Application of HDAC7 as target spot in diagnosis and treatment of rhabdomyosarcoma

By revealing a novel mechanism by which F-circP3F inhibits HDAC7, a regulatory axis for ARMS was constructed, providing a new perspective and strategy for the diagnosis and treatment of ARMS, especially for PAX3-FOXO1 positive patients, providing biomarkers and therapeutic targets.

CN122057022APending Publication Date: 2026-05-19SHIHEZI UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202610072366.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-20
Publication Date
2026-05-19

AI Technical Summary

Technical Problem

In the prior art, the upstream regulatory mechanism of the PAX3FOXO1 fusion gene in ARMS, especially the regulatory network at the non-coding RNA level, is still unclear, which affects the in-depth understanding of ARMS and the development of effective treatment strategies.

Method used

This study revealed a novel mechanism by which F-circP3F directly binds to and inhibits histone deacetase HDAC7, constructing a "circRNA-epiota-modifying enzyme-driver gene" regulatory axis (F-circP3F-HDAC7-PAX3-FOXO1). It also provides a drug combination of HDAC7 promoters and F-circP3F inhibitors for the diagnosis and treatment of ARMS.

Benefits of technology

It provides new biomarkers and therapeutic targets that can be used for molecular subtyping, early diagnosis, prognostic assessment and treatment efficacy monitoring of ARMS. HDAC7 is a key component, and activators or inhibitors can be used as treatment strategies for ARMS, especially for PAX3-FOXO1 positive patients.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122057022A_ABST
    Figure CN122057022A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of biological medicines, in particular to application of HDAC7 as a target spot in diagnosis and treatment of rhabdomyosarcoma. The invention reveals for the first time that circular RNA (F-circP3F) sourced from an oncogenic fusion gene PAX3-FOXO1 is directly combined with and inhibits histone deacetylase HDAC7 to play a role through a novel mechanism, and HDAC7 can be used for early diagnosis, prognosis evaluation and curative effect monitoring of rhabdomyosarcoma as a core link of the regulation mechanism. And the method is a treatment intervention target with great potential.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to the application of HDAC7 as a target in the diagnosis and treatment of rhabdomyosarcoma. Background Technology

[0002] Rhabdomyosarcoma (RMS) is the most common soft tissue sarcoma in children and adolescents, and is highly aggressive. Based on histological and molecular characteristics, RMS is mainly divided into embryonal RMS (ERMS) and acinar RMS (ARMS). ARMS is more malignant, prone to metastasis, and has a poor prognosis. Most ARMS cases exhibit the characteristic chromosomal translocation t(2;13)(q35;q14), producing PAX3. The FOXO1 fusion gene. This fusion gene acts as a key driver, promoting tumor development, progression, and maintenance through abnormal regulation of downstream transcriptional networks.

[0003] Circular RNA (circRNA) is a class of non-coding RNAs with a covalently closed circular structure, formed by backsplicing of precursor mRNA. Its circular structure makes it resistant to degradation by exonucleases, thus exhibiting high stability within cells. Recent studies have shown that circRNAs play important regulatory roles in various physiological and pathological processes, including acting as microRNA sponges in tumors, interacting with RNA-binding proteins, and regulating parental gene transcription. Of particular note is that fusion genes arising from chromosomal translocations can also generate a special type of circRNA through backsplicing, called F-circRNA. F-circRNAs were initially discovered in leukemia and subsequently identified in solid tumors, where they have been shown to participate in regulating malignant behaviors such as tumor cell proliferation and apoptosis.

[0004] Histone deacetylases (HDACs) are key epigenetic modifying enzymes that regulate gene expression. By removing the acetyl group from the tail of histones, they promote chromatin condensation and thus inhibit gene transcription. HDAC7 belongs to the class IIa HDAC family and plays a complex role in cell differentiation, migration, and survival. Its role in tumors is highly environment-dependent, and it can exert either pro-cancer or anti-cancer functions in different tumor types.

[0005] Currently, although PAX3 The central role of the FOXO1 fusion gene in ARMS has been confirmed, but its upstream regulatory mechanisms, especially the regulatory network at the non-coding RNA level, remain unclear. The inventors have previously studied PAX3... FOXO1 was successfully detected in FOXO1-positive ARMS cells and human acinar RMS tissue. Positive expression of circP3F RNA has been observed (see CN113981101A and CN114182023A, which are incorporated herein by reference). However, whether and how F-circRNA affects fusion gene expression and tumor phenotype by regulating histone modifying enzymes has not been reported. Therefore, a deeper understanding of the epigenetic regulatory mechanism of F-circRNA in ARMS is of great significance for understanding the pathogenesis of this tumor and developing new therapeutic strategies.

[0006] In view of this, the present invention is proposed. Summary of the Invention

[0007] The purpose of this invention is to reveal the regulatory mechanism of F-circP3F in the progression of rhabdomyosarcoma, and to provide new targets and approaches for the diagnosis and treatment of rhabdomyosarcoma.

[0008] This invention reveals for the first time that a circular RNA (F-circP3F) derived from the oncogenic fusion gene PAX3-FOXO1 functions through a novel mechanism—directly binding to and inhibiting the histone deacetylase HDAC7—elucidating a complete "circRNA-epiotic modifying enzyme-driver gene" regulatory axis (F-circP3F-HDAC7-PAX3-FOXO1). This regulatory axis is one of the key mechanisms maintaining the malignant phenotype of rhabdomyosarcoma, providing a completely new perspective for the diagnosis and treatment of rhabdomyosarcoma.

[0009] On the one hand, the present invention provides the use of HDAC7 promoters in the preparation of medicaments or kits for treating rhabdomyosarcoma.

[0010] In some embodiments of the present invention, the HDAC7 promoter comprises an HDAC7 activator and / or an agent that upregulates HDAC7 expression levels. The HDAC7 activator is an agent that enhances HDAC7 activity, such as a small molecule compound that enhances HDAC7 activity or the HDAC7 protein itself or its mutants. It is understood that by supplementing with an active HDAC7 protein or its mutants, enhancing the total HDAC7 activity in vivo, the same therapeutic effect on rhabdomyosarcoma can be achieved. The agent that upregulates HDAC7 expression levels comprises the HDAC7 gene or its nucleic acid constructs or vectors, or upstream genes or proteins capable of upregulating HDAC7 expression levels.

