Cyclic RNA compositions and methods
By designing and manufacturing circular RNA polynucleotides (oRNAs), the integration risks of DNA therapy and the cost of viral vectors have been addressed, enabling the safe and efficient expression of therapeutic proteins in host cells while avoiding immune responses and integration risks.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- ONA MEDICAL CORP
- Filing Date
- 2023-12-14
- Publication Date
- 2026-05-19
AI Technical Summary
Conventional DNA gene therapy carries the risk of integration into the host genome, leading to impaired genetic function, immune response, and difficulty in control. Viral vector delivery is expensive and time-consuming, while RNA therapy requires overcoming the barrier to entry into the cell nucleus.
Using circular RNA polynucleotides (oRNA), engineered precursor RNAs and circular RNAs are designed and manufactured to stably express therapeutic proteins within cells, avoiding integration risks and immune responses. Compositions are optimized using pharmaceutically acceptable salts, buffers, or diluents.
This approach enables the safe and efficient expression of therapeutic proteins in host cells, avoiding the integration risks of DNA therapy and the immune response of viral vectors, while reducing preparation costs.
Smart Images

Figure BDA0005515996320000911 
Figure BDA0005515996320000921 
Figure BDA0005515996320000931
Abstract
Description
[0001] Cross-references to related applications
[0002] This application claims priority to U.S. Provisional Application No. 63 / 387,600 and U.S. Provisional Application No. 63 / 387,559, filed December 15, 2022, each of which is incorporated herein by reference in its entirety for any purpose.
[0003] sequence list
[0004] This application is submitted together with an electronic sequence list. The sequence list is provided as a file named "01318-0009-00PCT_SL.xml" created on December 14, 2023, and is 30,429,268 bytes in size. The information in the electronic sequence list is incorporated herein by reference in its entirety. Background Technology
[0005] Conventional gene therapy involves inserting desired genetic information into host cells using DNA. The introduced DNA is typically integrated to some extent into the genome of one or more transfected cells, allowing the introduced genetic material to have a persistent effect in the host. While this persistent effect can have substantial benefits, the integration of exogenous DNA into the host genome can also have many detrimental effects. For example, it is possible that the introduced DNA will be inserted into an intact gene, leading to mutations that inhibit or even completely eliminate the function of the endogenous gene. Therefore, gene therapy with DNA can lead to impairment of important genetic functions in the treated host, such as eliminating or harmfully reducing the production of essential enzymes or disrupting genes crucial for cell growth regulation, resulting in dysregulated or cancerous proliferation. Furthermore, for conventional DNA-based gene therapy, the effective expression of the desired gene product must include a strong promoter sequence, which again can lead to undesirable changes in the regulation of normal gene expression in the cell. It is also possible that DNA-based genetic material will lead to the induction of undesirable anti-DNA antibodies, which in turn may trigger a potentially fatal immune response. Gene therapy using viral vectors can also lead to adverse immune responses. In some cases, the viral vector can even integrate into the host genome. Moreover, the production of clinical-grade viral vectors is expensive and time-consuming. The introduced genetic material, delivered via viral vectors, can also be difficult to control. Therefore, while DNA-based gene therapies for delivering secreted proteins using viral vectors have been evaluated, these approaches may be limited for these various reasons.
[0006] In contrast to DNA, using RNA as a gene therapy agent is generally safer because RNA does not involve the risk of stable integration into the genome of transfected cells. This eliminates concerns that the introduced genetic material will disrupt the normal function of essential genes or cause mutations leading to harmful or carcinogenic effects. Furthermore, efficient translation of the encoded protein does not require a foreign promoter sequence, again avoiding potential harmful side effects. In addition, mRNA does not need to enter the cell nucleus to perform its function, while DNA must overcome this major obstacle.
[0007] Circular RNAs can be used to design and generate stable forms of RNA. The circularization of RNA molecules offers advantages for the study of RNA structure and function, especially in molecules that tend to fold in inactive conformations. Circular RNAs are also of particular interest and usefulness for in vivo applications, particularly in the research areas of RNA-based gene expression control and therapy, including protein replacement therapy and vaccination.
[0008] This disclosure provides methods and compositions for manufacturing and optimizing circular RNA via engineered precursor linear RNA and final circular RNA sequences, as well as methods for treating subjects in need using the disclosed circular RNA polynucleotides. Summary of the Invention
[0009] This article describes precursor RNA polynucleotides and circular RNA polynucleotides (oRNAs). TM ), pharmaceutical compositions containing oRNA and related methods.
[0010] In some embodiments, this document discloses a circular RNA polynucleotide (oRNA) comprising a translation initiation element (TIE), wherein the TIE comprises a sequence or fragment thereof having at least 85% sequence identity with the sequence shown in any one of SEQ ID NO:14067-24829 (GIRES-1 to GIRES-10762), the sequence or fragment thereof optionally being barcoded with a barcode sequence selected from SEQ ID NO:3304-14066 (e.g., the IRES of SEQ ID NO:14067 is barcoded with the barcode sequence of SEQ ID NO:3304, SEQ ID NO:14068 is barcoded with the barcode sequence of SEQ ID NO:3305, the IRES of SEQ ID NO:14069 is barcoded with the barcode sequence of SEQ ID NO:3306, and so on). In some embodiments, the TIE comprises a common sequence as shown in the exemplary common sequence listing (SEQ ID NO: 24867-24892, Table A) herein, where N is any nucleotide (e.g., according to IUPAC). In some embodiments, the TIE comprises at least 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 600 nucleotides, or at least 700 nucleotides (e.g., continuous nucleotides) of the common sequence.
[0011] In some embodiments, this document discloses a circular RNA polynucleotide (oRNA) comprising a core functional element and a pharmaceutically acceptable salt, buffer, diluent, or combination thereof; wherein the core functional element comprises a translation initiation element (TIE), wherein the TIE comprises a sequence or fragment thereof having at least 85% sequence identity with the sequence shown in any one of SEQ ID NO:14067-24829.
[0012] In some embodiments, this document discloses a circular RNA polynucleotide (oRNA) comprising a core functional element and a pharmaceutically acceptable salt, buffer, diluent, or combination thereof; wherein the core functional element comprises a translation initiation element (TIE), wherein the TIE comprises a sequence having at least 85% sequence identity with the sequence shown in any one of SEQ ID NO: 793, 876, 1017, 1216, and 3291, wherein the oRNA is capable of expressing a therapeutic protein in T cells.
[0013] In some embodiments, this document discloses a circular RNA polynucleotide (oRNA) comprising a core functional element and a pharmaceutically acceptable salt, buffer, diluent, or combination thereof; wherein the core functional element comprises a translation initiation element (TIE) having at least 85% sequence identity with the sequence shown in any one of SEQ ID NO: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293, and 3302, wherein the oRNA is capable of expressing a therapeutic protein in T cells.
[0014] In some embodiments, this document discloses a circular RNA polynucleotide (oRNA) comprising a core functional element and a pharmaceutically acceptable salt, buffer, diluent, or combination thereof; wherein the core functional element comprises a translation initiation element (TIE), wherein the TIE is associated with SEQ ID NO: 75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 922, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 1193, 1198, 1263, 1276. The sequence shown in any one of 1280, 1282, 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299 and 3301 has at least 85% sequence identity, wherein the oRNA is capable of expressing a therapeutic protein in T cells.
[0015] In some embodiments, this document also discloses a precursor RNA polynucleotide capable of generating the circular RNA provided herein.
[0016] In some embodiments, the TIE includes an internal ribosome entry site (IRES). In some embodiments, the IRES is wholly or partially derived from the untranslated region (UTR). In some embodiments, the IRES has at least 90% identity with the sequences shown in any one of SEQ ID NO:14067-24829 (GIRES-1 to GIRES-10762). In some embodiments, the IRES has at least 95% identity with the sequences shown in any one of SEQ ID NO:14067-24829. In some embodiments, the IRES has at least 98% identity with the sequences shown in any one of SEQ ID NO:14067-24829. In some embodiments, the IRES has at least 99% identity with the sequences shown in any one of SEQ ID NO:14067-24829. In some embodiments, the IRES comprises the sequence shown in any one of SEQ ID NO:14067-24829.
[0017] In some embodiments, the TIE includes an internal ribosome entry site (IRES). In some embodiments, the IRES is wholly or partially derived from the untranslated region (UTR). In some embodiments, the IRES sequence has at least 90% sequence identity with the sequence shown in any one of SEQ ID NO: 793, 876, 1017, 1216, and 3291. In some embodiments, the IRES sequence has at least 95% sequence identity with the sequence shown in any one of SEQ ID NO: 793, 876, 1017, 1216, and 3291. In some embodiments, the IRES sequence has at least 98% sequence identity with the sequence shown in any one of SEQ ID NO: 793, 876, 1017, 1216, and 3291. In some embodiments, the IRES sequence has at least 99% sequence identity with the sequence shown in any one of SEQ ID NO: 793, 876, 1017, 1216, and 3291. In some embodiments, the IRES sequence comprises the sequence shown in any one of SEQ ID NO: 793, 876, 1017, 1216, and 3291. In some embodiments, the IRES sequence has at least 90% sequence identity with the sequence shown in any one of SEQ ID NO: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293, and 3302. In some embodiments, the IRES sequence has at least 95% sequence identity with the sequence shown in any one of SEQ ID NO: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293 and 3302. In some embodiments, the IRES sequence has at least 98% sequence identity with the sequence shown in any one of SEQ ID NO: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293 and 3302.In some embodiments, the IRES sequence has at least 99% sequence identity with the sequence shown in any one of SEQ ID NO: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293 and 3302. In some embodiments, the IRES sequence comprises the sequence shown in any one of SEQ ID NO: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293, and 3302. In some embodiments, the IRES sequence is related to SEQ ID NO: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293, and 3302. NO:75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 9 22, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 1193, 119 The sequences shown in any one of 8, 1263, 1276, 1280, 1282, 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299, and 3301 have at least 90% sequence identity. In some embodiments, the IRES sequence is identical to the SEQ ID. NO:75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 9 22, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 1193, 119 The sequence represented by any one of 8, 1263, 1276, 1280, 1282, 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299 and 3301 has at least 95% sequence identity.In some implementations, the IRES sequence is associated with SEQ ID NO: 75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 922, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 1193, 119 The sequences shown in any one of 8, 1263, 1276, 1280, 1282, 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299, and 3301 have at least 98% sequence identity. In some embodiments, the IRES sequence is related to the SEQ ID. NO:75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 9 22, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 1193, 119 The sequences shown in any one of 8, 1263, 1276, 1280, 1282, 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299, and 3301 have at least 99% sequence identity. In some embodiments, the IRES sequence contains a SEQ ID. NO:75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 87 4. 922, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 11 The sequence represented by any one of the following: 93, 1198, 1263, 1276, 1280, 1282, 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299, and 3301.
[0018] In some embodiments, the precursor RNA polynucleotide further comprises an accessory element. In some embodiments, the accessory element comprises a miRNA binding site or a fragment thereof, a restriction site or a fragment thereof, an RNA editing motif or a fragment thereof, a zip coding element or a fragment thereof, an RNA transport element or a fragment thereof, a nuclease site or a fragment thereof, or a combination thereof. In some embodiments, the accessory element comprises a binding domain of an IRES trans-acting factor (ITAF) and / or a translation initiation factor. In some embodiments, the binding domain comprises a polyA region, a polyC region, a polyAC region, a polypyrimidine bundle, or a combination or variant thereof. In some embodiments, the ITAF comprises poly(rC)-binding protein 1 (PCBP1), PCBP2, PCBP3, PCBP4, poly(A)-binding protein 1 (PABP1), polypyrimidine bundle-binding protein (PTB), a member of the Argonaute protein family, HNRNPK (nuclear heterogeneous ribonucleoprotein K protein), or La protein, or a fragment or combination thereof. In some embodiments, the core functional element further comprises a coding sequence and optionally a termination sequence located downstream of the coding sequence. In some embodiments, the coding sequence is located downstream of the IRES. In some implementations, the encoded sequence is located upstream of the IRES. In some implementations, the termination sequence is a stop codon or a stop box. In some implementations, the stop box contains one or more stop codons within two or more open reading frames.
[0019] In some embodiments, the precursor RNA polynucleotide comprises: (a) a 5' enhancing intron element, (b) a 5' enhancing exon element, (c) a core functional element, (d) a 3' enhancing exon element, and (e) a 3' enhancing intron element. In some embodiments, elements (a)-(e) are arranged in the order (a) to (e). In some embodiments, the 5' enhancing exon element and / or the 3' enhancing exon element are each contained within the core functional element. In some embodiments, the 5' enhancing exon element and / or the 3' enhancing exon element are each contained within a coding sequence.
[0020] In some embodiments, the 5' enhancing intron element comprises a 3' intron region. In some embodiments, the 3' intron region further comprises the first or second nucleotide of a 3' group I intron splicing site dinucleotide. In some embodiments, the 3' intron region is located at the 3' end of the 5' enhancing intron element. In some embodiments, the 5' enhancing intron element comprises a leading untranslated sequence at the 5' end. In some embodiments, the leading untranslated sequence comprises a spacer region. In some embodiments, the leading untranslated sequence comprises the last nucleotide of the transcription start site. In some embodiments, the leading untranslated sequence comprises 1 to 100 additional nucleotides. In some embodiments, the 5' enhancing intron element comprises a 5' affinity sequence. In some embodiments, the 5' affinity sequence comprises a polyA, polyAC, or polypyrimidine sequence. In some embodiments, the 5' affinity sequence comprises 10 to 100 nucleotides. In some embodiments, the 5' enhancing intron element comprises a 5' external spacer region sequence. In some embodiments, the 5' outer spacer sequence is located between the 5' affinity sequence and the 3' intron region. In some embodiments, the 5' outer spacer sequence has a length of about 6 to 60 nucleotides. In some embodiments, the 5' outer spacer sequence comprises or consists of sequences selected from or composed of sequences of SEQ ID NO:3094-3152.
