% lung tissue consolidation.

[0141] Lung pathological sections showed ( Figure 3 In sections (a)-(e) of the normal mice (blank group), the lungs showed intact alveolar structure, thin alveolar walls, clear alveolar cavities, no obvious inflammatory infiltration or tissue lesions, and intact airway structure. In contrast, the sections of the H1N1 group showed obvious pathological changes, specifically: thickened alveolar septa, significant inflammatory cell infiltration in the alveolar walls, mainly lymphocytes and monocytes; partial alveolar structural damage, with local alveolar cavities showing inflammatory cell infiltration, accompanied by mild to moderate interstitial edema and fibrosis; and obvious inflammatory infiltration around the airways, indicating a relatively significant inflammatory response. In the intervention groups, the lungs of the FeiHeB16, BB16M6, and BB22M22 mice showed mild lesions, mild alveolar wall thickening, mild inflammatory cell infiltration, and the overall alveolar structure remained relatively clear, with local mild inflammatory responses and mild thickening of the pulmonary interstitium. The overall degree of lesions was milder than that of the H1N1 group. According to the pathological scores of the tissue sections, the inflammatory response was significantly reduced after intervention in the groups of Bifidobacterium breve FeiHeB16, BB22M22, and Bifidobacterium longum subsp. BB16M6. Compared with the H1N1 group, the pathological scores of the three groups were significantly lower, with Bifidobacterium breve FeiHeB16 having the lowest score. Figure 3 (f)). In addition, compared with the blank group, the H1N1 group of mice showed significantly increased inflammatory response and interstitial fibrosis, indicating that influenza virus infection has a significant damaging and inflammatory inducing effect on lung tissue, and the influenza virus infection model was successfully established.

[0142] Example 5: Effect of Bifidobacterium on viral load in the lungs of influenza virus-infected mice

[0143] 1. Experimental reagents

[0144] RNA extraction kit, Novizan Biotechnology FastPure Complex Tissue / Cell Total RNA Isolation Kit, catalog number RC113-01, specification 50 rxns; RNA reverse transcription kit, Novizan Biotechnology HiScript IV All-in-One Ultra RT SuperMix for qPCR, catalog number R433-01, specification 100 rxns; SYBR Green I fluorescent dye, Novizan Biotechnology SYBR Green I nucleotide colloidal dye, catalog number JC2002-00.

[0145] 2. Experimental Methods

[0146] The animal experimental protocol was the same as steps one and two in Example 2. Mice were sacrificed on day 29, and mouse lung tissue was collected and placed in 1 mL of cryoprotectant, then frozen at -80°C for later use. Viral nucleoprotein (NP) protein in mouse lung tissue was detected using qPCR. Specifically, the lung tissue sample was thawed on ice, and total RNA was extracted from the mouse lung tissue using an RNA extraction kit. cDNA was then obtained by reverse transcription. Based on SYBR Green I fluorescent dye, the expression level of the target gene was detected by real-time quantitative PCR, with GADPH as an internal control gene. -ΔΔ CT scans were used for data standardization analysis.

[0147] GADPH primer sequence (5'-3')

[0148] Forward (SEQ ID NO: 2): AATGGTGAAGGTCGGTGTGAAC,

[0149] Reverse (SEQ ID NO: 3): GCCTTGACTGTGCCGTTGAA.

[0150] NP primer sequence (5'-3')

[0151] Forward (SEQ ID NO: 4): GGCACCAAACGGTCTTACGA,

[0152] Reverse (SEQ ID NO:5): TCACCTGATCAACTCCATTACCA.

[0153] 3. Experimental Results

[0154] Following influenza virus infection, viral load in the lungs can characterize the degree of viral infection and replication. This experiment used qPCR to detect the expression level of the H1N1 viral protein (NP) gene (NP sequence UniProt ID: P03466), and the results are as follows: Figure 4The results showed that, compared with the virus-infected group (H1N1), the reduction in viral load in the lungs of mice in both the *Bifidobacterium breve* FeiHeB16 and *Bifidobacterium longum* subspecies BB16M6 groups was significant, indicating that these two strains could better inhibit the replication of H1N1 virus than *Bifidobacterium breve* BB22M22, thus exerting an antiviral effect.