[0011] In some embodiments of the present invention, the HDAC7 promoter is used in combination with an F-circP3F inhibitor. In some embodiments of the present invention, the F-circP3F inhibitor is selected from one or more small interfering RNAs, short hairpin RNAs, antisense oligonucleotides, and CRISPR gene editing systems that target F-circP3F. Preferably, the F-circP3F inhibitor is an RNA with the nucleotide sequence shown in SEQ ID NO: 2.

[0012] In some embodiments of the present invention, the rhabdomyosarcoma is PAX3. FOXO1 fusion gene positive. In some embodiments of the present invention, the rhabdomyosarcoma is an alveolar rhabdomyosarcoma.

[0013] On the other hand, the present invention provides a drug combination or kit comprising an HDAC7 promoter and an F-circP3F inhibitor.

[0014] In some embodiments of the present invention, the HDAC7 promoter includes an HDAC7 activator and / or an agent that upregulates the expression level of HDAC7.

[0015] In some embodiments of the present invention, the F-circP3F inhibitor is selected from one or more of small interfering RNAs, short hairpin RNAs, antisense oligonucleotides, and CRISPR gene editing systems that target F-circP3F.

[0016] In some embodiments of the present invention, the F-circP3F inhibitor is an RNA with a nucleotide sequence as shown in SEQ ID NO: 2.

[0017] On another front, this invention provides the application of HDAC7 detection reagents in the preparation of kits for the diagnosis, prognostic assessment, treatment monitoring, and / or drug screening of rhabdomyosarcoma. The F-circP3F / HDAC7 / PAX3-FOXO1 axis is one of the key mechanisms maintaining the malignant phenotype of rhabdomyosarcoma. By detecting the expression level and activity of HDAC7, early diagnosis, treatment monitoring, and prognostic assessment of rhabdomyosarcoma can be effectively performed. Lower HDAC7 expression levels and activity indicate the presence of malignant rhabdomyosarcoma and a worse prognosis.

[0018] In some implementations, the HDAC7 assay reagent is used for drug screening to treat rhabdomyosarcoma. The screening method includes: contacting rhabdomyosarcoma cells with a substance to be screened, such as an antibody, protein, nucleic acid molecule (or its carrier) or small molecule compound; measuring whether HDAC7 is overexpressed in the rhabdomyosarcoma cells after contact; if overexpression is present, the substance to be screened is selected as a candidate drug.

[0019] In another aspect, the present invention provides a rhabdomyosarcoma cell model, wherein the expression level of HDAC7 in the rhabdomyosarcoma cells is upregulated or downregulated. For example, HDAC7 can be silenced or overexpressed using a lentiviral vector, thereby causing the expected changes in the phenotypes of rhabdomyosarcoma cells, such as proliferation, migration, and apoptosis. The cell model can be used to conduct in-depth in vitro studies on the biological behavior of rhabdomyosarcoma, screen targeted drugs, and explore combination therapy regimens.

[0020] The beneficial effects of this invention are at least as follows: 1. Novel Mechanism: This study reveals for the first time that a circular RNA (F-circP3F) derived from the oncogene PAX3-FOXO1 functions through a novel mechanism—directly binding to and inhibiting the histone deacetylase HDAC7. This expands our understanding of the mode of action of F-circRNA, particularly its regulatory capacity at the epigenetic level.

[0021] 2. Discovery of a novel regulatory loop: This invention elucidates a complete "circRNA-epiota-modifying enzyme-driver gene" regulatory axis (F-circP3F-HDAC7-PAX3-FOXO1). This regulatory axis is one of the key mechanisms for maintaining the malignant phenotype of ARMS, providing a completely new perspective for understanding the pathogenesis of ARMS.

[0022] 3. Providing new biomarkers: F-circP3F, HDAC7 and their functional axis activity status can serve as potential biomarkers for molecular subtyping, early diagnosis, prognostic assessment and monitoring of treatment efficacy in ARMS.

[0023] 4. Unveiling new therapeutic targets: HDAC7, as a core component of this functional axis, is a highly promising therapeutic target. Activators of HDAC7 or inhibitors of F-circP3F may become new strategies for treating ARMS, especially specific for PAX3-FOXO1-positive patients.

[0024] 5. Development of distinctive research tools: The ARMS cell model based on silencing or overexpressing F-circP3F / HDAC7 provided by this invention offers a powerful tool for in-depth in vitro research on the biological behavior of this tumor, screening targeted drugs, and exploring combination therapy options. Attached Figure Description

[0025] To more clearly illustrate the technical solutions in the specific embodiments of this disclosure or the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this disclosure. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0026] Figure 1 The differentially expressed mRNAs in RH30 cells are shown. Figure 1 A is a heatmap showing differentially expressed mRNAs in RH30, RD, and HSKMC cells screened by next-generation RNA sequencing. Figure 1 A (left) G1 is HSKMC cell, G2 is RH30 cell; Figure 1 A (right) G1 is RD cell, G2 is RH30 cell. Figure 1 B is a Venn diagram for screening genes highly expressed in RH30 cells, where the red circles represent mRNAs highly expressed in RH30 cells compared to RD cells, and the blue circles represent mRNAs highly expressed in RH30 cells compared to PSMC cells.

[0027] Figure 2 The results of GO functional enrichment analysis of 3703 differentially expressed genes in RH30 cells are shown. Figure 2 A is a bubble chart of GO molecular function (MF) enrichment analysis of differentially expressed genes; Figure 2 B is a bubble chart representing the enrichment analysis of differentially expressed genes in GO cellular components (CC).

[0028] Figure 3 Heatmap of differentially expressed circRNAs in RH30, RD and HSKMC cells screened by next-generation circRNA sequencing.

[0029] Figure 4 Volcano plot of differentially expressed circRNAs between RH30 and RD cells.

[0030] Figure 5 Bar chart showing GO enrichment analysis of differentially expressed circRNAs between RH30 and RD cells.