[0021] In some embodiments, the 5' enhancing intron element comprises: (a) a leading untranslated sequence; (b) a 5' affinity sequence; (c) a 5' outer spacer sequence; and (d) a 3' intron segment comprising the first nucleotide of a 3' group I intron splicing site; wherein the leading untranslated sequence comprises the last nucleotide of the transcription start site and 1 to 100 nucleotides. In some embodiments, (a)-(d) are arranged in the order (a) to (d). In some embodiments, the 5' enhancing intron element comprises: (a) a leading untranslated sequence; (b) a 5' outer spacer sequence; (c) a 5' affinity sequence; and (d) a 3' intron segment comprising the first nucleotide of a 3' group I splicing site; wherein the leading untranslated sequence comprises the last nucleotide of the transcription start site and 1 to 100 nucleotides. In some embodiments, (a)-(d) are arranged in the order (a) to (d). In some embodiments, the 5' enhancing intron element comprises: (a) a leading untranslated sequence; (b) a 5' outer spacer sequence; (c) a 5' affinity sequence; and a 3' intron segment comprising a first nucleotide and a second nucleotide of a 3' group I splice site; wherein the leading untranslated sequence comprises the last nucleotide of the transcription start site and 1 to 100 nucleotides; and wherein the 5' enhancing exon element comprises a 3' exon segment lacking a second nucleotide of a 3' group I splice site dinucleotide. In some embodiments, (a)-(d) are arranged in the order of (a) to (d).
[0022] In some embodiments, the 5' enhancing exon element comprises a 3' exon segment. In some embodiments, the 3' exon segment further comprises a second nucleotide of a 3' group I intron splicing site dinucleotide. In some embodiments, the 3' exon segment comprises 1 to 100 natural nucleotides derived from a natural exon. In some embodiments, the natural exon is derived from a gene containing a group I intron or a fragment thereof. In some embodiments, the natural exon is derived from *Anabaena* bacteria, T4 bacteriophage virus, *Twort* bacteriophage, *Tetrahymena*, or *Azoarcus* bacteria. In some embodiments, the 5' enhancing exon element comprises a 5' internal spacer sequence downstream of the 3' exon segment. In some embodiments, the 5' internal spacer sequence is about 6 to 60 nucleotides in length. In some embodiments, the 5' internal spacer sequence comprises or consists of sequences selected from or composed of sequences of SEQ ID NO:3094-3152.
[0023] In some embodiments, the 5' enhancing exon element comprises, in the following order: (a) a 3' exon segment comprising a second nucleotide including a 3' group I intron splicing site dinucleotide; and (b) a 5' internal spacer sequence, wherein the 3' exon segment comprises 1 to 100 natural nucleotides derived from the natural exon. In some embodiments, the 5' enhancing exon element comprises, in the following order: (a) a 3' exon segment; and (b) a 5' internal spacer sequence, wherein the 3' exon segment comprises 1 to 100 natural nucleotides derived from the natural exon; and wherein the 5' enhancing intron element comprises a 3' intron segment containing a first nucleotide and a second nucleotide containing a 3' group I splicing site dinucleotide.
[0024] In some embodiments, the 3' enhancing exon element comprises a 5' exon segment. In some embodiments, the 5' exon segment comprises the first nucleotide of a 5' group I intron segment. In some embodiments, the 5' exon segment further comprises 1 to 100 nucleotides derived from a natural exon. In some embodiments, the natural exon is derived from a gene containing a group I intron or a fragment thereof. In some embodiments, the 3' enhancing exon element comprises a 3' internal spacer sequence. In some embodiments, the 3' internal spacer sequence is located between the termination sequence and the 5' exon segment. In some embodiments, the length of the 3' internal spacer is about 6 to 60 nucleotides. In some embodiments, the 3' internal spacer comprises or consists of sequences selected from or composed of sequences of SEQ ID NO: 3094-3152. In some embodiments, the 3' enhancing exon element comprises: (a) a 3' internal spacer sequence; and (b) a 5' exon segment comprising a first nucleotide including a 5' group I intron splicing site dinucleotide, wherein the 5' exon segment comprises 1 to 100 nucleotides derived from a natural exon. In some embodiments, the 3' enhancing exon element comprises: (a) a 3' internal spacer sequence; and (b) a 5' exon segment comprising 1 to 100 nucleotides derived from a natural exon; wherein the 3' enhancing intron element comprises a 5' intron segment containing a first nucleotide and a second nucleotide including a 5' group I intron splicing site dinucleotide.
[0025] In some embodiments, the 3' enhancing intron element comprises a 5' intron region. In some embodiments, the 5' intron region comprises a second nucleotide of a 5' group I intron splicing site dinucleotide. In some embodiments, the 3' enhancing intron element comprises a trailing untranslated sequence located at the 3' end of the 5' intron. In some embodiments, the trailing untranslated sequence comprises 3 to 12 nucleotides. In some embodiments, the 3' enhancing intron region comprises a 3' outer spacer sequence. In some embodiments, the 3' outer spacer sequence is located between the 5' intron region and the trailing untranslated sequence. In some embodiments, the 3' outer spacer sequence is 6 to 60 nucleotides in length. In some embodiments, the 3' outer spacer sequence comprises or consists of sequences selected from or composed of sequences of SEQ ID NO:3094-3152. In some embodiments, the 3' enhancing intron element comprises a 3' affinity sequence. In some embodiments, the 3' affinity sequence is located between the 3' outer spacer sequence and the trailing untranslated sequence. In some embodiments, the 3' affinity sequence comprises a polyA, polyAC, or polypyrimidine sequence. In some embodiments, the affinity sequence comprises 10 to 100 nucleotides.
[0026] In some embodiments, the 5' enhancing intron element further comprises a 5' outer double-stranded sequence; wherein the 3' enhancing intron element further comprises a 3' outer double-stranded sequence. In some embodiments, the 5' outer double-stranded sequence and the 3' outer double-stranded sequence are completely or partially complementary to each other. In some embodiments, the 5' outer double-stranded sequence comprises a fully synthetic or partially synthetic nucleotide. In some embodiments, the 3' outer double-stranded sequence comprises a fully synthetic or partially synthetic nucleotide. In some embodiments, the 3' outer double-stranded sequence is about 6 to about 50 nucleotides. In some embodiments, the 5' outer double-stranded sequence is about 6 to about 50 nucleotides. In some embodiments, the 5' enhancing exon element further comprises a 5' inner double-stranded sequence; wherein the 3' enhancing exon element further comprises a 3' inner double-stranded sequence. In some embodiments, the 5' inner double-stranded sequence and the 3' inner double-stranded sequence are completely complementary to each other. In some embodiments, the 5' inner double-stranded sequence and the 3' inner double-stranded sequence are partially complementary to each other. In some embodiments, the 5' inner double-stranded sequence and the 3' inner double-stranded sequence form a double-stranded structure containing at least one mismatched nucleotide pair. In some embodiments, the double-stranded double-stranded structure contains at least two mismatched nucleotide pairs. In some embodiments, the double-stranded double-stranded structure contains at least three mismatched nucleotide pairs. In some embodiments, the double-stranded double-stranded structure contains at least four mismatched nucleotide pairs. In some embodiments, the double-stranded double-stranded structure contains at least five mismatched nucleotide pairs. In some embodiments, the 5' inner double-stranded sequence contains a fully synthetic nucleotide. In some embodiments, the 5' inner double-stranded sequence contains a partially synthetic nucleotide. In some embodiments, the 3' inner double-stranded sequence contains a fully synthetic nucleotide. In some embodiments, the 3' inner double-stranded sequence is about 6 to about 19 nucleotides. In some embodiments, the 5' inner double-stranded sequence is about 6 to about 19 nucleotides. In some embodiments, the 3' enhanced intron segment comprises, in the following order: (a) a 5' intron segment comprising a second nucleotide of a 5' group I intron splicing site dinucleotide; (b) a 3' outer spacer sequence; and (c) a 3' affinity sequence. In some embodiments, the 3' enhanced exon segment comprises, in the following order: (a) a 5' intron segment comprising a first nucleotide of a 5' group I intron splicing site dinucleotide and a second nucleotide of a 5' group I intron splicing site dinucleotide; (b) a 3' outer spacer sequence; and (c) a 3' affinity sequence; wherein the 3' enhanced exon element comprises a 5' exon segment lacking a first nucleotide of a 5' group I intron splicing site dinucleotide.
[0027] In some embodiments, the precursor RNA polynucleotide comprises: (a) a leading untranslated sequence; (b) a 5' affinity sequence; (c) a 5' outer double-stranded sequence; (d) a 5' spacer sequence; (e) a 3' intron region; (f) a 3' exon region; (g) a 5' inner double-stranded sequence; (h) a 5' inner spacer sequence; (i) a translation initiation element; (j) a coding sequence; (k) a termination sequence; (l) a 3' inner spacer sequence; (m) a 3' inner double-stranded sequence; (n) a 5' exon region; (o) a 5' intron region; (p) a 3' outer double-stranded sequence; (q) a 3' affinity sequence; and (r) a trailing untranslated sequence. In some embodiments, (a)-(r) are arranged in the order (a) to (r). In some embodiments, the precursor RNA polynucleotide comprises: (a) a leading untranslated sequence; (b) a 5' affinity sequence; (c) a 5' outer spacer sequence; (d) a 3' intron region; (e) a 3' exon region; (f) a 5' inner double-stranded sequence; (g) a 5' inner spacer sequence; (h) a translation initiation element; (i) a coding sequence; (j) a termination sequence; (k) a 3' inner spacer sequence; (l) a 3' inner double-stranded sequence; (m) a 5' exon region; (n) a 5' intron region; (o) a 3' outer spacer sequence; (p) a 3' affinity sequence; and (q) a trailing untranslated sequence. In some embodiments, (a)-(q) are arranged in the order of (a) to (q). In some embodiments, the precursor RNA polynucleotide comprises: (a) a leading untranslated sequence; (b) a 5' affinity sequence; (c) a 5' outer spacer sequence; (d) a 3' intron region; (e) a 3' exon region; (f) a 5' inner spacer sequence; (g) a translation initiation element; (h) a coding sequence; (i) a termination sequence; (j) a 3' inner spacer sequence; (k) a 5' exon region; (l) a 5' intron region; (m) a 3' outer spacer sequence; (n) a 3' affinity sequence; and (o) a trailing untranslated sequence. In some embodiments, (a)-(o) are arranged in the order (a) to (o). In some embodiments, the precursor RNA polynucleotide comprises: (a) a leading untranslated sequence; (b) a 5' affinity sequence; (c) a 5' outer double-stranded sequence; (d) a 5' spacer sequence; (e) a 3' intron region; (f) a 3' exon region; (g) a 5' inner double-stranded sequence; (h) a 5' inner spacer sequence; (i) a termination sequence; (j) a coding sequence; (k) a translation initiation element; (l) a 3' inner spacer sequence; (m) a 3' inner double-stranded sequence; (n) a 5' exon region; (o) a 5' intron region; (p) a 3' outer double-stranded sequence; (q) a 3' affinity sequence; and (r) a trailing untranslated sequence. In some embodiments, (a)-(r) are arranged in the order (a) to (r).
[0028] In some embodiments, the coding sequence comprises two or more protein-coding regions. In some embodiments, the coding sequence comprises a sequence encoding a proteolytic cleavage site and / or a ribosomal cleavage element between a first expression sequence and a second expression sequence. In some embodiments, the ribosomal cleavage element is a self-cleaving spacer region. In some embodiments, the precursor RNA polynucleotide further comprises a polynucleotide sequence encoding a 2A ribosomal cleavage peptide. In some embodiments, the precursor RNA polynucleotide comprises the following sequences operatively linked to and / or operatively linked to each other with IRES: (1) a 3' group I intron segment; (2) a coding sequence encoding a therapeutic protein; and (3) a 5' group I intron segment. In some embodiments, the 3' group I intron segment and the 5' group I intron segment are each derived from a bacterial phage, a viral vector, an organelle genome, or a nuclear rDNA gene. In some embodiments, the 3' group I intron and the 5' group I intron are each derived from *Anabaena*, T4 bacteriophage, *Tovot phage*, *Tetrahymena*, or *Vibrio azoospora*. In some embodiments, the precursor RNA polynucleotide includes one or more spacer sequences operatively linked to at least one of the 3' group I intron, the IRES sequence, the coding sequence, and the 5' group I intron. In some embodiments, the precursor RNA polynucleotide includes two spacer sequences. In some embodiments, the two spacer sequences include a 5' outer spacer sequence and a 3' outer spacer sequence, or a 5' inner spacer sequence and a 3' inner spacer sequence. In some embodiments, the precursor RNA polynucleotide includes four spacer sequences. In some embodiments, the four spacer sequences include a 5' outer spacer sequence, a 3' outer spacer sequence, a 5' inner spacer sequence, and a 3' inner spacer sequence. In some embodiments, the precursor RNA polynucleotide comprises a 3' exon segment and a 5' exon segment, each derived from a natural exon. In some embodiments, the precursor RNA polynucleotide comprises the following elements operatively linked to each other: (a) a 5' outer spacer sequence; (b) a 3' group I intron segment; (c) a 5' exon segment; (d) a 5' inner double-stranded sequence; (e) an IRES sequence; (f) a coding sequence; (g) a 3' inner double-stranded sequence; (h) a 3' exon segment; (j) a 5' group I intron segment; and (k) a 3' outer spacer sequence. In some embodiments, elements (a)-(k) are arranged in the order (a)-(k).In some embodiments, the precursor RNA polynucleotide comprises the following elements operatively linked together: (a) a 3' group I intron region; (b) a 5' exon region; (c) a 5' internal double-stranded sequence; (d) a 5' internal spacer region sequence; (e) an IRES sequence; (f) a coding sequence; (g) a 3' internal spacer region sequence; (h) a 3' internal double-stranded sequence; (i) a 3' exon region; and (j) a 5' group I intron region. In some embodiments, elements (a)-(j) are arranged in the order (a)-(j). In some embodiments, the precursor RNA polynucleotide comprises the following elements operatively linked together: (a) a 5' outer spacer sequence; (b) a 3' group I intron segment; (c) a 5' exon segment; (d) a 5' inner double-stranded sequence; (e) a 5' inner spacer sequence; (f) an IRES sequence; (g) a coding sequence; (h) a 3' inner spacer sequence; (i) a 3' inner double-stranded sequence; (j) a 5' exon element; (k) a 5' group I intron segment; and (l) a 3' outer spacer sequence. In some embodiments, elements (a)-(l) are arranged in the order (a)-(l). In some embodiments, the precursor RNA polynucleotide comprises fully synthesized nucleotides. In some embodiments, the precursor RNA polynucleotide comprises partially synthesized nucleotides. In some implementations, precursor RNA polynucleotides are transcribed from vectors or DNA polynucleotides comprising PCR products, linearized plasmids, nonlinear plasmids, linearized microloops, nonlinear microloops, viral vectors, granules, cDNA, or artificial chromosomes.