[0155] Example 6: qPCR assay of lung tissue signaling pathways

[0156] 1. Experimental reagents

[0157] RNA extraction kit, Novizan Biotechnology FastPure Complex Tissue / Cell Total RNA Isolation Kit, catalog number RC113-01, specification 50 rxns; RNA reverse transcription kit, Novizan Biotechnology HiScript IV All-in-One Ultra RT SuperMix for qPCR, catalog number R433-01, specification 100 rxns; SYBR Green I fluorescent dye, Novizan Biotechnology SYBR Green I nucleotide colloidal dye, catalog number JC2002-00.

[0158] 2. Experimental Methods

[0159] The animal experimental protocol was the same as steps one and two in Example 2. The methods for RNA extraction and reverse transcription from mouse lung tissue were the same as in Example 5. After thawing the lung tissue samples on ice, total RNA was extracted from the mouse lung tissue using an RNA extraction kit, and cDNA was obtained by reverse transcription. The mRNA expression levels of genes such as TLR7, MyD88, and TRAF6 in mouse lung tissue were detected using qPCR based on SYBR Green I fluorescent dye. GADPH was used as an internal reference gene, and a 2... -ΔΔ CT scans were used for data standardization analysis.

[0160] GADPH primer sequence (5'-3')

[0161] Forward (SEQ ID NO: 2): AATGGTGAAGGTCGGTGTGAAC,

[0162] Reverse (SEQ ID NO: 3): GCCTTGACTGTGCCGTTGAA.

[0163] TLR7 (Genome accession number: NM_133211) primer sequence (5'-3'):

[0164] Forward (SEQ ID NO: 6): GATCGTGACTGCACAGACA

[0165] Reverse (SEQ ID NO: 7): CAGATGGTTCAGCCTACGGA

[0166] MyD88 (Gen accession number: NM_010851) primer sequence (5'-3'):

[0167] Forward (SEQ ID NO: 8): ACTTGTTAGACCGTGAGGAT

[0168] Reverse (SEQ ID NO: 9): CTCGGACTCCTGGTTCTG

[0169] TRAF6 (gene accession number: NM_009424) primer sequence (5'-3'):

[0170] Forward (SEQ ID NO: 10): TCTGCTTGATGGCTTTACG

[0171] Reverse (SEQ ID NO: 11): ACCGTCAGGGAAAGAATCT

[0172] 3. Experimental Results

[0173] Experimental results are as follows Figure 5 As shown, compared with the H1N1 group, intervention with *Bifidobacterium breve* FeiHeB16 significantly upregulated the expression levels of pattern recognition receptor TLR7 (p < 0.05), adaptor protein MyD88 (p < 0.01), and tumor necrosis factor receptor-associated factor TRAF6 (p < 0.001). The results indicate that intervention with *Bifidobacterium breve* FeiHeB16 further activated the innate immune system of the host mice, increasing the expression of pattern recognition receptor TLR7 and enhancing the ability to recognize the virus. TLR7 signaling is transduced through the MyD88-dependent signaling pathway, which, through this key adaptor protein, transmits the signal downstream and modifies and activates TRAF6, further activating downstream signaling pathways and thus exerting an antiviral effect. Compared to *Bifidobacterium breve* FeiHeB16, *Bifidobacterium breve* BB22M22 significantly upregulated TRAF6 expression only, with no significant effect on TLR7 and MyD88 expression. Therefore, the immune signaling pathway regulated by *Bifidobacterium breve* to exert its antiviral effect is significantly different from that of *Bifidobacterium breve* FeiHeB16. These results indicate that *Bifidobacterium breve* FeiHeB16 can enhance the innate immunity of host mice by significantly upregulating the TLR7-MyD88-TRAF6 signaling pathway, and the regulation of this signaling pathway is strain-specific.