[0031] Figure 6 Bubble diagram for KEGG pathway enrichment analysis of differentially expressed circRNAs in RH30 and RD cells.

[0032] Figure 7 Volcano plot of differentially expressed circRNAs between RH30 and HSKMC cells.

[0033] Figure 8 Bar chart showing GO enrichment analysis of differentially expressed circRNAs between RH30 and HSKMC cells.

[0034] Figure 9 Bubble diagram for KEGG pathway enrichment analysis of differentially expressed circRNAs in RH30 and HSKMC cells.

[0035] Figure 10 The results show the GSEA enrichment of differentially expressed genes in the histone deacetylation activity pathway.

[0036] Figure 11 The results show the GSEA enrichment of differentially expressed genes in the histone deacetylation complex pathway.

[0037] Figure 12 A heatmap of mRNA sequencing of RD cells overexpressing F-circP3F (RD-OE-F-circP3F) and control cells (RD-OE-NC).

[0038] Figure 13 The results show the mRNA sequencing of histone acetyltransferases and histone deacetyltransferases in RD cells overexpressing F-circP3F (RD-OE-F-circP3F) and control cells (RD-OE-NC).

[0039] Figure 14 The figure shows a statistical graph of the mRNA expression levels of HDAC2, HDAC7, and HDAC10 in 293T and RD cells after F-circP3F overexpression, as detected by qRT-PCR experiments. Figure 14 A is a statistical graph showing the mRNA expression levels of HDAC2, HDAC7, and HDAC10 in 293T cells overexpressing F-circP3F (293T-OE-F-circP3F) and control cells (293T-OE-NC) detected by qRT-PCR (n=3, **). P <0.01, *** P <0.001); Figure 14 B is a statistical graph showing the mRNA expression levels of HDAC2, HDAC7, and HDAC10 in RD cells overexpressing F-circP3F (RD-OE-F-circP3F) and control cells (RD-OE-NC) detected by qRT-PCR (n=3, *). P <0.05).

[0040] Figure 15 A heatmap showing the differential expression of 21 histone acetylation-related molecules in soft tissue sarcomas (n=265) from the TCGA database.

[0041] Figure 16 This is a graph showing the correlation analysis of the expression of 21 histone acetylation-related molecules in TCGA soft tissue sarcoma (n=265).

[0042] Figure 17 The expression characteristics and regulatory associations of histone acetylation-related molecules in RH30, RD, and HSKMC cells are presented. Figure 17 A is a heatmap showing the differential expression of histone deacetylation-related molecules in the whole transcriptome sequencing of RH30, RD, and HSKMC cells; Figure 17 B is a graph showing the correlation analysis of the expression of histone deacetylation-related molecules in RH30, RD, and HSKMC cells; Figure 17 C is a bar chart showing the expression levels of histone deacetylation-related molecules in RH30, RD, and HSKMC cell lines.

[0043] Figure 18 A flowchart of the experimental procedure for RNA pull-down binding mass spectrometry (MS) identification and Western blot verification of F-circP3F interacting proteins.

[0044] Figure 19 Venn diagram for intersection analysis of F-circP3F binding protein, F-circP3F regulatory genes, and histone acetylation / deacetylation enzymes.

[0045] Figure 20 The secondary structure of F-circP3F binding histone deacetylase HDAC7 was determined by mass spectrometry.

[0046] Figure 21 The RNA pull-down assay demonstrates Western blot verification of the direct binding of F-circP3F to HDAC7.

[0047] Figure 22 Alpha Fold3 showed that it predicts a high-confidence binding site between HDAC7 and F-circP3F.

[0048] Figure 23 The expression of HDAC7 in RH30-OE-F-circP3F cells was detected. Figure 23 A represents the qRT-PCR detection of HDAC7 mRNA expression level in RD cells after F-circP3F overexpression (n=3, *). P <0.05). Figure 23 B represents the Western blot analysis of HDAC7 protein expression level in RD cells after overexpression of F-circP3F, with GAPDH serving as an internal control protein.

[0049] Figure 24 The expression of HDAC7 in 293T-OE-F-circP3F cells was detected. Figure 24A represents the qRT-PCR detection of HDAC7 mRNA expression level in RH30 cells after F-circP3F overexpression (n=3, *). P <0.05). Figure 24 B represents the Western blot analysis of HDAC7 protein expression level in RH30 cells after F-circP3F overexpression, with GAPDH serving as an internal control protein.

[0050] Figure 25 HDAC7 overexpression ( Figure 25 A) / Silence Figure 25 B) Schematic diagram of the structure of a lentiviral vector.

[0051] Figure 26 This demonstrates the successful construction of a stable RH30 cell line overexpressing HDAC7, in which... Figure 26 A shows fluorescence imaging of RH30 cells overexpressing HDAC7; Figure 26 B represents the detection of HDAC7 expression levels in RH30 cells overexpressing HDAC7 by qRT-PCR (n=3, ***). P <0.001).

[0052] Figure 27 This demonstrates the successful construction of a stable RH30 cell line with silenced HDAC7, in which... Figure 27 A shows fluorescence imaging of RH30 cells with silenced HDAC7. Figure 27 B represents the detection of HDAC7 expression levels in RH30 cells with silenced HDAC7 by qRT-PCR (n=3, ** P <0.01).

[0053] Figure 28 The results show that qRT-PCR and Western blot confirmed that overexpression of HDAC7 inhibits the expression of PAX3-FOXO1. Figure 28 A represents the expression level of PAX3-FOXO1 in RH30 cells after HDAC7 overexpression, verified by qRT-PCR (n=3, ***). P <0.001); Figure 28 B represents the Western blot analysis of the protein expression level of PAX3-FOXO1 after HDAC7 overexpression in RH30 cells.

[0054] Figure 29 The results show that qRT-PCR and Western blot confirmed that silencing HDAC7 promotes the expression of PAX3-FOXO1, where... Figure 29 A represents qRT-PCR validation of PAX3-FOXO1 expression levels in RH30 cells after HDAC7 silencing (n=3, * P<0.05); Figure 29 B represents a Western blot analysis of the protein expression level of PAX3-FOXO1 after silencing HDAC7 in RH30 cells.