[0029] In some embodiments, this document discloses oRNA generated using precursor RNA polynucleotides from any of the foregoing aspects and embodiments. In some embodiments, the oRNA comprises an IRES sequence and a coding sequence. In some embodiments, the IRES sequence is upstream of the coding sequence. In some embodiments, the IRES sequence is downstream of the coding sequence. In some embodiments, the oRNA comprises: (a) a 5' exon segment; (b) a 5' internal double-stranded sequence; (c) a 5' internal spacer sequence; (d) an IRES sequence; (e) a coding sequence; (f) a 3' internal spacer sequence; (g) a 3' internal double-stranded sequence; and (h) a 5' exon element. In some embodiments, (a)-(h) are arranged in the order of (a) to (h).
[0030] In some embodiments, this document discloses a pharmaceutical composition comprising an oRNA containing a sequence having at least 85% sequence identity with the sequence shown in any one of SEQ ID NO:14067-24829, and a pharmaceutically acceptable salt, buffer, diluent, or combination thereof.
[0031] In some embodiments, this document discloses a pharmaceutical composition comprising an oRNA having at least 85% sequence identity with a sequence shown in any one of SEQ ID NO:14067-24829, and a pharmaceutically acceptable salt, buffer, diluent, or combination thereof; wherein the oRNA is capable of expressing a therapeutic protein in a cell.
[0032] In some embodiments, this document discloses a pharmaceutical composition comprising an oRNA containing a sequence having at least 85% sequence identity with the sequence shown in any one of SEQ ID NO:14067-24829, a cell, and a pharmaceutically acceptable salt, buffer, diluent, or combination thereof; wherein the oRNA is capable of expressing a therapeutic protein in the cell.
[0033] In some embodiments, this document discloses a pharmaceutical composition comprising an oRNA having at least 85% sequence identity with a sequence shown in any one of SEQ ID NO:14067-24829, a transfer medium capable of delivering the oRNA to cells, and a pharmaceutically acceptable salt, buffer, diluent, or combination thereof; wherein the oRNA is capable of expressing a therapeutic protein in cells.
[0034] In some embodiments, this document discloses a pharmaceutical composition comprising an oRNA having at least 85% sequence identity with a sequence shown in any one of SEQ ID NO: 793, 876, 1017, 1216 and 3291, and a pharmaceutically acceptable salt, buffer, diluent or combination thereof, wherein the oRNA is capable of expressing a therapeutic protein in a cell.
[0035] In some embodiments, this document discloses a pharmaceutical composition comprising an oRNA containing a sequence having at least 85% sequence identity with the sequence shown in any one of SEQ ID NO: 793, 876, 1017, 1216 and 3291, T cells, and pharmaceutically acceptable salts, buffers, diluents or combinations thereof.
[0036] In some embodiments, this document discloses a pharmaceutical composition comprising an oRNA having at least 85% sequence identity with a sequence shown in any one of SEQ ID NO: 793, 876, 1017, 1216 and 3291, a transfer medium capable of delivering the oRNA to T cells, and a pharmaceutically acceptable salt, buffer, diluent or combination thereof.
[0037] In some embodiments, the pharmaceutical composition comprises an oRNA having at least 85% sequence identity with the sequence shown in any one of SEQ ID NO: 793, 876, 1017, 1216, and 3291, a transfer medium capable of delivering the oRNA to T cells, and a pharmaceutically acceptable salt, buffer, diluent, or combination thereof. In some embodiments, the sequence has at least 95% sequence identity with the sequence shown in any one of SEQ ID NO: 793, 876, 1017, 1216, and 3291. In some embodiments, the sequence has at least 98% sequence identity with the sequence shown in any one of SEQ ID NO: 793, 876, 1017, 1216, and 3291. In some embodiments, the sequence has at least 98% sequence identity with the sequence shown in any one of SEQ ID NO: 793, 876, 1017, 1216, and 3291. In some embodiments, the sequence comprises the sequence shown in any one of SEQ ID NO:793, 876, 1017, 1216 and 3291.
[0038] In some embodiments, this document discloses a pharmaceutical composition comprising an oRNA having at least 85% sequence identity with a sequence shown in any one of SEQ ID NO: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293, and 3302, and a pharmaceutically acceptable salt, buffer, diluent, or combination thereof, wherein the oRNA is capable of expressing a therapeutic protein in immune cells (e.g., T cells, myeloid cells, and / or NK cells).
[0039] In some embodiments, this document discloses a pharmaceutical composition comprising an oRNA having at least 85% sequence identity with a sequence shown in any one of SEQ ID NO: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293, and 3302, T cells, and pharmaceutically acceptable salts, buffers, diluents, or combinations thereof.
[0040] In some embodiments, this document discloses a pharmaceutical composition comprising an oRNA having at least 85% sequence identity with a sequence shown in any one of SEQ ID NO: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293, and 3302, a transfer medium capable of delivering the oRNA to T cells, and a pharmaceutically acceptable salt, buffer, diluent, or combination thereof.
[0041] In some embodiments, the TIE comprises a sequence having at least 90% identity with the sequence shown in any one of SEQ ID NO:14067-24829. In some embodiments, the sequence has at least 95% identity with the sequence shown in any one of SEQ ID NO:14067-24829. In some embodiments, the sequence has at least 98% identity with the sequence shown in any one of SEQ ID NO:14067-24829. In some embodiments, the sequence has at least 99% identity with the sequence shown in any one of SEQ ID NO:14067-24829. In some embodiments, the sequence comprises a sequence shown in any one of SEQ ID NO:14067-24829.
[0042] In some embodiments, the TIE comprises a sequence having at least 90% sequence identity with the sequence shown in any one of SEQ ID NO: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293 and 3302. In some embodiments, the sequence has at least 95% sequence identity with the sequence shown in any one of SEQ ID NO: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293 and 3302. In some embodiments, the sequence has at least 98% sequence identity with the sequence shown in any one of SEQ ID NO: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293 and 3302. In some embodiments, the sequence has at least 99% sequence identity with the sequence shown in any one of SEQ ID NO: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293 and 3302. In some embodiments, the sequence comprises the sequence shown in any one of SEQ ID NO: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293 and 3302.
[0043] In some embodiments, this document discloses a pharmaceutical composition comprising the same components as those in SEQ ID NO: 75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 922, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 1193, 1198, 1263, 1276, 1280, 1282, 2601. The oRNA having at least 85% sequence identity with a sequence shown in any one of 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299 and 3301, and a pharmaceutically acceptable salt, buffer, diluent or combination thereof, wherein the oRNA is capable of expressing a therapeutic protein in T cells.
[0044] In some embodiments, this document discloses a pharmaceutical composition comprising the same components as those in SEQ ID NO: 75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 922, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 1193, 1198, 1263, 1276, 1280, 1 oRNA, T cells, and pharmaceutically acceptable salts, buffers, diluents, or combinations thereof, having at least 85% sequence identity with any of the sequences shown in any of the following: 282, 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299, and 3301.
[0045] In some embodiments, this document discloses a pharmaceutical composition comprising the same components as those in SEQ ID NO: 75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 922, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 1193, 1198, 1263, 1276, 1280, 1282, 2601. oRNA having at least 85% sequence identity with any of the sequences shown in any of the following: 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299, and 3301; transfer mediators capable of delivering oRNA to T cells; and pharmaceutically acceptable salts, buffers, diluents, or combinations thereof.
[0046] In some implementations, the TIE contains the SEQ ID NO: 75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 922, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 1193, 1198. A sequence having at least 90% sequence identity with any of the sequences shown in SEQ ID NO. 1263, 1276, 1280, 1282, 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299, and 3301. In some embodiments, the sequence is identical to SEQ ID NO. NO:75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 9 22, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 1193, 119 The sequences shown in any one of 8, 1263, 1276, 1280, 1282, 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299, and 3301 have at least 95% sequence identity. In some embodiments, the sequence is related to SEQ ID. NO:75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 9 22, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 1193, 119 The sequence represented by any one of 8, 1263, 1276, 1280, 1282, 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299 and 3301 has at least 98% sequence identity.In some implementations, the sequences are associated with SEQ ID NO: 75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 922, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 1193, 119 The sequences shown in any one of 8, 1263, 1276, 1280, 1282, 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299, and 3301 have at least 99% sequence identity. In some embodiments, the sequence comprises SEQ ID NO. IDNO:75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 922, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 1 The sequence represented by any one of 193, 1198, 1263, 1276, 1280, 1282, 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299, and 3301.
[0047] In some embodiments, the oRNA comprises the following elements in the following order: (1) a TIE sequence (e.g., containing an IRES sequence); and (2) a coding sequence encoding a therapeutic protein, wherein elements (1) and (2) are operatively linked to each other. In some embodiments, the TIE sequence (e.g., containing an IRES sequence) is capable of promoting the expression of the therapeutic protein encoded by the precursor RNA polynucleotide in cells. In some embodiments, the TIE sequence (e.g., containing an IRES sequence) is capable of promoting the expression of the therapeutic protein in cells such that the expression level of the protein in cells is comparable to or higher than that when a control TIE sequence (e.g., containing an IRES sequence) (e.g., SEQ ID NO: 3303) is used. In some embodiments, the TIE sequence (e.g., containing an IRES sequence) is capable of promoting the expression of the therapeutic protein in cells such that the expression level of the protein in cells is about 1.5, 2, 3, 4, 5, or higher than that mediated by a control TIE sequence (e.g., containing an IRES sequence) (e.g., SEQ ID NO: 3303).
[0048] In some embodiments, the TIE sequence (e.g., containing an IRES sequence) is capable of promoting the expression of a therapeutic protein encoded by a precursor RNA polynucleotide in immune cells. In some embodiments, the TIE sequence (e.g., containing an IRES sequence) is capable of promoting the expression of a therapeutic protein in immune cells such that the expression level of the protein in immune cells is comparable to or higher than that when using a control TIE sequence (e.g., containing an IRES sequence) (e.g., SEQ ID NO: 3303). In some embodiments, the TIE sequence (e.g., containing an IRES sequence) is capable of promoting the expression of a therapeutic protein in immune cells such that the expression level of the protein in immune cells is about 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, or higher than that mediated by a control TIE sequence (e.g., containing an IRES sequence) (e.g., SEQ ID NO: 3303). Immune cells include, but are not limited to, T cells, bone marrow cells (e.g., macrophages), and NK cells.
[0049] In some embodiments, the TIE sequence (e.g., containing an IRES sequence) is capable of promoting the expression of a therapeutic protein encoded by a precursor RNA polynucleotide in non-immune cells (e.g., muscle cells or hepatocytes). In some embodiments, the TIE sequence (e.g., containing an IRES sequence) is capable of promoting the expression of a therapeutic protein in non-immune cells (e.g., muscle cells or hepatocytes) such that the expression level of the protein in non-immune cells (e.g., muscle cells or hepatocytes) is comparable to or higher than that when using a control TIE sequence (e.g., containing an IRES sequence) (e.g., SEQ ID NO: 3303). In some embodiments, the TIE sequence (e.g., containing an IRES sequence) is capable of promoting the expression of the therapeutic protein in non-immune cells (e.g., muscle cells or hepatocytes) such that the expression level of the protein in non-immune cells (e.g., muscle cells or hepatocytes) is about 1.5, 2, 3, 4, 5, or higher than that mediated by a control TIE sequence (e.g., containing an IRES sequence) (e.g., SEQ ID NO: 3303).
[0050] In some embodiments, the TIE sequence (e.g., containing an IRES sequence) is capable of promoting the expression of a therapeutic protein encoded by a precursor RNA polynucleotide in T cells. In some embodiments, the TIE sequence (e.g., containing an IRES sequence) is capable of promoting the expression of a therapeutic protein in T cells such that the expression level of the protein in T cells is comparable to or higher than that when using a control IRES (e.g., SEQ ID NO: 3303). In some embodiments, the TIE sequence (e.g., containing an IRES sequence) is capable of promoting the expression of a therapeutic protein in T cells such that the expression level of the protein in T cells is about 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, or higher than that mediated by a control TIE sequence (e.g., containing an IRES sequence) (e.g., SEQ ID NO: 3303).