[0174] Example 7: Effect of Bifidobacterium on IFN-I response in influenza virus-infected mice

[0175] 1. Experimental reagents

[0176] RIPA lysis buffer, catalog number P0013B, purchased from Beyotime; IFN-β ELISA kit, catalog number SBJ-M0047, specification 96T, purchased from Nanjing Senbega Biotechnology Co., Ltd.; Enhanced BCA kit, catalog number P0010, purchased from Beyotime.

[0177] 2. Experimental Methods

[0178] The animal experimental protocol was the same as steps one and two in Example 2. The methods for RNA extraction and reverse transcription from mouse lung tissue were the same as in Example 5. The expression levels of interferon-stimulated genes MxA, Oas1a, Irf7, and Rsad2 in mouse lung tissue were detected using qPCR. GADPH was used as an internal reference gene, and 2... -ΔΔ CT scans were used for data standardization analysis.

[0179] GADPH primer sequence (5'-3')

[0180] Forward (SEQ ID NO: 2): AATGGTGAAGGTCGGTGTGAAC,

[0181] Reverse (SEQ ID NO: 3): GCCTTGACTGTGCCGTTGAA.

[0182] MxA (Gene accession number: NM_010846) primer sequence (5'-3'):

[0183] Forward (SEQ ID NO: 12): CCAACTGGAATCCTCCTGGAA,

[0184] Reverse (SEQ ID NO: 13): GCCGCACCTTCTCCTCATAG.

[0185] Oas1a (Gen sequence accession number: NM_001424706) primer sequence (5'-3'):

[0186] Forward (SEQ ID NO: 14): GAAGAGGCTGATGTGTGGCT,

[0187] Reverse (SEQ ID NO: 15): TGTCCAGTTCTCTTCTACCTGC.

[0188] Irf7 (Genome accession number: NM_001252601) primer sequence (5'-3'):

[0189] Forward (SEQ ID NO: 16): GCCAGGAGCAAGACCGTGTT,

[0190] Reverse (SEQ ID NO: 17): TGCCCCACCACTGCCTGTA.

[0191] Rsad2 (Genome accession number: NM_021384) primer sequence (5'-3'):

[0192] Forward (SEQ ID NO: 18): AACAGGCTGGTTTGGAGAAG,

[0193] Reverse (SEQ ID NO: 19): TGCCATTGCTCACTATGCTC.

[0194] Simultaneously, the level of the mouse lung cytokine IFN-β was measured: 100 mg of lung tissue was mixed with 1 mL of RIPA lysis buffer, homogenized using a tissue homogenizer, and centrifuged at 12000 r / min for 15 min at 4℃. The supernatant was collected and stored at -20℃ for later use. The IFN-β level in the supernatant was detected by ELISA, and the protein concentration was measured using an enhanced BCA kit to correct for cytokine levels.

[0195] 3. Experimental Results

[0196] Experimental results show that... Figure 6 As shown, compared with the H1N1 group, intervention with *Bifidobacterium breve* FeiHeB16 significantly increased the level of IFN-β in the lungs of mice, and also significantly upregulated the expression of interferon-stimulated genes MxA, Oas1a, Rsad2, and Irf7. Intervention with *Bifidobacterium longum* subsp. BB16M6 also significantly increased the expression of IFN-β and interferon-stimulated genes MxA, Oas1a, and Irf7 in the lungs of mice. However, there was no statistically significant difference between *Bifidobacterium breve* BB22M22 and the H1N1 group. This indicates that *Bifidobacterium breve* FeiHeB16 and *Bifidobacterium longum* subsp. BB16M6 can specifically activate the IFN-I response in the lungs after H1N1 infection, increase the level of IFN-β in the lungs, and thus increase the expression of interferon-stimulated genes, thereby enhancing the host's resistance to influenza virus. Meanwhile, the experimental results also showed that Bifidobacterium breve FeiHeB16 was more effective than Bifidobacterium longum subsp. BB16M6 in increasing the expression of IFN-β in the lungs and upregulating the expression of genes MxA, Oas1a, and Rsad2.