[0055] Figure 30 The results of the CCK8 assay to detect the reduced proliferation capacity of RH30 cells after HDAC7 overexpression (n=3, ****) P <0.001).

[0056] Figure 31 The results of the CCK8 assay to detect the enhanced proliferation of RH30 cells after silencing HDAC7 (n=3, ***) P <0.001).

[0057] Figure 32 Experimental results and statistical graphs for detecting the decrease in HDAC7 overexpression in RH30 cells using EDU experiments (n=3, **) P <0.01).

[0058] Figure 33 Experimental results and statistical graphs of increased proliferation levels in RH30 cells after HDAC7 silencing in EDU experiments (n=3, **) P <0.01).

[0059] Figure 34 Experimental results and statistical graphs for detecting the reduced proliferation capacity of RH30 cells after HDAC7 overexpression in plate cloning assays (n=3, ****) P <0.0001).

[0060] Figure 35 Experimental results and statistical graphs for detecting the enhanced proliferation capacity of RH30 cells after silencing HDAC7 in a plate clone assay (n=3, * P <0.05).

[0061] Figure 36 Experimental results and statistical graphs of the reduced invasion and migration ability of RH30 cells after HDAC7 overexpression detected by Transwell assay (n=3, ** P <0.01).

[0062] Figure 37 Experimental results and statistical graphs of enhanced invasion and migration ability of RH30 cells after HDAC7 silencing were obtained using Transwell assays (n=3, ****). P <0.0001).

[0063] Figure 38The results and statistical graphs of TUNEL assays to detect the increased apoptosis level in RH30 cells after HDAC7 overexpression (n=3, ***) P <0.001).

[0064] Figure 39 Experimental results and statistical graphs of the decrease in apoptosis level in RH30 cells after HDAC7 silencing in TUNEL assays (n=3, * P <0.05).

[0065] Figure 40 Experimental results and statistical graphs for Transwell assays of the effects of silencing F-circP3F and overexpressing HDAC7 on the invasion and migration ability of RH30 cells (n=3, **) P <0.01, *** P <0.001, **** P <0.0001).

[0066] Figure 41 Experimental results and statistical graphs for Transwell assays to detect the effect of F-circP3F overexpression and HDAC7 silencing on the invasion and migration ability of RD cells (n=3, ***) P <0.001, **** P <0.0001).

[0067] Figure 42 The results of the CCK8 assay to detect the effect of silencing F-circP3F and overexpressing HDAC7 on the proliferation of RH30 cells (n=3, ****) P <0.0001).

[0068] Figure 43 The results of the cck8 assay to detect the effect of F-circP3F overexpression and HDAC7 silencing on the proliferation of RD cells (n=3, ****) P <0.0001). Detailed Implementation

[0069] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0070] It should be noted that the terminology used herein is for the purpose of describing particular implementations only and is not intended to limit the exemplary implementations according to this application. As used herein, the singular form includes the plural form unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this description, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.

[0071] In this document, the term "pharmaceutical" is intended to include small molecule compounds, their pharmaceutically acceptable salts or combinations thereof, or biological macromolecules, their analogs or combinations thereof.

[0072] In this document, the term "treatment" is intended to include prevention and treatment, methods by which beneficial or desired outcomes, including clinical outcomes, can be obtained. For the purposes of this application, beneficial or desired clinical outcomes include, but are not limited to, one or more of the following: relief of one or more symptoms caused by the disease, reduction of the severity of the disease, stabilization of the disease (e.g., prevention or delay of disease progression), prevention or delay of disease spread (e.g., metastasis), prevention or delay of disease recurrence, delay or slowing of disease progression, improvement of disease status, provision of disease remission (partial or complete), reduction of the dosage of one or more other medications required to treat the disease, delay of disease progression, improvement or enhancement of quality of life, increased weight gain and / or prolonged survival. "Treatment" also includes a reduction in the pathological outcome of cancer (e.g., tumor volume). In the context of cancer, "treatment" includes any or all of the following: inhibition of cancer cell growth, inhibition of cancer cell replication and metastasis, reduction of overall tumor burden, and improvement of one or more symptoms associated with the disease.

[0073] In this document, the term "nucleic acid construct" refers to a single-stranded or double-stranded nucleic acid molecule, preferably an artificially constructed nucleic acid molecule. Optionally, the nucleic acid construct may further comprise one or more operatively linked regulatory sequences.

[0074] In this document, the term "vector" refers to a reproducible nucleic acid from which one or more heterologous proteins can be expressed when the vector is transformed into a suitable host cell. Vectors include those into which nucleic acids encoding polypeptides or fragments thereof can be introduced, typically through restriction enzyme digestion and ligation. Vectors also include those containing nucleic acids encoding polypeptides. Vectors are used to introduce nucleic acids encoding polypeptides into host cells for amplification of nucleic acids or for expression / display of the polypeptides encoded by the nucleic acids. Examples of vectors include plasmids, artificial chromosomes, bacteriophages such as λ phage or M13 phage, and animal viruses. Animal viruses used as vectors include retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpesviruses (such as herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, and papillomaviruses (such as SV40). A vector may contain multiple elements controlling expression.

[0075] In this document, the term "drug combination" refers to a combination of one or more components suitable for administration of different drug components, which may be administered simultaneously, separately, or sequentially. Different drug components may form a composition together (e.g., a pharmaceutical composition) or may exist independently, for example, with separate formulations and / or packaging.

[0076] In this document, the term "pharmacy box" refers to one or more components packaged together, which may be individually packaged or placed in a container, such as a tube, bottle, vial, bag, blister pack, syringe, or other suitable container device. The pharmaceutical boxes described herein may also include instructions for using the components of the pharmaceutical box to carry out the subject method (e.g., instructions for preparing and / or using the drug combination described herein). Instructions for carrying out the subject method are typically recorded on a suitable recording medium. For example, instructions may be printed on a substrate such as paper or plastic. Thus, instructions may exist in the form of a package insert within the pharmaceutical box, or on a label of the container of the pharmaceutical box or its components (i.e., components associated with the packaging or sub-package). In some embodiments, instructions are present as a suitable computer-readable storage medium (e.g., CD). Electronic storage data documents exist on ROM, disks, etc. In other embodiments, the actual instruction manual is not present in the pillbox, but means are provided for obtaining the manual from a remote source, such as via the Internet. An example of this embodiment is a pillbox that includes a URL where the manual is located and / or from which the manual can be downloaded.