[0051] In some embodiments, the therapeutic protein includes a chimeric protein. In some embodiments, the chimeric protein includes a chimeric antigen receptor (CAR), a T-cell receptor (TCR), a B-cell receptor (BCR), an immune cell activation or inhibition receptor, a recombinant fusion protein, a chimeric mutant protein, or a fusion protein, or a combination thereof. In some embodiments, the therapeutic protein includes an antibody, a nanobody, a non-antibody protein, an immunomodulatory ligand, a receptor, a structural protein, a growth factor ligand or receptor, a hormone or hormone receptor, a transcription factor, a checkpoint inhibitor or agonist, an Fc fusion protein, an anticoagulant, a coagulation factor, a chaperone protein, an antimicrobial protein, a structural protein, a biochemical enzyme, a tight junction protein, a mitochondrial stress-response protein, a cytoskeletal protein, a metal-binding protein, or a small molecule, or a combination thereof. In some embodiments, the therapeutic protein includes antibodies, nanobodies, non-antibody proteins, immunomodulatory ligands, receptors, structural proteins, growth factor ligands or receptors, hormones or hormone receptors, transcription factors, checkpoint inhibitors or agonists, Fc fusion proteins, anticoagulants, coagulation factors, chaperone proteins, antimicrobial proteins, structural proteins, biochemical enzymes, tight junction proteins, mitochondrial stress-response proteins, cytoskeletal proteins, metal-binding proteins, or small molecules or combinations thereof. In some embodiments, the structural protein includes channel proteins or nuclear pore proteins. In some embodiments, the coding sequence is codon-optimized. In some embodiments, the coding sequence is codon-optimized. In some embodiments, the coding sequence is codon-optimized. In some embodiments, the coding sequence is optimized to have a GC content between 50% and 70%. In some embodiments, the coding sequence is optimized to have a GC content between 55% and 64%. In some embodiments, the oRNA is about 0.1 to about 15 kilobases in length. In some embodiments, the pharmaceutical composition has an in vivo therapeutic effect duration of at least 20 hours in humans. In some embodiments, the pharmaceutical composition has a functional half-life of at least 6 hours. In some embodiments, the pharmaceutical composition has a duration of therapeutic effect in human cells greater than or equal to that of an equivalent linear RNA polynucleotide containing the same expression sequence. In some embodiments, the pharmaceutical composition has a longer in vivo therapeutic effect in humans than that of an equivalent linear RNA polynucleotide containing the same expression sequence. In some embodiments, the duration of in vivo therapeutic effect in humans is longer than that of an equivalent linear RNA polynucleotide containing the same expression sequence. In some embodiments, the pharmaceutical composition is formulated for delivery to T cells via electroporation. In some embodiments, the oRNA is contained in a nucleic acid expression vector. In some embodiments, the nucleic acid expression vector is selected from the group consisting of: PCR products, linearized plasmids, nonlinearized plasmids, linearized microloops, nonlinearized microloops, granules, cDNA, or artificial chromosomes.
[0052] In some embodiments, the transfer medium comprises nanoparticles. In some embodiments, the nanoparticles are lipid nanoparticles, core-shell nanoparticles, biodegradable nanoparticles, biodegradable lipid nanoparticles, polymer nanoparticles, polymeric complexes, or biodegradable polymer nanoparticles. In some embodiments, the nanoparticles are lipid nanoparticles, core-shell nanoparticles, or biodegradable nanoparticles. In some embodiments, the nanoparticles comprise one or more cationic lipids, ionizable lipids, or poly-β-amino esters, or combinations thereof. In some embodiments, the nanoparticles comprise one or more non-cationic lipids. In some embodiments, the nanoparticles comprise one or more non-cationic lipids. In some embodiments, the one or more structural lipids include cholesterol. In some embodiments, the nanoparticles comprise arachidonic acid, leukotrienes, oleic acid, or combinations thereof. In some embodiments, the molar ratio of ionizable lipids in the transfer medium is about 40% to about 60% of the total lipids present in the transfer medium. In some embodiments, the molar ratio of accessory lipids in the transfer medium is about 3.5% to about 14% of the total lipids present in the transfer medium. In some embodiments, the molar ratio of PEG-lipids in the transfer medium is about 0.5% to about 5% of the total lipids present in the LNP. In some embodiments, the structural lipids in the transfer medium are about 28% to about 50% of the total lipids present in the transfer medium. In some embodiments, the molar ratio of ionizable lipids:helper lipids:structural lipids:PEG-lipids is about 45:9:44:2, about 50:10:38.5:1.5, about 41:12:45:2, about 62:4:33:1, or about 53:5:41:1. In some embodiments, the nanoparticles have a lipid to phosphate (IL:P) ratio of about 3 to about 6, such as about 3, about 4, about 4.5, about 5, about 5.5, or about 6. In some embodiments, the transfer medium is formulated for endosome release of cyclic RNA polynucleotides. In some embodiments, the nanoparticles include a targeting portion operatively linked thereto, wherein the targeting portion mediates receptor-mediated endocytosis, endosome fusion, or direct fusion into cells without cell separation or purification. In some embodiments, the targeting portion includes small molecules, scFvs, nanobodies, peptides, cyclic peptides, bicyclic or tricyclic peptides, microbodies, polynucleotides, aptamers, engineered scaffold proteins, heavy chain variable regions, light chain variable regions, or fragments thereof. In some embodiments, the transfer medium includes liposomes, dendritic polymers, carbohydrate carriers, glycan nanomaterials, fusion bodies, exogenous bodies, or combinations thereof.
[0053] In some embodiments, the nanoparticles include a targeting portion operatively linked thereto, wherein the targeting portion mediates receptor-mediated endocytosis, endosome fusion, or direct fusion into T cells without cell separation or purification. In some embodiments, the T cells are CD8+ cytotoxic T cells, CD4+ helper T cells (Th), regulatory T (Treg) cells, memory T cells, or innate-like T cells. In some embodiments, the Th cells are Th1 cells, Th2 cells, Th17 cells, Th9 cells, Tfh cells, or Th22 cells. In some embodiments, the memory T cells are central memory T cells (Tcm), effector memory T cells (Tem), tissue-resident memory T cells (Trm), or virtual memory T cells. In some embodiments, the innate-like T cells are natural killer T (NKT) cells, mucosa-associated invariant T cells (MAIT) or γδ T cells (γδT cells).
[0054] In some embodiments, this document discloses a eukaryotic cell comprising a precursor RNA polynucleotide, oRNA, or pharmaceutical composition of any of the foregoing aspects and embodiments. In some embodiments, the eukaryotic cell is a human cell. In some embodiments, the eukaryotic cell is an immune cell. In some embodiments, the eukaryotic cell is a T cell, dendritic cell, macrophage, B cell, neutrophil, or basophil.
[0055] In some embodiments, this document discloses a T cell comprising a precursor RNA polynucleotide, oRNA, or pharmaceutical composition of any of the foregoing aspects and embodiments. In some embodiments, the T cell is a human T cell. In some embodiments, the T cell is a CD8+ cytotoxic T cell, a CD4+ helper T cell (Th), a regulatory T (Treg) cell, a memory T cell, or an innate-like T cell. In some embodiments, the Th cell is a Th1 cell, a Th2 cell, a Th17 cell, a Th9 cell, a Tfh cell, or a Th22 cell. In some embodiments, the memory T cell is a central memory T cell (Tcm), an effector memory T cell (Tem), a tissue-resident memory T cell (Trm), or a virtual memory T cell. In some embodiments, the innate-like T cell is a natural killer T (NKT) cell, a mucosa-associated invariant T cell (MAIT), or a γδ T cell (γδT cell).
[0056] In some embodiments, this document discloses a prokaryotic cell comprising a precursor RNA polynucleotide, oRNA, or pharmaceutical composition of any of the foregoing aspects and embodiments.
[0057] In some embodiments, this document discloses a method for expressing a therapeutic protein in a cell, the method comprising contacting the cell with a precursor RNA polynucleotide, oRNA, or pharmaceutical composition of any of the foregoing aspects and embodiments, thereby expressing the therapeutic protein in the cell.
[0058] In some embodiments, this document discloses a method for expressing a therapeutic protein in T cells, the method comprising contacting the T cells with a precursor RNA polynucleotide, oRNA, or pharmaceutical composition of any of the foregoing aspects and embodiments, thereby expressing the therapeutic protein in the T cells. In some embodiments, the TIE sequence (e.g., containing an IRES sequence) is capable of promoting the expression of the therapeutic protein in T cells such that the expression level of the protein in the T cells is comparable to or higher than that when using a control TIE sequence (e.g., containing an IRES sequence) (e.g., SEQ ID NO: 3303). In some embodiments, the TIE sequence (e.g., containing an IRES sequence) is capable of promoting the expression of the therapeutic protein in T cells such that the expression level of the protein in the T cells is about 1.5 times, 2 times, 3 times, 4 times, 5 times, or higher than that mediated by a control IRES (e.g., SEQ ID NO: 3303) when using a control TIE sequence (e.g., containing an IRES sequence) (e.g., SEQ ID NO: 3303).
[0059] In some embodiments, this document discloses a method for expressing a protein from an oRNA molecule in a cell, the method comprising providing the cell with an oRNA containing an IRES adjacent to a sequence selected from any one of SEQ ID NO:14067-24829.
[0060] In some embodiments, this document discloses a method for expressing a protein from an oRNA molecule in T cells, the method comprising providing the T cells with an oRNA containing an IRES comprising a sequence selected from any one of SEQ ID NO: 793, 876, 1017, 1216, and 3291 adjacent to the coding sequence. In some embodiments, the IRES is capable of promoting the expression of a therapeutic protein in T cells such that the expression level of the protein in the T cells is comparable to or higher than that when using a control IRES (e.g., SEQ ID NO: 3303). In some embodiments, the IRES is capable of promoting the expression of a therapeutic protein in T cells such that the expression level of the protein in the T cells is about 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, or higher than that mediated by a control IRES (e.g., SEQ ID NO: 3303).
[0061] In some embodiments, this document discloses a method for expressing a protein from an oRNA molecule in T cells, the method comprising providing T cells with an oRNA containing an IRES (isolated molecule) adjacent to the coding sequence, selected from any one of SEQ ID NO: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293, and 3302. In some embodiments, the IRES is capable of promoting the expression of a therapeutic protein in T cells such that the expression level of the protein in T cells is comparable to or higher than that when using a control IRES (e.g., SEQ ID NO: 3303). In some implementations, the IRES can promote the expression of therapeutic proteins in T cells such that the expression level of the protein in T cells is about 1.5, 2, 3, 4, 5 or higher than that mediated by a control IRES (e.g., SEQ ID NO:3303).
[0062] In some embodiments, this document discloses a method for expressing a protein from an oRNA molecule in T cells, the method comprising providing the T cells with an oRNA molecule containing a protein adjacent to the coding sequence selected from SEQ ID NO: 75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 922, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 1193, 11 The oRNA of IRES containing any of the sequences shown in SEQ ID NO: 98, 1263, 1276, 1280, 1282, 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299, and 3301. In some embodiments, the IRES is capable of promoting the expression of therapeutic proteins in T cells such that the expression level of the protein in T cells is comparable to or higher than that when using a control IRES (e.g., SEQ ID NO: 3303). In some implementations, the IRES can promote the expression of therapeutic proteins in T cells such that the expression level of the protein in T cells is about 1.5, 2, 3, 4, 5 or higher than that mediated by a control IRES (e.g., SEQ ID NO:3303).
[0063] In some embodiments, this document discloses a method of treating a subject suffering from a disease or condition, the method comprising administering a pharmaceutical composition of any of the foregoing aspects and embodiments. In some embodiments, the disease or condition is cancer. In some embodiments, the disease or condition is an autoimmune disease or condition. In some embodiments, the subject is a person. Attached Figure Description
[0064] Figure 1 depicts the HEK293 cells 24 hours after transfection with circular RNA containing Gaussian luciferase expression sequences and various IRES sequences. Figure 1A , Figure 1D and Figure 1E ), HepG2 ( Figure 1B ) or 1C1C7 ( Figure 1C The luminescence in the supernatant of cells.
[0065] Figure 2 depicts the HEK293 cells 24 hours after transfection with circular RNA containing Gaussian luciferase expression sequences and various IRES sequences of different lengths. Figure 2A ), HepG2 ( Figure 2B ) or 1C1C7 ( Figure 2C The luminescence in the supernatant of cells.
[0066] Figure 3 depicts the selected IRES constructs in HepG2 as measured by luminescence. Figure 3A ) or 1C1C7 ( Figure 3B Stability of cells over 3 days.
[0067] Figure 4A and Figure 4B Protein expression from selected IRES constructs in Jurkat cells was depicted as measured by luminescence from secreted Gaussia luciferase in cell supernatant.
[0068] Figure 5A and Figure 5B The stability of selected IRES constructs in Jurkat cells over 3 days was described, as measured by luminescence.
[0069] Figure 6 depicts the 24-hour luminescence of modified linear, unpurified circular, or purified circular RNA encoding Gaussian luciferase. Figure 6A ) or relative luminescence within 3 days ( Figure 6B A comparison of ).
[0070] Figure 7 depicts the effects of electroporation of Jurkat cells with modified linear, unpurified circular, or purified circular RNA followed by IFNγ (...). Figure 7A ), IL-6 Figure 7B ), IL-2 Figure 7C ), RIG-I ( Figure 7D ), IFN-β1 ( Figure 7E ) and TNFα Figure 7F Transcription induction of ).
[0071] Figure 8 depicts a primary human monocyte ( Figure 8A ) and macrophages ( Figure 8B and Figure 8C A comparison of the luminescence of circular RNA and modified linear RNA encoding Gaussia luciferase in ).
[0072] Figure 9 depicts the relative luminescence in the supernatant of primary T cells over 3 days after transduction with circular RNA containing Gaussian luciferase expression sequences and different IRES sequences. Figure 9A ) or 24-hour light emission ( Figure 9B ).
[0073] Figure 10 depicts the 24-hour luminescence in the supernatant of primary T cells after transduction with circular RNA containing the Gaussian luciferase expression sequence or modified linear RNA. Figure 10A ) or relative luminescence within 3 days ( Figure 10B ) and 24-hour luminescence in PBMC ( Figure 10C ).
[0074] Figure 11 depicts the HPLC chromatograms of RNA constructs with different substitution sites. Figure 11A ) and cyclization efficiency ( Figure 11B ).
[0075] Figure 12 depicts the HPLC chromatograms of RNA constructs with different introns and / or substitution sites. Figure 12A ) and cyclization efficiency ( Figure 12B ).
[0076] Figure 13 depicts the HPLC chromatograms of three RNA constructs with or without homologous arms. Figure 13A ) and cyclization efficiency ( Figure 13B ).