[0197] The above experiments demonstrate that *Bifidobacterium breve* FeiHeB16 of this invention can increase the expression of IFN-I and interferon-stimulated genes by upregulating the TLR7-MyD88-TRAF6 signaling pathway, thereby activating the innate immune system and exerting antiviral effects such as alleviating weight loss, reducing lung index, and relieving lung inflammation in influenza mice. *Bifidobacterium longum* subspecies BB16M6 can also effectively alleviate various symptoms caused by influenza virus infection, such as weight loss and lung inflammation in mice, but *Bifidobacterium breve* FeiHeB16 is more effective. *Bifidobacterium breve* BB22M22 can also exert antiviral effects and alleviate lung inflammation in influenza mice, but its mechanism of action differs from that of *Bifidobacterium breve* FeiHeB16, and its effect is weaker. This also indicates that the regulation of antiviral signaling pathways by *Bifidobacterium breve* is strain-specific.

[0198] It should be noted that although the technical solution of the present invention has been described with specific examples, those skilled in the art will understand that the present invention should not be limited thereto.

[0199] The various embodiments of the present invention have been described above. These descriptions are exemplary and not exhaustive, nor are they limited to the disclosed embodiments. Many modifications and variations will be apparent to those skilled in the art without departing from the scope and spirit of the described embodiments. The terminology used herein is chosen to best explain the principles, practical application, or technical improvements to the embodiments in the market, or to enable others skilled in the art to understand the embodiments disclosed herein.

Claims

1. The use of Bifidobacterium breve in the preparation of compositions for the prevention and / or improvement of pulmonary symptoms caused by influenza virus infection, characterized in that, The Bifidobacterium breve includes the Bifidobacterium breve FeiHeB16 strain, which has been deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 34753 and deposit date of June 4, 2025.

2. The use according to claim 1, characterized in that, The *Bifidobacterium breve* strain FeiHeB16 increases the expression of at least one of TLR7, MyD88, and TRAF6 in lung tissue.

3. The use according to claim 1 or 2, characterized in that, The *Bifidobacterium breve* strain FeiHeB16 upregulated the TLR7-MyD88-TRAF6 signaling pathway in lung tissue.

4. The use according to any one of claims 1-3, characterized in that, The *Bifidobacterium breve* strain FeiHeB16 increases the expression of at least one of MxA, Oas1a, Irf7, and Rsad2 in lung tissue.

5. The use according to any one of claims 1-4, characterized in that, The *Bifidobacterium breve* FeiHeB16 strain increased the expression of IFN-I in lung tissue. Preferably, the *Bifidobacterium breve* FeiHeB16 strain enhances the expression of IFN-β in lung tissue.

6. The use according to any one of claims 1-5, characterized in that, The lung symptoms caused by the influenza virus infection include at least one of the following: elevated lung index, lung inflammation, and elevated influenza virus load in the lungs.

7. The use according to any one of claims 1-6, characterized in that, The lung inflammation includes at least one of the following: thickening of alveolar septa, inflammatory cell infiltration of alveolar walls, damage to alveolar structure, and inflammatory cell infiltration within alveolar cavities.

8. The use according to any one of claims 1-7, characterized in that, The lung symptoms caused by the influenza virus infection mentioned are the lung symptoms caused by influenza virus infection in the subjects.

9. The use according to claim 8, characterized in that, The subjects included mammals; Preferably, the subject includes a human being.

10. The use according to any one of claims 1-9, characterized in that, The influenza virus mentioned includes the H1N1 influenza virus.

Images