[0077] Those skilled in the art will understand that while specific nucleotide sequences are provided in this invention, it should be understood that these nucleotide sequences include conserved sequence variants, such as sequences having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identity. The nucleotide sequences can be optimized through truncation, base substitution, base deletion, etc., as long as the optimized nucleotide sequence retains its corresponding function; all such optimizations should fall within the equivalent protection scope of this invention. Unless otherwise specified herein, the orientation of the nucleotide sequence is from the 5' to the 3' end.

[0078] This invention includes the following aspects: 1. Differential expression profile analysis: Whole transcriptome sequencing (RNA-seq) was performed on ARMS cell line (RH30), ERMS cell line (RD) and normal skeletal muscle cells (HSKMC) to screen for mRNAs and circRNAs (including F-circP3F) that are specifically highly expressed in ARMS cells. Bioinformatics enrichment analysis revealed that differentially expressed genes were significantly enriched in epigenetic pathways such as histone modification and chromatin binding.

[0079] 2. Identification of F-circP3F interacting proteins: An RNA pull-down assay combined with mass spectrometry was used to screen and identify proteins that directly bind to F-circP3F. The intersection of the identification results with differentially expressed histone-modifying enzyme genes revealed that HDAC7 is the only histone deacetylase that simultaneously binds directly to F-circP3F and is regulated by its transcription. This binding was further validated by RNA pull-down-WB and AlphaFold3 structure prediction.

[0080] 3. Validation of F-circP3F regulation of HDAC7: The expression level of HDAC7 was detected in ARMS cells overexpressing or silencing F-circP3F using qRT-PCR and Western Blot techniques, confirming that F-circP3F has a negative regulatory effect on HDAC7.

[0081] 4. Regulation of PAX3-FOXO1 by HDAC7: HDAC7 overexpression and silencing stable cell lines were constructed in ARMS cells. The expression changes of the PAX3-FOXO1 fusion gene were detected by qRT-PCR. It was confirmed that HDAC7 overexpression can inhibit PAX3-FOXO1 expression, while HDAC7 silencing promotes its expression.

[0082] 5. Effects of HDAC7 on malignant phenotype of ARMS cells: Using experiments such as CCK-8, EDU, plate colony formation, Transwell invasion and migration, and TUNEL cell apoptosis, the effects of HDAC7 overexpression or silencing on the proliferation, colony formation, invasion, migration and apoptosis of ARMS cells were systematically evaluated, confirming that HDAC7 plays the role of a tumor suppressor gene in ARMS.

[0083] 6. Validation of the synergistic effect of the F-circP3F-HDAC7 functional axis: By silencing F-circP3F and overexpressing HDAC7, or by simultaneously overexpressing F-circP3F and silencing HDAC7, the effects on cell proliferation, invasion, and migration were examined, thereby confirming the existence and importance of this regulatory axis at the functional level.

[0084] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0085] The cell culture, molecular biology, immunology, microbiology, genetics, analytical chemistry, organic synthetic chemistry, medical and medicinal chemistry, and protein and nucleic acid hybridization described herein are well-known and widely used by those skilled in the art. Unless otherwise stated, all reagents used in the examples are commercially available or prepared according to conventional or disclosed methods and are ready for direct use without further processing; similarly, the instruments used in the examples are commercially available. Unless otherwise stated, molecular biology reagents are used according to the manufacturer's specifications.

[0086] Example 1. F-circP3F expression is associated with histone deacetylation activity pathway and regulates the expression of related molecules. 1. Differentially expressed mRNAs and circRNAs in ARMS cells are associated with histone modifications. To screen for differentially expressed mRNAs in alveolar rhabdomyosarcoma cells (RH30), embryonic rhabdomyosarcoma cells (RD), and skeletal muscle cells (HSKMC), mRNAs from the three cell types were extracted and analyzed using next-generation sequencing. Figure 1 A presents a heatmap of mRNAs identified in RH30, RD, and HSKMC cells. By screening for mRNAs highly expressed in RH30 cells relative to RD cells and mRNAs highly expressed in RH30 cells relative to HSKMC cells, the intersection of these two sets of data yielded 3703 differentially expressed genes. Figure 1 B).

[0087] Functional annotation analysis of the 3703 differentially expressed mRNAs revealed that the molecular functions of highly expressed genes in RH30 cells were mainly related to histone binding, transcriptional repressor activity, DNA helicase activity, and histone modification. Figure 2 A); its cellular components are mainly related to structures such as aggregated chromosomes, SWI / SNF superfamily complexes, and histone deacetylase complexes. Figure 2 B).

[0088] In addition, differentially expressed circRNAs (including F-circP3F and other F-circRNAs) in RH30, RD, and HSKMC cells were further screened. Total RNA was extracted from these three cell types, and linear RNA was digested with RNase R before next-generation sequencing analysis. Figure 3 A heatmap of circRNA expression in RH30, RD, and HSKMC cells. GO and KEGG pathway enrichment analysis was performed on differentially expressed circRNAs in RH30 and RD cells, revealing that their functions are mainly related to chromatin binding, chromosome structure regulation, histone modification, and RNA degradation. Figure 4 , Figure 5 , Figure 6 GO and KEGG pathway enrichment analysis was performed on differentially expressed circRNAs in RH30 and HSKMC cells, revealing that they were functionally enriched in chromatin segregation, histone modification, cell cycle progression, and RNA degradation. Figure 7 , Figure 8 , Figure 9 ).