[0077] Figure 14 The circularization efficiency of three RNA constructs—those without homologous arms or with homologous arms of different lengths and GC contents—was depicted.
[0078] Figure 15A and Figure 15B HPLC chromatograms were depicted, showing the contribution of strong homologous arms to improved splicing efficiency, the relationship between cyclization efficiency and nicks in selected constructs, and the combination of substitution sites and homologous arms assumed to demonstrate improved cyclization efficiency.
[0079] Figure 16 Fluorescence images of T cells co-cultured with Raji cells expressing GFP and firefly luciferase (left) or electroporated with circular RNA encoding CAR (right) are shown.
[0080] Figure 17 The images show bright-field (left), fluorescence (middle), and overlay (right) images of T cells co-cultured with Raji cells expressing GFP and firefly luciferase, simulated electroporation (top) or electroporation with circular RNA encoding CAR (bottom).
[0081] Figure 18 The study describes the specific lysis of Raji target cells by T cells via simulated electroporation or electroporation with circular RNA encoding different CAR sequences.
[0082] Figure 19 depicts the luminescence in the supernatant of Jurkat cells (left) or resting primary human CD3+ T cells (right) 24 hours after transduction with linear or circular RNA containing Gaussian luciferase expression sequences and different IRES sequences. Figure 19A ), and relative luminescence over 3 days ( Figure 19B ).
[0083] Figure 20 depicts the effect of electroporation of human CD3+ T cells with modified linear, unpurified circular or purified circular RNA on IFN-β1 (…). Figure 20A ), RIG-I ( Figure 20B ), IL-2 Figure 20C ), IL-6 Figure 20D ), IFNγ ( Figure 20E ) and TNFα Figure 20F Transcription induction of ).
[0084] Figure 21 illustrates the specific lysis of Raji target cells by human primary CD3+ T cells electroporated with circRNA encoding CAR, as determined by detecting firefly bioluminescence. Figure 21A ), and IFNγ transcriptional induction 24 hours after electroporation with different amounts of circular or linear RNA encoding CAR sequences ( Figure 21B ).
[0085] Figure 22 depicts human primary CD3+ T cells electroporated with circular or linear RNA encoding CAR at different E:T ratios, as determined by detecting firefly bioluminescence. Figure 22A and Figure 22B ) Specific lysis of target cells or non-target cells.
[0086] Figure 23 The study depicted the specific lysis of target cells by human CD3+ T cells electroporated with CAR-encoded RNA at 1, 3, 5, and 7 days post-electroporation.
[0087] Figure 24 The study depicted the specific lysis of target cells by human CD3+ T cells electroporated with circular RNA encoding CARs targeting CD19 or BCMA.
[0088] Figure 25 The total organ throughput harvested from CD-1 mice was depicted by administration of circular RNA formulated with FLuc and containing 50% lipid 10b-15, 10% DSPC, 1.5% PEG-DMG, and 38.5% cholesterol.
[0089] Figure 26The image shows a luminescent image of an organ harvested from CD-1 mice administered with circular RNA formulated with 50% lipid 10b-15, 10% DSPC, 1.5% PEG-DMG, and 38.5% cholesterol.
[0090] Figure 27 depicts the molecular characterization of lipids 10a-26 and 10a-27. Figure 27A The proton nuclear magnetic resonance (NMR) spectrum of lipid 10a-26 is shown. Figure 27B The retention time of lipid 10a-26 as measured by liquid chromatography-mass spectrometry (LC-MS) is shown. Figure 27C The mass spectrum of lipid 10a-26 is shown. Figure 27D The proton NMR spectrum of lipid 10a-27 is shown. Figure 27E The retention time of lipid 10a-27 as measured by LC-MS is shown. Figure 27F The mass spectrum of lipid 10a-27 is shown.
[0091] Figure 28 depicts the molecular characterization of lipid 22-S14 and its synthetic intermediates. Figure 28A depicts the NMR spectrum of 2-(tetradecylthio)ethane-1-ol. Figure 28B depicts the NMR spectrum of 2-(tetradecylthio)ethyl acrylate. Figure 28C The NMR spectrum of bis(2-(tetradecylthio)ethyl)3,3'-((3-(2-methyl-1H-imidazol-1-yl)propyl)azadiyl)dipropionate (lipid 22-S14) was depicted.
[0092] Figure 29 The NMR spectrum of bis(2-(tetradecylthio)ethyl)3,3'-((3-(1H-imidazol-1-yl)propyl)azadiyl)dipropionate (lipid 93-S14) was depicted.
[0093] Figure 30 depicts the molecular characterization of 8-((3-(2-methyl-1H-imidazol-1-yl)propyl)(8-(nonoxy)-8-oxooctyl)amino)octanoic acid heptadecan-9-yl ester (lipid 10a-54). Figure 30A The proton NMR spectrum of lipid 10a-54 is shown. Figure 30B The retention time of lipid 10a-54 as measured by LC-MS is shown. Figure 30C The mass spectrum of lipid 10a-54 is shown.
[0094] Figure 31 depicts the molecular characterization of 8-((3-(1H-imidazol-1-yl)propyl)(8-(nonoxy)-8-oxooctyl)amino)octanoic acid heptadecan-9-yl ester (lipid 10a-53). Figure 31A The proton NMR spectrum of lipid 10a-53 is shown. Figure 31BThe retention time of lipid 10a-53 as measured by LC-MS is shown. Figure 31C The mass spectrum of lipid 10a-53 is shown.
[0095] Figure 32A The total flux of spleen and liver harvested from CD-1 mice administered with circular RNA encoding firefly luciferase (FLuc) and formulated with ionizable lipids of interest, DSPC, cholesterol, and DSPE-PEG 2000 (Avanti Polar Lipids Inc.) in a weight ratio of 16:1:4:1 or 62:4:33:1 was depicted. Figure 32B The mean radiance depicts the biological distribution of protein expression.
[0096] Figure 33A Images depicting the luminescence of organs harvested from CD-1 mice administered with circular RNA formulated with ionizable lipids 22-S14, DSPC, cholesterol, and DSPE-PEG 2000 (Avanti Polar Lipids Inc.) in a weight ratio of 16:1:4:1 or 62:4:33:1. Figure 33B Whole-body IVIS images were depicted in CD-1 mice administered with circular RNA encoding FLuc and formulated with ionizable lipids 22-S14, DSPC, cholesterol, and DSPE-PEG 2000 (AvantiPolar Lipids Inc.) in a weight ratio of 16:1:4:1 or 62:4:33:1.
[0097] Figure 34A Images depicting the luminescence of organs harvested from CD-1 mice administered with circular RNA formulated with ionizable lipids 93-S14, DSPC, cholesterol, and DSPE-PEG 2000 (Avanti Polar Lipids Inc.) in a weight ratio of 16:1:4:1 or 62:4:33:1. Figure 34B Whole-body IVIS images were depicted in CD-1 mice administered with circular RNA encoding FLuc and formulated with ionizable lipids 93-S14, DSPC, cholesterol, and DSPE-PEG 2000 (AvantiPolar Lipids Inc.) in a weight ratio of 16:1:4:1 or 62:4:33:1.
[0098] Figure 35AImages depicting the luminescence of organs harvested from CD-1 mice administered with circular RNA formulated with ionizable lipid 10a-26, DSPC, cholesterol, and DSPE-PEG 2000 (Avanti Polar Lipids Inc.) in a weight ratio of 16:1:4:1 or 62:4:33:1. Figure 35B Whole-body IVIS images were depicted in CD-1 mice administered with circular RNA encoding FLuc and formulated with ionizable lipids 10a-26, DSPC, cholesterol, and DSPE-PEG 2000 (AvantiPolar Lipids Inc.) in a weight ratio of 16:1:4:1 or 62:4:33:1.
[0099] Figure 36 depicts a highlighted image of FLuc encoded and encapsulated in lipid 10b-15 ( Figure 36A ), lipid 10a-53 ( Figure 36B ) or lipid 10a-54 ( Figure 36C A luminescent image of organs harvested from c57BL / 6J mice after administration of circular RNA in lipid nanoparticles formed from the drug. PBS was used as a control. Figure 36D ).
[0100] Figure 37A and Figure 37B The relative luminescence in human PBMC lysates was depicted after incubation for 24 hours with test lipid nanoparticles containing circular RNA encoding firefly luciferase.
[0101] Figure 38 shows the GFP (GFP) content in human PBMCs after incubation with test lipid nanoparticles containing circular RNA encoding GFP or CD19 CAR. Figure 38A ) and CD19 CAR ( Figure 38B The expression of ).
[0102] Figure 39 The expression of anti-mouse CD19 CAR in 1C1C7 cells transfected with circular RNA lipids containing anti-mouse CD19 CAR expression sequences and different IRES sequences was depicted.
[0103] Figure 40 The cytotoxicity of anti-mouse CD19 CAR on mouse T cells was demonstrated. CD19 CAR is encoded by and expressed from circular RNA that is electroporated into mouse T cells.
[0104] Figure 41 depicts peripheral blood of C57BL / 6J mice injected every other day with test lipid nanoparticles encapsulated with circular RNA encoding anti-mouse CD19 CAR. Figure 41A and Figure 41B ) or spleen ( Figure 41C B cell count in ).
[0105] Figure 42A and Figure 42B The expression levels of anti-human CD19 CAR expressed from circular RNA and linear mRNA were compared.
[0106] Figure 43A and Figure 43B The cytotoxic effects of anti-human CD19 CAR expressed from circular RNA versus linear mRNA were compared.
[0107] Figure 44 The cytotoxicity of two CARs (anti-human CD19 CAR and anti-human BCMACAR) expressed from single circular RNAs in T cells was characterized.
[0108] Figure 45A Representative FACS plots of tdTomato expression frequencies in various splenic immune cell subsets after treatment with LNPs formed from lipids 10a-27, 10a-26, or 10b-15 are shown. Figure 45B The proportions of bone marrow cells, B cells, and T cells expressing tdTomato are shown as equivalent to the proportions of each cell population successfully transfected with Cre circular RNA (mean + standard deviation, n = 3). Figure 45C This indicates the proportions (mean + standard deviation, n = 3) of additional splenic immune cell populations (including NK cells, classical monocytes, non-classical monocytes, neutrophils, and dendritic cells) expressing tdTomato after treatment with lipids 27 and 26.
[0109] Figure 46A An exemplary RNA construct design with a built-in polyA sequence in an intron is described. Figure 46B The chromatographic trace of unpurified circular RNA is shown. Figure 46C The chromatographic traces of affinity-purified circular RNA are shown. Figure 46D Immunogenicity of circular RNA prepared using different in vitro transcription (IVT) conditions and purification methods is shown. (Commercial = commercial IVT mixture; Custom = custom IVT mixture; Aff = affinity purification; Enz = enzyme purification; GMP:GTP ratio = 8, 12.5, or 13.75).
[0110] Figure 47A An exemplary RNA construct design is described, which uses a dedicated binding sequence of TATAATTCTACCCTATTGAGGCATTGACTA (SEQ ID NO:3269) as a substitute for polyA for hybridization purification. Figure 47B The chromatographic trace of unpurified circular RNA is shown. Figure 46C The chromatographic traces of affinity-purified circular RNA are shown.
[0111] Figure 48A The chromatographic trace of unpurified circular RNA encoding dystrophin is shown. Figure 48B The chromatographic trace of the enzyme purifying circular RNA encoding dystrophin is shown.
[0112] Figure 49 compares the expression of purified circRNAs with different 5' spacers between the 3' intron / 5' internal double-stranded region and IRES in Jurkat cells. Figure 49A ) and stability ( Figure 49B (AC = using only A and C in the spacer sequence; UC = using only U and C in the spacer sequence.)
[0113] Figure 50 The luminescent expression levels and expression stability of circular RNAs containing the original or modified IRES elements shown are illustrated in primary T cells.
[0114] Figure 51 The luminescent expression levels and expression stability of circular RNAs containing the original or modified IRES elements shown are illustrated in HepG2 cells.
[0115] Figure 52 The luminescent expression levels and expression stability of circular RNAs containing the original or modified IRES elements shown are illustrated in 1C1C7 cells.
[0116] Figure 53 The luminescent expression levels and stability of circular RNAs containing IRES elements with inserted untranslated regions (UTRs) or hybrid IRES elements are shown in HepG2 cells. “Scr” indicates disordered expression and is used as a control.
[0117] Figure 54 The luminescent expression levels and expression stability of circular RNA containing an IRES operatively linked to a Gaussian luciferase coding sequence and a variable stop codon box are shown in 1C1C7 cells.
[0118] Figure 55 The luminescent expression levels and expression stability of circular RNA containing an IRES and a variable untranslated region (UTR) inserted before the start codon of the Gaussian luciferase coding sequence are shown in 1C1C7 cells.
[0119] Figure 56The expression levels of human erythropoietin (hEPO) in Huh7 cells are shown from circular RNAs containing two miR-122 target sites downstream of the hEPO coding sequence.
[0120] Figure 57 The expression of mOX40L in immune cells in wild-type mice after intravenous injection of LNPs transfected with circular RNA encoding mOX40L is shown.
[0121] Figure 58 shows the depletion of B cells in mice that were intravenously transfected with LNPs using circular RNA. Figure 58A The depletion of B cells by B220+ B cells from live CD45+ immune cells was quantified, and Figure 58B B cell exhaustion of live CD45+ immune cells B220+ B cells was compared with that of circular RNA expressing luciferase. Figure 58C It resulted in an increase in the weight of B cells from transfected cells.
[0122] Figure 59 shows the effect of peripheral blood (LNP) treatment with LNPs encapsulated with circular RNA expressing anti-CD19 CAR when treated. Figure 59A ) and spleen ( Figure 59B CAR expression levels in ) were compared. Anti-CD20 (aCD20) and circular RNA encoding luciferase (oLuc) were used for comparison.
[0123] Figure 60 shows the overall frequency of anti-CD19 CAR expression of IRES-specific circular RNA encoding anti-CD19 CAR on T cells, the frequency of anti-CD19 CAR expression on cell surface, and its effect on anti-tumor response. Figure 60A The geometric mean fluorescence intensity of anti-CD19 CAR was shown. Figure 60B The percentage of anti-CD19 CAR expression is shown, and Figure 60C The percentage of target cell lysis achieved via anti-CD19 CAR is shown. (CK = goat ridge virus; AP = mouse microRNA virus; CK* = codon-optimized goat ridge virus; PV = Parabovirus; SV = Salivirus.)
[0124] Figure 61 The CAR expression levels in A20 FLuc target cells were shown when treated with an IRES-specific circular RNA construct.
[0125] Figure 62 shows the cytoplasm of circular RNA from primary human T cells ( Figure 62A ) and surface ( Figure 62B The luminescent expression level of proteins.
[0126] Figure 63 shows the luminescent expression in human T cells when treated with the IRES-specific circular construct. Expression in the circular RNA construct is compared with that in linear mRNA. Figure 63A , Figure 63B and Figure 63G Gaussia luciferase expression was provided in multiple donor cells. Figure 63C , Figure 63D , Figure 63E and Figure 63F Firefly luciferase expression was provided from multiple donor cells.
[0127] Figure 64 illustrates the anti-CD19 CAR in human T cells after treatment with lipid nanoparticles containing circular RNA encoding anti-CD19 or anti-BCMA CAR. Figure 64A and Figure 64B ) and anti-BCMACAR ( Figure 63B )Express.
[0128] Figure 65 shows the expression level of anti-CD19 CAR generated by delivering circular RNA encoding anti-CD19 CAR in a specific antigen-dependent manner via in vitro electroporation. Figure 65A Nalm6 cells lysed with anti-CD19 CAR are shown. Figure 65B K562 cells lysed with anti-CD19CAR are shown.
[0129] Figure 66 illustrates LNP transfection mediated by ApoE3 in a solution containing LNP and circular RNA expressing green fluorescent protein (GFP). Figure 66A The survival-death results are shown. Figure 66B , Figure 66C , Figure 66D and Figure 66E The expression frequencies of multiple donors are provided.
[0130] Figure 67 Several controlled adjuvant strategies are provided. As shown in the figure, circRNA requires in vitro splicing of unpurified sense circular RNA using GTP as an indicator molecule. 3p-circRNA requires a mixture of purified sense circular RNA containing a 5' triphosphorylated end and purified antisense circular RNA. Figure 67 A shows in vitro IFN-β induction in wild-type and MAVS knockout A549 cells, and Figure 67 B shows the in vivo cytokine response to the formulated circRNA generated using the strategy shown.
[0131] Figure 68 illustrates intramuscular delivery of LNPs containing circular RNA constructs. Figure 68AIt provided in vivo whole-body flux after 6 hours and Figure 68B Systemic IVIS was provided 6 hours after a 1 μg dose of the LNP-circular RNA construct. Figure 68C The in vitro expression distribution over a 24-hour period was provided.
[0132] Figure 69 illustrates the expression of multiple circular RNAs from a single lipid formulation. Figure 69A hEPO titers of LNPs containing circular RNA constructs from single-group and mixed-group studies were provided, while Figure 69B The total throughput of bioluminescent expression of LNPs containing circular RNA constructs from single or mixed groups is provided.
[0133] Figure 70 A general sequence construct of a linear RNA polynucleotide precursor (10) is depicted. The provided sequence is shown in 5' to 3' order: 5' enhancing intron element (20), 5' enhancing exon element (30), core functional element (40), 3' enhancing exon element (50), and 3' enhancing intron element (60).
[0134] Figure 71 Various exemplary iterations of the 5' enhanced exon element (20) are depicted. As shown, one iteration of the 5' enhanced exon element (20) comprises, in order from 5' to 3', the following sequence: leading untranslated sequence (21), 5' affinity tag (22), 5' outer double-stranded region (24), 5' outer spacer region (26), and 3' intron segment (28).
[0135] Figure 72 Various exemplary iterations of the 5' enhanced exon element (30) are depicted. As shown, one iteration of the 5' enhanced exon element (30) includes, in the order of 5' to 3', the 3' exon segment (32), the 5' inner double-stranded region (34), and the 5' inner spacer region (36).
[0136] Figure 73 Various exemplary iterations of the core functional element (40) are depicted. As shown, one iteration of the core functional element (40) includes a TIE (42), a coding region (46), and a termination region (e.g., a stop codon or stop box) (48). Another iteration is illustrated to show the core functional element (47) containing a non-coding region (47).
[0137] Figure 74 Various exemplary iterations of the 3' enhanced exon element (50) are depicted. As shown, one iteration of the 3' enhanced exon element (50) comprises, in the following 5' to 3' order: 3' internal spacer region (52), 3' internal double-stranded region (54), and 5' exon segment (56).
[0138] Figure 75 Various exemplary iterations of the 3' enhanced intron element (60) are depicted. As shown, one iteration of the 3' enhanced intron element (60) includes, in the following order: 5' intron segment (62), 3' outer spacer region (64), 3' outer double-stranded region (66), 3' affinity tag (68), and terminal untranslated sequence (69).
[0139] Figure 76 Various exemplary iterations of the translation initiation element (TIE) (42) are depicted. In one iteration, the TIE (42) sequence is simply IRES (43). In another iteration, the TIE (42) is an aptamer (44). In two different iterations, the TIE (42) is a combination of aptamer (44) and IRES (43). In yet another iteration, the TIE (42) is an aptamer complex (45).
[0140] Figure 77 An exemplary linear RNA polynucleotide precursor (10) is described, comprising, in the following 5' to 3' order: a leading untranslated sequence (21), a 5' affinity tag (22), a 5' outer double-stranded region (24), a 5' outer spacer (26), a 3' intron segment (28), a 3' exon segment (32), a 5' inner double-stranded region (34), a 5' inner spacer region (36), a TIE (42), a coding element (46), a termination region (48), a 3' inner spacer region (52), a 3' inner double-stranded region (54), a 5' exon segment (56), a 5' intron segment (62), a 3' outer spacer region (64), a 3' outer double-stranded region (66), a 3' affinity tag (68), and a terminal untranslated sequence (69).
[0141] Figure 78 An exemplary linear RNA polynucleotide precursor (10) is described, comprising, in the following 5' to 3' order: a leading untranslated sequence (21), a 5' affinity tag (22), a 5' outer double-stranded region (24), a 5' outer spacer (26), a 3' intron segment (28), a 3' exon segment (32), a 5' inner double-stranded region (34), a 5' inner spacer region (36), a coding element (46), a termination region (48), a TIE (42), a 3' inner spacer region (52), a 3' inner double-stranded region (54), a 5' exon segment (56), a 5' intron segment (62), a 3' outer spacer region (64), a 3' outer double-stranded region (66), a 3' affinity tag (68), and a terminal untranslated sequence (69).
[0142] Figure 79An exemplary linear RNA polynucleotide precursor (10) is described, comprising, in the following 5' to 3' order: a leading untranslated sequence (21), a 5' affinity tag (22), a 5' outer double-stranded region (24), a 5' outer spacer (26), a 3' intron segment (28), a 3' exon segment (32), a 5' inner double-stranded region (34), a 5' inner spacer region (36), a non-coding element (47), a 3' inner spacer region (52), a 3' inner double-stranded region (54), a 5' exon segment (56), a 5' intron segment (62), a 3' outer spacer region (64), a 3' outer double-stranded region (66), a 3' affinity tag (68), and a terminal untranslated sequence (69).
[0143] Figure 80 The structure of a typical circular RNA (8) formed after splicing is described. The circular RNA depicted includes a 5' exon element (30), a core functional element (40), and a 3' exon element (50).
[0144] Figure 81 illustrates various ways in which auxiliary elements (70) (e.g., miRNA binding sites) can be included in linear RNA polynucleotides. Figure 81A Linear RNA polynucleotides containing auxiliary elements (70) in the spacer region are shown. Figure 81B A linear RNA polynucleotide containing an auxiliary element (70) located between each outer double-stranded region and exon segment is shown. Figure 81C Auxiliary elements (70) within the interval area are depicted. Figure 81D Various iterations of the auxiliary element (70) located within the core functional element are described. Figure 81E The auxiliary element (70) located within the internal ribosome entry site (IRES) is described.
[0145] Figure 82 illustrates the in vitro performance of LNPs formulated with circular RNA encoding firefly luciferase and possessing TIE in primary human cells at different doses. Figure 82A ), mice ( Figure 82B ) and crab-eating macaques ( Figure 82C Screening in hepatocytes.
[0146] Figures 83A to 83C This study demonstrates the screening of LNPs formulated with circular RNA encoding firefly luciferase and possessing TIE in vitro at different doses in primary human hepatocytes from three different donors.
[0147] Figure 84 This demonstrates the in vitro expression of LNPs formulated with circular RNA encoding GFP and possessing TIE in HeLa, HEK293, and HUH7 human cell models.
[0148] Figure 85This demonstrates the in vitro expression of LNPs formulated with circular RNA encoding GFO protein and possessing TIE in primary human hepatocytes.
[0149] Figure 86 illustrates the role of circular RNA encoding firefly luciferase and possessing a TIE in mouse myoblasts ( Figure 86A ) and primary human myoblasts ( Figure 86B In vitro expression in ).
[0150] Figure 87 illustrates the in vitro expression of a circular RNA encoding firefly luciferase and possessing a TIE in myoblasts and differentiated primary human skeletal muscle myotubes. Figure 87A Data related to cells received from human donor 1 were provided; Figure 87B Data related to cells received from human donor 2 were provided.
[0151] Figure 88 illustrates the cell-free in vitro translation of variable-sized circular RNA. Figure 88A In this study, the expression of circular RNA encoding firefly luciferase and linear mRNA encoding firefly luciferase was tested. Figure 88B In this study, human and mouse cells were administered circular RNA encoding the ATP7B protein. Some of the circular RNAs tested were codon-optimized. Circular RNAs expressing firefly luciferase were used for comparison.
[0152] Figure 89 illustrates an exemplary RNA circularization process. Figure 89A The schematic diagram illustrates the autocatalytic cyclization process. In short, a precursor RNA molecule containing intronic segments and auxiliary elements that enhance cyclization efficiency undergoes splicing to produce a synthetic circular RNA and two excised intronic / auxiliary sequence segments (spliced intronic segments / fragments). Some circular RNA (oRNA) is cleaved during synthesis. Figure 89B An exemplary chromatogram is shown, illustrating the peak retention of different types after size exclusion HPLC analysis.
[0153] Figure 90 An exemplary negative-selective purification method for circular RNA molecules such as oRNA is described. Oligonucleotides complementary to sequences (such as intronic segments or external helper regions) present in the precursor RNA but not in the oRNA are bound to a solid support such as beads. The oRNA preparation is washed onto the beads; the precursor RNA, partially spliced RNA, incomplete transcripts, and post-splicing intronic segments are bound to the oligonucleotides under certain buffering conditions, while the oRNA and nicked oRNA flow through. The effluent is collected for further processing.
[0154] Figure 91A and Figure 91B An exemplary negative selection purification method for circular RNA molecules such as oRNA is described. Figure 91A The schematic diagram illustrates the enzymatic polyadenylation of the in vitro transcription product containing oRNA and linear RNA, resulting in polyadenylation of only linear RNA. A mixture of linear and circular RNA is washed on beads conjugated with deoxythymidine oligonucleotides (“Oligo dT”) under specific buffer conditions. The polyadenylated linear RNA anneals to the beads, while the oRNA flows through for collection. Figure 91B An exemplary SEC-HPLC chromatogram is shown of the in vitro transcription (IVT) reaction product before polyadenylation and purification (left panel) and the eluent after polyadenylation using E. coli polyA polymerase and purification with oligo-dT beads in binding buffer.
[0155] Figure 92A and Figure 92B An exemplary enzymatic purification method for circular RNA is described. In this method, oRNA is synthesized by IVT in the presence of excess GMP and undergoes autocatalytic splicing during the process. The resulting reaction product is digested with Xrn1 (a 5' to 3' exonuclease requiring a 5' terminal monophosphate) and RNase R (a 3' to 5' exonuclease) to remove non-circular RNA molecules. Figure 92A This Xrn1 and RNaseR digestion of linear RNA is shown. Figure 92B An exemplary SEC-HPLC chromatogram is shown of the IVT reaction product before enzymatic digestion (left panel) and the material after final enzymatic purification (right panel).
[0156] Figure 93A and Figure 93B The induction of RIG-1 and IFNB1 RNA expression (markers of immune stimulation) after transfection of cells with the various RNA preparations shown is illustrated. All RNA preparations, except for commercially available 3phpRNA, were generated using in vitro transcription and circularization of RNA containing Anabaena substitution introns, GLuc reading frames, strong homologous arms, 5' and 3' spacers, and CVB3 IRES. RIG-1 and IFNB1 RNA expression was measured using RT-qPCR. In Figure 93, “IVT” indicates the unpurified reaction mixture; “+GMP” indicates the unpurified reaction mixture in which in vitro transcription was performed in the presence of GMP at 12.5 times the GTP; “+HPLC” indicates the reaction mixture purified by HPLC; “+HPLC / GMP” indicates the reaction mixture purified by HPLC in which in vitro transcription was performed in the presence of GMP at 12.5 times the GTP; “3phpRNA” indicates a positive control containing hairpin triphosphate RNA (tlrl-hprna, Invivogen); and “simulated” indicates a preparation without RNA. Figure 93AThe immune stimulation of HeLa cells was demonstrated, and Figure 93B The immune stimulation of A594 cells is shown.