[0089] 2. F-circP3F enriches histone deacetylation activity and the deacetylation complex pathway and regulates the expression of histone deacetylases (HDACs). RD cells and 293T cells were transfected with a lentiviral vector overexpressing F-circP3F and a control lentiviral vector (purchased from Suzhou Gemma Gene Co., Ltd.), respectively, to construct RD cells (RD-OE-F-circP3F) and 293T cells (293T-OE-F-circP3F) overexpressing F-circP3F, as well as corresponding control cells RD-OE-NC and 293T-OE-NC. Specific steps are described in Example 3 below. After overexpressing F-circP3F in RD cells, RNA sequencing and GSEA enrichment analysis were performed. The results showed that F-circP3F could enrich histone deacetylation activity (…). Figure 10 ) and histone deacetylation complex pathway ( Figure 11 Next-generation sequencing of F-circP3F-overexpressing RD cell mRNA showed that F-circP3F can regulate the expression of multiple histone deacetylase family (HDAC) molecules. Figure 12 , Figure 13 qRT-PCR assays also confirmed that overexpression of F-circP3F in 293T and RD cells downregulated the expression of histone deacetylases HDAC2, HDAC7, and HDAC10. Figure 14 A and Figure 14 B).

[0090] In addition, bioinformatics analysis of transcriptome sequencing data (n=265) of soft tissue sarcomas (including ARMS) in the TCGA database showed that 21 histone acetylation-related molecules were differentially expressed to varying degrees in sarcoma tissues and were correlated with each other. Figure 15 and Figure 16 ).

[0091] ARMS cell line (RH30), ERMS cell line (RD), and normal skeletal muscle cell line (HSKMC) were selected and sent to Shanghai Ruian Company for whole transcriptome sequencing. The results showed that 23 histone deacetylases were differentially expressed in the above cell lines. Figure 17 A), among which HDAC2, HDAC7, HDAC11, and SIRT7 were significantly highly expressed in ARMS cells, while HDAC5, HDAC10, and SIRT1 were significantly lowly expressed in ARMS cells. Figure 17 B and Figure 17 C).

[0092] Example 2. F-circP3F binds to and inhibits histone deacetylase HDAC7 Proteins binding to F-circP3F were enriched using an RNA pull-down assay, followed by mass spectrometry analysis to identify 373 proteins that specifically bind to F-circP3F. Intersection analysis was performed with these proteins against 15,973 differentially expressed mRNAs detected by next-generation RNA sequencing in Example 1 and 23 differentially expressed histone acetyltransferases / deacetyltransferases detected by whole-transcriptome sequencing. The analysis revealed that HDAC7 is the only histone deacetyltransferase that directly binds to F-circP3F and is transcribedly regulated by it. Figure 18 , Figure 19 , Figure 20 RNA pull-down-Western blot confirmed that F-circP3F binds directly to HDAC7. Figure 21 AlphaFold3 also predicted a high-confidence binding site between HDAC7 and F-circP3F. Figure 22 ).

[0093] To further verify the regulation of histone deacetylase HDAC7 expression level by F-circP3F, RD cells were transfected with lentiviral vectors overexpressing F-circP3F and control lentiviral vectors (purchased from Suzhou Gemma Gene Co., Ltd.) to construct RD cells overexpressing F-circP3F (RD-OE-F-circP3F) and control cells (RD-OE-NC). RH30 cells were transfected with lentiviral vectors silencing F-circP3F and control lentiviral vectors (purchased from Suzhou Gemma Gene Co., Ltd.) to construct RH30 cells silencing F-circP3F (RH30-SH-F-circP3F) and control cells (RH30-SH-NC). The encoding DNA sequence (5'-3') of Sh-F-circP3F is AGGGTTAGTGAGCAGCCTCAG (SEQ ID NO: 2). The specific steps are described in Example 3 below. The expression levels of HDAC7 in RD cells overexpressing F-circP3F and RH30 cell lines with silenced F-circP3F were detected by qRT-PCR and Western Blot, respectively. The qRT-PCR results showed that, compared with the control group (RD-OE-NC), the expression level of HDAC7 in RD cells overexpressing F-circP3F decreased. Figure 23 A); Compared with the control group (RH30-SH-NC), the expression level of HDAC7 in RH30 cells increased after F-circP3F silencing ( Figure 24 A). Western blot results showed that HDAC7 protein expression level decreased after F-circP3F overexpression ( Figure 23 B); After silencing F-circP3F, HDAC7 protein expression levels increased ( Figure 24 B).

[0094] Example 3. Inhibition of histone deacetylase HDAC7 promotes the expression of PAX3-FOXO1. 1. Constructing stable cell lines that overexpress and silence HDAC7 To further verify whether histone deacetylase HDAC7 affects the expression of PAX3-FOXO1 in RH30 cells, this example used the PAX3-FOXO1 fusion gene-positive human cell line—alveolar rhabdomyosarcoma cells (RH30)—to construct stable cell lines that overexpress and silence HDAC7. HDAC7-related lentiviral vectors were purchased from Suzhou Gemma Gene Co., Ltd. The lentiviral vector overexpressing HDAC7 (LV-OE-HDAC7) and the control lentiviral vector overexpressing HDAC7 (LV-NC-OE) carried GFP fluorescent protein and the puro resistance gene (…). Figure 25A); lentiviral vector silencing HDAC7 (LV-Sh-HDAC7) and its control lentiviral vector (LV-NC-Sh) carry mCherry fluorescent protein and Neo resistance gene ( Figure 25 B).

[0095] The encoding DNA sequence information of Sh-HDAC7 (5'-3'): CTTCGGCAACTTCTCAATAAA (SEQ ID NO: 1), and the transcribed shRNA RNA sequence is the sequence after replacing thymine (T) with uracil (U) in the above DNA sequence.