[0157] Figure 94A and Figure 94B The expression levels of anti-CD19 CAR generated by in vitro delivery of various circular RNAs encoding chimeric antigen receptors via electroporation in human T cells are shown. Figure 94A Representative dot plots of FAC analysis from human T cell expression of CD19-41BBζ, CD19-CD28ζ, HER2-41BBζ, and HER2-CD28ζCAR are provided. Figure 94B Cumulative data on MFI expression of CD19-41BBζ, CD19-CD28ζ, HER2-41BBζ and HER2-CD28ζ collected via fluorescence activated cell sorting (FACS) were depicted.
[0158] Figures 95A to 95C This study demonstrates the cytotoxic response of tumor cells to electroporation of T cells using circular RNA encoding CD19-41BBζ and CD19-CD28ζ, followed by co-culturing with tumor cells. Figure 95A This study demonstrated specific lysis of tumor cells after co-culturing with T cells expressing oRNAs encoding CD19-41BBζ, CD19-CD28ζ, HER2-41BBζ, and HER2-CD28ζCARs, compared to T cells expressing circular RNA encoding mOX40L. Figure 95B and Figure 95C The levels of IFN-γ and IL-2 cytokines secreted by T cells expressing the listed oRNAs after co-culturing with tumor cells were described in pg / mL, compared to the levels of the circular RNA encoding mOX40L.
[0159] Figure 96A and Figure 96B The in vivo expression of mOX40L in spleen and peripheral blood T cells of humanized mice after intravenous administration of LNPs formulated with circular RNA encoding mOX40L is shown. LNPs were formulated with PBS (indicated as "mediator" in the figure) or with lipids 10b-15, 10a-27, or 10a-26. Figure 96A The detection of mOX40L in T cells of humanized mouse spleen was described. Figure 96B The detection of mOX40L in T cells in peripheral blood of humanized mice was described.
[0160] Figure 97This study illustrates impaired B cell regeneration in humanized mice following intravenous administration of LNPs formulated with circular RNA encoding an anti-CD19 chimeric antigen receptor (CAR). A representative FACS dot plot from peripheral blood of untreated animals (left) and treated animals (right) shows the percentage of B cells 6 days after intravenous administration.
[0161] Figure 98A and Figure 98B The killing percentage of Nalm6 tumor cells after co-culturing with LNP-oRNA encoding CAR or a control is shown. Figure 98A ) and chimeric antigen receptor (CAR) surface expression following in vitro transfection with LNP-circular RNA (oRNA) encoding CD19-41BBζ or CD19-CD28ζ CAR ( Figure 98B ). Figure 98A This demonstrates the killing effect of T cells on Nalm6 tumor cells after co-culturing with CARs encoding CD19-41BBζ and CD19-CD28ζ, as well as LNP-oRNA constructs of HER2-41BBz and HER2-CD28z, or control LNP-oRNA mOX40L. Figure 98B The mean fluorescence intensity (MFI) of CAR surface expression on T cells treated with the LNP-oRNACAR construct is provided.
[0162] Figure 99 Antigen-dependent tumor regression, measured by total flux (photons / second), was depicted in mice after administration of PBS, PBMC, LNP-oRNA encoding mOx40L, LNP-oRNA encoding CD19-41BBζ (“CD19-41BBζ is CAR”), LNP-oRNA encoding CD19-CD28ζ (“CD19-CD28ζ is CAR”), LNP-oRNA encoding HER2-41BBzCAR (“HER2-41BBz is CAR”), or LNP-oRNA encoding HER2-CD28z CAR (“HER2-CD28z is CAR”). PBS and PBMC solutions lacking oRNA served as negative controls.
[0163] Figure 100A , Figure 100B and Figure 100CThe correlation between IRES activity in myotubes and hepatocytes, or between myotubes and T cells, was depicted. Each data point indicates the mean expression value of circular RNAs containing IRES preceding the Gaussian luciferase coding region, where each IRES contains a sequence or fragment thereof selected from SEQ ID NO:1-2983 and 3282-3287. Circular RNAs containing IREs were synthesized in array form and formulated into LNPs, which were then transfected into activated primary human T cells, primary human myotubes, and primary human hepatocytes. All data points were normalized to the positive control IRES (SEQ ID NO:3282).
[0164] Figure 101A , Figure 101B and Figure 101C Depicting hepatocytes ( Figure 101A ), myotubes ( Figure 101B ) and T cells ( Figure 101C The data points represent the IRES activity relative to commonly used IRES (EMCV, CVB3). Each data point indicates the average expression value of a circular RNA containing an IRES preceding the Gaussian luciferase coding region, where each IRES contains a sequence or fragment thereof selected from SEQ ID NO:1-2983 and 3282-3287. Circular RNAs containing IRES were synthesized in array form and formulated into LNPs, which were then transfected into activated primary human T cells, primary human myotubes, and primary human hepatocytes. All data points were normalized to the positive control IRES (SEQ ID NO:3282).
[0165] Figure 102A and Figure 102B This is a scatter plot showing the relative expression of the circular RNA (oRNA) encoding the Gaussia luciferase (gLuc) gene in two of the three cell types of interest. Figure 102A The expression of gLuc-encoded oRNA, encapsulated in lipid nanoparticles (LNPs) and transfected into primary human hepatocytes (PHH), under transcriptional control of the internal ribosome entry site (IRES) sequences listed in Tables 5 and 6, was compared with gLuc expression in somatic electroporation T cells (EP TCLs) constructed with gLuc-encoded oRNA under transcriptional control of the same IRES sequences. A significant and strong correlation was observed between gLuc expression in PPH and EP TCLs. Figure 102BThe expression of gLuc-encoding oRNA encapsulated in lipid nanoparticles (LNPs) and transfected into primary human myotubes (MYOs) under transcriptional control of the IRES sequences listed in Tables 5 and 6 was compared with gLuc expression in EP TCLs containing gLuc-encoding oRNA constructs under transcriptional control of the same IRES sequences. A significant and strong correlation was observed between gLuc expression in MYOs and EP TCLs.
[0166] Figures 103A to 103C This is a scatter plot showing the relative expression of the oRNA encoding the firefly luciferase (FLuc) gene relative to the gLuc gene in one of the three cell types of interest (PHH, MYO, EP TCL). Figure 103A The expression of oRNAs encoding FLuc and gLuc, encapsulated in LNPs and transfected into primary human myotubes, was transcribed under the control of the IRES sequences listed in Table 7. Figure 103B The expression of oRNAs encoding FLuc and gLuc, encapsulated in LNPs and transfected into primary human hepatocytes, was transcribed under the control of the IRES sequences listed in Table 8. Figure 103C Expression of oRNAs encoding FLuc and gLuc under transcriptional control of the IRES sequences listed in Table 9, transfected into primary human T cells via electroporation. Strong correlations were observed between gLuc and FLuc expression within the same cell type across all three cell types.
[0167] Figure 104 The estimated number of clones per internal ribosome entry site (IRES) (“estimated number of clones per fragment”) is plotted against the number of sequences in each pool (“merged fragments”). Eleven pools were collected. The dashed lines in the graph represent the estimated linear relationship between the estimated number of clones per IRES for each sequence.
[0168] Figure 105 Chromatographic coverage diagrams of the in vitro transcription reaction (IVT) generated from the merged plasmid output screened by the IRES library and the standard single plasmid control determined by HPLC analysis are provided.
[0169] Figure 106 Chromatograms of circRNA generated via IVT before and after RNase R digestion are shown. Figure 106 A provides a control circRNA before RNase R digestion. Figure 106 B provides circular RNA from the IVT following RNase R digestion of the merged plasmid. Figure 106 C provides a control circRNA digested with RNase R. Figure 106D provides circular RNA from the IVT-fed output of the merged plasmid after RNase R digestion.
[0170] Figure 107 This study illustrates the absorbance spectra of the polyribosome species contained in a sucrose gradient collected from cells translating circular RNA with internal ribosome entry sites (IRES).
[0171] Figure 108 A graphical summary of the circRNAs encoded in the plasmid pool is provided, which are graded by multi-ribosome loading and determined by the sequencing read intensity of the RNA contained in the sucrose gradient of interest.
[0172] Figure 109 A graphical representation of the RNA encoded in the pool is provided, which is graded by the RNA half-life (in hours) calculated after filtering the minimum count at at least 3 time points.
[0173] Figure 110 A graphical representation of the RNA encoded in the pool is provided, graded according to the estimated circularization efficiency, which is calculated by comparing the counts in the exonuclease-treated library with the minimum count of the IVT library after filtering by library size normalization.
[0174] Figure 111 shows the immunoprecipitation results of circular RNA constructs encoding dystrophin and having V5 or plaque protein antibody tags. The circular RNA constructs were derived from IVT reactions of vectors with IRES of constructs 82-87 and 81. Each circular RNA construct was tested twice. Figure 111A Immunoprecipitation imaging of circular RNA is shown. Figure 111B The area under the curve (AUC) value is shown.
[0175] Figure 112 shows the immunoprecipitation results of circular RNA constructs encoding dystrophin and having V5 or plaque protein antibody tags. The circular RNA constructs were derived from IVT reactions of constructs 81, 85, and 88-90. Each circular RNA construct was tested twice. Figure 112A Immunoprecipitation imaging of circular RNA is shown. Figure 112B The area under the curve (AUC) value generated from the immunoprecipitation results is shown.
[0176] Figure 113 shows the immunoprecipitation results of circular RNA constructs encoding dystrophin and having V5 or speckle adhesion protein antibody tags. Circular RNA constructs were derived from IVT reactions of constructs 81-83, 85-87, and 91. Each circular RNA construct was tested twice. Figure 113A Immunoprecipitation imaging of circular RNA is shown. Figure 113BThe area under the curve (AUC) value generated from the immunoprecipitation results is shown.
[0177] Figure 114 shows the immunoprecipitation results of circular RNA constructs encoding dystrophin and having V5 or plaque protein antibody tags. The circular RNA constructs were derived from IVT reactions of constructs 81-83, 85-89, and 91. Figure 114A Immunoprecipitation imaging of circular RNA is shown. Figure 114B The area under the curve (AUC) value generated from the immunoprecipitation results is shown.
[0178] Figure 115 Immunoprecipitation images depicting the results of circular RNA encoding dystrophin injected in vivo into MDX mice. Results for the gastrocnemius muscle (“Gastroc”) are on the right side of the image, and results for the diaphragm (“Diaphragm”) are on the left side. The circular RNA also contains SEQ ID NO:3283, SEQ ID NO:3291, SEQ ID NO:24894, or SEQ ID NO:24895IRES.
[0179] Figure 116 provides information containing SEQ ID NO:3282 ( Figure 116A ) and SEQ ID NO:3291( Figure 116B Western blotting results of a circular RNA construct encoding dystrophin and IRES. Figure 116C The AUC results are provided for the percentage of dystrophin present.
[0180] Figure 117 shows the liver of mice after administration of circular RNA containing IRES (e.g., SEQ ID NO: 1284 or SEQ ID NO: 24896). Figure 117A ) or spleen ( Figure 117B Fluc expression and expression attenuation of circular RNA in )
[0181] Figure 118 The expression and attenuation of circular RNA following administration of circular RNA containing IRES (e.g., SEQ ID NO:1284, SEQ ID NO:3291, or SEQ ID NO:24896) are provided.
[0182] Figure 119 illustrates the administration of circular RNA encoding fluc, hEPO, or FIX and containing SEQ ID NO:3283, SEQ ID NO:3282, SEQ ID NO:1284, or SEQ ID NO:3291IRES to primary human hepatocytes. Figure 119A hEPO Figure 119B ) or FIX Figure 119C Protein expression. Detailed Implementation
[0183] This disclosure provides, in particular, methods and compositions for treating autoimmune diseases, deficiency diseases, or cancer based on circular RNA therapy. Specifically, this disclosure provides methods for treating autoimmune diseases, deficiency diseases, or cancer by administering a composition comprising circular RNA encoding at least one therapeutic protein to a subject requiring treatment at an effective dose and at an interval, thereby reducing or delaying the onset of at least one symptom or feature of the relevant disease or condition in terms of intensity, severity, or frequency.
[0184] As disclosed herein, improved circular RNA therapies and related compositions and methods allow for increased stability and expression of circular RNA in target cells (e.g., T cells). In some embodiments, circular RNA is transcribed from a linear RNA polynucleotide construct comprising an enhanced intron element, an enhanced exon element, and a core functional element. In some embodiments, the enhanced intron element comprises a post-splicing group I intron segment, a spacer region, a double-stranded sequence, an affinity sequence, and a unique untranslated sequence that allows for optimal circularization. In some embodiments, the enhanced exon element comprises an exon segment, a spacer region, and a double-stranded sequence to aid the circularization process and maintain the stability of the circular RNA after circularization. In the same embodiments, the core functional element comprises essential elements for protein translation using translation initiation elements (TIEs), coding or non-coding elements, and termination sequences (e.g., stop codons or stop boxes). Together, the enhanced intron element, the enhanced exon element, and the core functional element comprising the coding element provide optimal circular RNA polynucleotides for encoding therapeutic proteins. In one implementation, enhanced intron elements, enhanced exon elements, and core functional elements containing non-coding elements provide optimal circular RNA polynucleotides for triggering the immune system as adjuvants.
[0185] This document also discloses DNA templates (e.g., vectors) for preparing circular RNA. In some embodiments, the DNA template comprises a 3' enhanced intron region, a 3' enhanced exon region, a core functional element, a 5' enhanced exon region, and a 5' enhanced intron region. In some embodiments, these elements are positioned in the DNA template in the order described above.
[0186] Other embodiments include circular RNA polynucleotides, including circular RNA polynucleotides prepared using the DNA template provided herein (e.g., circular RNA containing a 3' enhancing exon element, a core functional element, and a 5' enhancing exon element), compositions containing such circular RNA, cells containing such circular RNA, and methods for using and preparing such DNA templates, circular RNA, compositions, and cells.
[0187] In some embodiments, this document provides methods for administering the circular RNA polynucleotides provided herein into cells for therapeutic purposes or to produce useful proteins. In some embodiments, this method is advantageous for producing desired peptides with longer half-lives than linear RNAs within eukaryotic cells due to the resistance of the circular RNA to ribonucleases.