[0096] RH30 alveolar rhabdomyosarcoma cells in the logarithmic growth phase and in good growth condition were digested, counted, and plated. The cells were then incubated at 37°C in a 5% CO2 incubator for 24 hours until the cell confluence reached 50%. Approximately 60% were infected with the virus; each lentiviral vector was administered at a rate of 1×10⁻⁶. 8 A TU / mL, MOI=10 titer was added to the wells corresponding to alveolar rhabdomyosarcoma cells, followed by 40 μL of HirianGA and 40 μL of HirianGP infection reagent. The cells were then cultured at 37°C in a 5% CO2 incubator. Forty-eight hours after transfection, cell status was observed under a microscope. The virus-containing culture medium was then replaced with complete medium containing 10% fetal bovine serum. After lentiviral infection of alveolar rhabdomyosarcoma cells at RH30 for 72 hours, puromycin (10 μg / mL) was added to 1640 complete medium for selection. The puromycin-containing medium was changed every two days. Cells were observed under a microscope before each medium change / passage until cell growth was stable and almost no dead cells appeared. The puromycin selection concentration was then reduced by half to approximately 5 μg / mL, and this concentration was maintained for one week of cell culture. After the constructed isolated silent and overexpressing cells achieved a fluorescence transfection efficiency of 90%, qRT was used. PCR technology (primer sequences are shown in Table 1) was used to detect the difference in HDAC7 expression between the experimental groups (overexpression group RH30-OE-HDAC7 and silence group RH30-SH-HDAC7) and the control groups (overexpression control group RH30-NC-HDAC7 and silence control group RH30-SH-NC-HDAC7), confirming the successful construction of the stable cell line. Figure 26 and Figure 27 ).

[0097] 2. qRT-PCR experiment To further verify whether histone deacetylase HDAC7 affects the expression of PAX3-FOXO1 in RH30 cells, the expression level of PAX3-FOXO1 after silencing / overexpressing HDAC7 was detected by qRT-PCR in RH30 cell lines with HDAC7 overexpression and silencing. Total RNA was extracted from RH30 cells with HDAC7 overexpression and silencing using the TRIzol method. qRT-PCR was performed using primers specific to the PAX3-FOXO1 fusion site, with GAPDH as an internal reference gene. The primer sequences for qRT-PCR are shown in Table 1.

[0098] Table 1. qRT-PCR primer sequence listing

[0099] Experimental results showed that overexpression of HDAC7 decreased the expression level of PAX3-FOXO1 in RH30 cells. Figure 28 A), while after silencing HDAC7, the expression level of PAX3-FOXO1 in RH30 cells increased ( Figure 29 A).

[0100] 3. Western Blot Experiment To further verify whether histone deacetylase HDAC7 affects the expression of PAX3-FOXO1 in RH30 cells, Western blotting was used to detect the expression levels of PAX3-FOXO1 after HDAC7 silencing / overexpression in RH30 cell lines with HDAC7 overexpression and silencing. The results showed that HDAC7 protein levels increased and PAX3-FOXO1 protein expression decreased after HDAC7 overexpression. Figure 28 B); After silencing HDAC7, HDAC7 protein levels decreased and PAX3-FOXO1 protein expression increased ( Figure 29 B).

[0101] Example 4. HDAC7 inhibits malignant biological behavior in alveolar rhabdomyosarcoma cells in vitro. Cell proliferation was detected using CCK8, EDU, and plate cloning methods; cell invasion and migration were detected using Transwell assay; and cell apoptosis was detected using the TUNEL assay.

[0102] The effect of HDAC7 on cell proliferation was detected using the CCK-8 assay. Changes in cell proliferation in RH30 cells overexpressing HDAC7 and the control group are shown below. Figure 30As shown in Table 2, the absorbance values ​​at 450 nm of RH30-OE-HDAC7 and RH30-OE-NC cells were basically the same at 0h and 24h. However, as the culture time increased to 48h-96h, the absorbance at 450 nm of the RH30-NC-HDAC7 group was significantly higher than that of the RH30-OE-HDAC7 group. These results indicate that overexpression of HDAC7 can inhibit the proliferation of RH30 cells (Table 2 and 3). Figure 30 The changes in cell proliferation in RH30 cells in the HDAC7-silenced group (RH30-sh-HDAC7) and the control group (RH30-sh-NC) are as follows: Figure 31 As shown in the figure: ELISA reader detection revealed that the absorbance values ​​at 450 nm for RH30-sh-HDAC7 and RH30-sh-NC cells were essentially the same at the 0-hour time point. However, as the culture time increased to 24-96 hours, the absorbance at 450 nm in the RH30-sh-HDAC7 group was significantly higher than that in the RH30-sh-NC group. These results indicate that silencing HDAC7 enhances the proliferation ability of RH30 cells (Table 3 and...). Figure 31 ).

[0103] Table 2. Absorbance values ​​of RH30 cells after HDAC7 overexpression

[0104] Table 3. Absorbance values ​​of RH30 cells after silencing HDAC7

[0105] EDU experiments were conducted to investigate the effect of HDAC7 on the proliferation of ARMS cells. The results showed that overexpression of HDAC7 reduced cell proliferation (Table 4). Figure 32 ), and silencing HDAC7 increased the proliferation level of RH30 cells (Table 5, ). Figure 33 ).

[0106] Table 4. EDU assay to detect the proliferation ability of RH30 cells after HDAC7 overexpression

[0107] Table 5. EDU assay to detect the proliferation capacity of RH30 cells after silencing HDAC7.

[0108] A plate colony formation assay was used to examine the effect of HDAC7 on ARMS cell proliferation. The results showed that overexpression of HDAC7 in RH30 cells reduced the number of colonies and decreased the colony size (Table 6). Figure 34); After silencing HDAC7 in RH30 cells, compared with the control group (RH30-sh-NC), the number of clones formed by RH30 cells with silenced HDAC7 (RH30-sh-HDAC7) was significantly increased, and the clone volume was larger (Table 7, Figure 35 These results indicate that overexpression of HDAC7 can inhibit the clonogenic ability of RH30 cells, while silencing of HDAC7 enhances the clonogenic ability of RH30 cells.

[0109] Table 6. Plate clone assay to detect the proliferation ability of RH30 cells after HDAC7 overexpression.

[0110] Table 7. Plate clone assay to detect the proliferation capacity of RH30 cells after silencing HDAC7.

[0111] Transwell assays were used to investigate the effects of HDAC7 on the invasion and migration abilities of ARMS cells. Transwell assay results showed that overexpression of HDAC7 (OE-HDAC7) inhibited the invasion and migration abilities of RH30 cells (Table 8). Figure 36 Silencing HDAC7 (SH-HDAC7) enhances the invasion and migration ability of RH30 cells (Table 9). Figure 37 ).

[0112] Table 8. Transwell assay of RH30 cell invasion and migration after HDAC7 overexpression

[0113] Table 9. Transwell assay of RH30 cell invasion and migration after HDAC7 silencing

[0114] To further verify the effect of HDAC7 on the apoptosis capacity of RH30 cells, the TUNEL assay was used to detect the apoptosis level of the cells. The TUNEL assay results showed that, compared with RH30-OE-NC, the apoptosis level of RH30-OE-HDAC7 cells was increased (Table 10). Figure 38 ), and silencing HDAC7 reduced apoptosis levels (Table 11, ). Figure 39 ).

[0115] Table 10. TUNEL assay to detect apoptosis in RH30 cells overexpressing HDAC7

[0116] Table 11. TUNEL assay for apoptosis in RH30 cells after silencing HDAC7 cells

[0117] Example 5. F-circP3F regulates HDAC7 to promote the invasion, migration, and proliferation of alveolar rhabdomyosarcoma cells. To investigate the effects of F-circP3F regulation of HDAC7 on the invasion, migration, and proliferation of ARMS cells, stable cell lines with F-circP3F and / or HDAC7 silencing / overexpression were constructed in RH30 and RD cells according to the method described in Example 3. The cell lines were grouped as shown in Tables 12 and 13 below. The encoding DNA sequence (5'-3') of Sh-HDAC7 is CTTCGGCAACTTCTCAATAAA (SEQ ID NO: 1), and the encoding DNA sequence (5'-3') of Sh-F-circP3F is AGGGTTAGTGAGCAGCCTCAG (SEQ ID NO: 2).

[0118] Table 12. Grouping of stable cell lines co-treated with F-circP3F / HDAC7 in RH30

[0119] Table 13. Grouping of stable cell lines in RD cells co-treated with F-circP3F / HDAC7

[0120] To investigate the effect of F-circP3F regulation of HDAC7 on ARMS cell invasion and migration, Transwell assays were performed. The results showed that knockdown of F-circP3F significantly weakened the invasion and migration abilities of RH30 cells; simultaneous overexpression of HDAC7 after F-circP3F knockdown further reduced the number of invading and migrating cells, indicating that HDAC7 overexpression enhanced the inhibitory effect of silencing F-circP3F on cell invasion and migration (Table 14). Figure 40 Furthermore, in RD cells, knockdown of HDAC7 enhanced RD cell migration and invasion; overexpression of F-circP3F combined with HDAC7 knockdown significantly enhanced migration and invasion, indicating that HDAC7 silencing can enhance the effect of F-circP3F overexpression on cell migration and invasion (Table 15). Figure 41 ).

[0121] Table 14. Transwell assay of RH30 cell invasion and migration after F-circP3F silencing / HDAC7 overexpression

[0122] Table 15. Transwell assay of RD cell invasion and migration after F-circP3F overexpression / HDAC7 silencing

[0123] The effect of HDAC7 on ARMS cell proliferation via F-circP3F was detected using the CCK8 assay. The results showed that, compared with the blank control group (Sh-NC+OE-NC), cell proliferation was significantly reduced by silencing F-circP3F alone, and cell proliferation was also reduced by overexpressing HDAC7 alone. The proliferation of cells in the group with silenced F-circP3F and overexpressed HDAC7 was significantly lower than that of either the group with silenced F-circP3F alone or the group with overexpressed HDAC7 alone. This indicates that silencing F-circP3F and overexpressing HDAC7 inhibits RH30 cell proliferation (Table 16). Figure 42 Furthermore, in RD cells, compared with the blank control group (Sh-NC+OE-NC), cell proliferation was increased by overexpression of F-circP3F alone, and cell proliferation was increased by silencing HDAC7 alone; the cell proliferation of the group overexpressing F-circP3F and silencing HDAC7 was significantly higher than that of the group overexpressing F-circP3F alone or silencing HDAC7 alone. This indicates that overexpression of F-circP3F and silencing HDAC7 promotes RD cell proliferation (Table 17). Figure 43 ).

[0124] Table 16. Absorbance values ​​of RH30 cells after silencing F-circP3F / overexpressing HDAC7

[0125] Table 17. Absorbance values ​​of RD cells after F-circP3F overexpression / HDAC7 silencing

[0126] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. Application of HDAC7 promoters in the preparation of drugs or kits for treating rhabdomyosarcoma.

2. The application according to claim 1, characterized in that, The HDAC7 promoters include HDAC7 activators and / or agents that upregulate HDAC7 expression levels.

3. The application according to claim 1 or 2, characterized in that, The HDAC7 promoter was used in combination with the F-circP3F inhibitor.

4. The application according to claim 3, characterized in that, The F-circP3F inhibitor is selected from one or more of small interfering RNAs, short hairpin RNAs, antisense oligonucleotides, and CRISPR gene editing systems that target F-circP3F.

5. A drug combination or pillbox, characterized in that, Including HDAC7 promoters and F-circP3F inhibitors.

6. The drug combination or pillbox according to claim 5, characterized in that, The HDAC7 promoters include HDAC7 activators and / or agents that upregulate HDAC7 expression levels.

7. The drug combination or pillbox according to claim 5 or 6, characterized in that, The F-circP3F inhibitor is selected from one or more of small interfering RNAs, short hairpin RNAs, antisense oligonucleotides, and CRISPR gene editing systems that target F-circP3F.

8. The drug combination or pillbox according to claim 5 or 6, characterized in that, The F-circP3F inhibitor is an RNA with a nucleotide sequence as shown in SEQ ID NO:

2.

9. The use of HDAC7 detection reagents in the preparation of kits for the diagnosis, prognostic assessment, treatment monitoring and / or drug screening of rhabdomyosarcoma.

10. A rhabdomyosarcoma cell model, characterized in that, The cell model was rhabdomyosarcoma cells, and the expression level of HDAC7 in the rhabdomyosarcoma cells was upregulated or downregulated.