[0188] Circular RNA polynucleotides lack the free ends necessary for exonuclease-mediated degradation, making them resistant to several mechanisms of RNA degradation and exhibiting a prolonged half-life compared to equivalent linear RNA. Circulation can stabilize RNA polynucleotides that typically have short half-lives and can enhance the overall efficacy of exogenous mRNA in a variety of applications. In one embodiment, the circular RNA polynucleotides provided herein, as assessed by protein synthesis, have a functional half-life of at least 20 hours (e.g., at least 80 hours) in eukaryotic cells (e.g., mammalian cells, such as human cells).
[0189] Various aspects of the present invention are described in detail in the following sections. The use of sections is not intended to limit the invention. Each section may be applied to any aspect of the invention. In this application, unless otherwise stated, the use of "or" means "and / or".
[0190] 1. Definition
[0191] Linear nucleic acid molecules are described as having a “5’-terminus” (or “5’ end”) and a “3’-terminus” (or “3’ end”) because the phosphodiester bond of a nucleic acid occurs at the 5’ and 3’ carbons of the sugar moiety of the substituent mononucleotide. The terminal nucleotide of a polynucleotide to which a new bond will be attached is its 5’-terminal nucleotide. The terminal nucleotide of a polynucleotide to which a new bond will be attached is its 3’-terminal nucleotide. As used herein, a “terminal nucleotide” is a nucleotide at the 3’- or 5’-terminal end.
[0192] As used herein, the term "3' group I intron segment" or "3' group I intron fragment" refers to a sequence having 75% or higher similarity to the 3' proximal end of a natural group I intron, including a splice site dinucleotide and optionally a segment of a natural exon sequence. In some embodiments, the circular RNA contains a post-splicing 3' group I intron fragment. In some embodiments, the post-splicing 3' group I intron fragment in the circular RNA is a post-splicing strand of an exon sequence. In some embodiments, the circular RNA also contains a desired expression sequence, and the post-splicing strand of the exon sequence (e.g., designed) is part of, adjacent to, and / or within the same reading frame as the desired expression sequence.
[0193] As used herein, the term "5' group I intron segment" or "5' group I intron fragment" refers to a sequence having 75% or higher similarity to the 5' proximal end of a natural group I intron, including a splice site dinucleotide and optionally a segment of a natural exon sequence. In some embodiments, the circular RNA contains a post-splicing 5' group I intron fragment. In some embodiments, the post-splicing 5' group I intron fragment in the circular RNA is a post-splicing strand of an exon sequence. In some embodiments, the circular RNA also contains a desired expression sequence, and the post-splicing strand of the exon sequence (e.g., designed) is part of, adjacent to, and / or within the same reading frame as the desired expression sequence.
[0194] As used herein, the term "replacement site" refers to the site in a group I intron where cleavage occurs prior to intron replacement. This cleavage produces 3' and 5' group I intron segments, which are replaced on either side of the precursor RNA to be circularized.
[0195] As used herein, the singular forms “a,” “an,” and “the” include plural referents unless the context explicitly indicates otherwise. Thus, for example, a reference to “a cell” includes a combination of two or more cells, or an entire culture of cells; a reference to “polynucleotide” actually includes many copies of that polynucleotide.
[0196] Unless otherwise specified or obvious from the context, as used herein, the term “about” should be understood as falling within the normal tolerance range in the field, such as within 2 standard deviations of the mean. “About” can be understood as within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1%, 0.09%, 0.08%, 0.07%, 0.06%, 0.05%, 0.04%, 0.03%, 0.02%, or 0.01% of the stated value. All numerical values provided herein are modified by the term “about” unless the context clearly indicates otherwise.
[0197] As used herein, an "affinity sequence" or "affinity tag" is a region of a polynucleotide sequence, ranging from one (1) nucleotide to hundreds or thousands of nucleotides, containing repeating groups of nucleotides used to aid in the purification of the polynucleotide sequence. For example, an affinity sequence may include, but is not limited to, polyA or polyAC sequences. In some embodiments, affinity tags are used in purification methods, referred to herein as "affinity purification," in which the selective binding of a binding agent to a molecule containing an affinity tag facilitates separation from molecules that do not contain an affinity tag. In some embodiments, affinity purification methods are "negative selection" purification methods in which unwanted substances, such as linear RNA, are selectively bound and removed, while desired substances, such as circular RNA, are eluted and separated from the unwanted substances.
[0198] The term "antibody" (Ab) includes, but is not limited to, glycoprotein immunoglobulins that specifically bind antigens. Generally, an antibody may comprise at least two heavy (H) chains and two light (L) chains linked together by disulfide bonds, or an antigen-binding molecule thereof. Each H chain may contain a heavy chain variable region (abbreviated as VH) and a heavy chain constant region. The heavy chain constant region may contain three constant domains CH1, CH2, and CH3. Each light chain may contain a light chain variable region (abbreviated as VL) and a light chain constant region. The light chain constant region may contain one constant domain CL. The VH and VL regions may be further subdivided into hypervariable regions called complementarity-determining regions (CDRs), interspersed with more conserved regions called framework regions (FRs). Each VH and VL may contain three CDRs and four FRs, arranged in the following order from the amino terminus to the carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4. The variable regions of the heavy and light chains contain binding domains that interact with the antigen. The constant region of Ab can mediate the binding of immunoglobulins to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component of the classical complement system. Antibodies may include, for example, monoclonal antibodies, recombinant antibodies, monospecific antibodies, multispecific antibodies (including bispecific antibodies), human antibodies, engineered antibodies, humanized antibodies, chimeric antibodies, immunoglobulins, synthetic antibodies, tetrameric antibodies comprising two heavy chain and two light chain molecules, antibody light chain monomers, antibody heavy chain monomers, antibody light chain dimers, antibody heavy chain dimers, antibody light chain-antibody heavy chain pairs, intracellular antibodies, antibody fusions (sometimes referred to herein as “antibody conjugates”), heteroconjugated antibodies, single-domain antibodies, monovalent antibodies, single-chain antibodies or single-chain variable fragments (scFv), camelified antibodies, affinity molecules, Fab fragments, F(ab')2 fragments, disulfide-linked variable fragments (sdFv), anti-idiotypic (anti-id) antibodies (including, for example, anti-anti-id antibodies), microantibodies, domain antibodies, synthetic antibodies (sometimes referred to herein as “antibody mimics”), and antigen-binding fragments of any of the above. In some embodiments, the antibodies described herein refer to a population of polyclonal antibodies.
[0199] Immunoglobulins can be derived from any of the commonly known isotypes, including but not limited to IgA, secretory IgA, IgG, and IgM. IgG subclasses are also well known to those skilled in the art and include, but are not limited to, human IgG1, IgG2, IgG3, and IgG4. "Isotype" refers to an Ab class or subclass (e.g., IgM or IgG1) encoded by a heavy chain constant region gene. The term "antibody" includes, for example, both naturally occurring and non-naturally occurring Abs; monoclonal and polyclonal Abs; chimeric and humanized Abs; human or non-human Abs; fully synthetic Abs; and single-chain Abs. Non-human Abs can be humanized by recombinant methods to reduce their immunogenicity in humans. Unless otherwise specified, and unless the context otherwise requires, the term "antibody" also includes an antigen-binding fragment or antigen-binding portion of any of the above-described immunoglobulins, and includes monovalent and bivalent fragments or portions, as well as single-chain Abs.
[0200] Many definitions of CDR are commonly used: Kabat number, Chothia number, AbM number, or contact number. The AbM definition is a compromise between the two used by the Oxford Molecular AbM antibody modeling software. The contact definition is based on the analysis of available complex crystal structures. The term "Kabat number" and similar terms are recognized in the art and refer to a system for numbering amino acid residues in the variable regions of the heavy and light chains of an antibody or its antigen-binding molecule. In some respects, the CDR of an antibody can be determined according to the Kabat numbering system (see, for example, Kabat EA & Wu TT (1971) Ann NYAcad Sci 190:382-391 and Kabat EA et al., (1991) Sequences of Proteins of Immunological Interest, 5th ed., Department of Health and Human Services, NIH Publication No. 91-3242). Using the Kabat numbering system, the CDRs within the antibody heavy chain molecule are typically located at amino acid positions 31 to 35, which may optionally include one or two additional amino acids, followed by 35 (referred to as 35A and 35B in the Kabat numbering scheme) (CDR1), amino acid positions 50 to 65 (CDR2), and amino acid positions 95 to 102 (CDR3). Using the Kabat numbering system, the CDRs within the antibody light chain molecule are typically located at amino acid positions 24 to 34 (CDR1), amino acid positions 50 to 56 (CDR2), and amino acid positions 89 to 97 (CDR3). In one specific embodiment, the CDRs of the antibody described herein have been determined according to the Kabat numbering scheme. In some respects, the CDR of an antibody can be determined according to the Chothia numbering scheme, which refers to the position of the immunoglobulin structural loop (see, for example, Chothia C & Lesk AM, (1987), J Mol Biol 196:901-917; Al-Lazikani B et al., (1997) J Mol Biol 273:927-948; Chothia C et al., (1992) J Mol Biol 227:799-817; Tramontano A et al., (1990) J Mol Biol 215(1):175-82; and U.S. Patent No. 7,709,226).Typically, when using the Kabat numbering convention, the Chothia CDR-H1 ring is located at positions 26 to 32, 33, or 34 of the heavy chain amino acids; the Chothia CDR-H2 ring is located at positions 52 to 56 of the heavy chain amino acids; and the Chothia CDR-H3 ring is located at positions 95 to 102 of the heavy chain amino acids. The Chothia CDR-L1 ring is located at positions 24 to 34 of the light chain amino acids; the Chothia CDR-L2 ring is located at positions 50 to 56 of the light chain amino acids; and the Chothia CDR-L3 ring is located at positions 89 to 97 of the light chain amino acids. When using the Kabat numbering convention, the end of the Chothia CDR-HI loop varies between H32 and H34, depending on the loop length (this is because the Kabat numbering scheme places the insertions at H35A and H35B; if neither 35A nor 35B exists, the loop ends at 32; if only 35a exists, the loop ends at 33; if both 35A and 35B exist, the loop ends at 34). In one specific embodiment, the CDR of the antibody described herein has been determined according to the Chothia numbering scheme.
[0201] As used herein, the terms “variable region” or “variable domain” are used interchangeably and are common in the art. A variable region typically refers to a portion of an antibody, usually a portion of the light or heavy chain, typically about 110 to 120 amino acids from the amino terminus of the mature heavy chain and about 90 to 115 amino acids from the mature light chain, which varies considerably in sequence between antibodies and is responsible for the binding and specificity of a particular antibody to its specific antigen. Sequence variability is concentrated in those regions called complementarity-determining regions (CDRs), while more highly conserved regions within a variable domain are called frame regions (FRs). Without wishing to be bound by any particular mechanism or theory, it is believed that the CDRs of both the light and heavy chains are primarily responsible for antibody-antigen interactions and specificity. In some embodiments, the variable region is a human variable region. In some embodiments, the variable region comprises a rodent or mouse CDR and a human frame region (FR). In a particular embodiment, the variable region is a primate (e.g., a non-human primate) variable region. In some implementations, the variable region comprises a rodent or mouse CDR and a primate (e.g., non-human primate) frame region (FR). The terms "VL" and "VL domain" are used interchangeably to refer to the light chain variable region of an antibody or its antigen-binding molecule. The terms "VH" and "VH domain" are used interchangeably to refer to the heavy chain variable region of an antibody or its antigen-binding molecule.
[0202] As used herein, the terms “constant region” and “constant domain” are interchangeable and have the meanings commonly found in the art. A constant region is an antibody portion, such as the carboxyl-terminal portion of the light and / or heavy chain, that does not directly participate in antibody-antigen binding but can exhibit various effector functions, such as interaction with Fc receptors. The constant regions of immunoglobulin molecules typically have a more conserved amino acid sequence than the variable domains of immunoglobulins.
[0203] As used herein, "aptamer" generally refers to a single oligonucleotide of a defined sequence or a mixture of said nucleotides, wherein the mixture retains the property of specifically binding to target molecules (e.g., eukaryotic initiation factors, 40S ribosomes, polyC-binding proteins, polyA-binding proteins, polypyrimidine bundle-binding proteins, the argonaute protein family, nuclear heterogeneous ribonucleoproteins K and Ia, and associated RNA-binding proteins). Therefore, as used herein, "aptamer" refers to singular and plural sequences of nucleotides, as defined above. The term "aptamer" means a single-stranded or double-stranded nucleic acid capable of binding to proteins or other molecules. Typically, aptamers preferably contain about 10 to about 100 nucleotides, preferably about 15 to about 40 nucleotides, more preferably about 20 to about 40 nucleotides, because oligonucleotides of length falling within these ranges are readily prepared using conventional techniques. Optionally, aptamers may also contain at least about 6 nucleotides, preferably 10, more preferably 14 or 15 nucleotides, necessary for achieving specific binding. As used herein, the phrase "aptamer complex" refers to a sequence comprising two or more aptamers operatively linked together. An aptamer complex may include two or more aptamer complexes whose sequences are adjacent to each other, or may have one or more intercalation nucleotides between each of the two or more aptamers.
[0204] As used herein, “autoimmunity” is defined as a persistent and progressive immune response to non-infectious autoantigens, distinct from infectious non-autoantigens from bacteria, viruses, fungi, or parasites that invade and persist within mammals and humans. Autoimmune conditions include scleroderma, Graves' disease, Crohn's disease, Sjögren's disease, multiple sclerosis, Hashimoto's disease, psoriasis, myasthenia gravis, autoimmune polyendocrine syndrome, type 1 diabetes mellitus (TIDM), autoimmune gastritis, autoimmune uveitis, polymyositis, colitis, and thyroiditis, as well as systemic autoimmune diseases such as lupus ulcerative colitis. As used herein, “autoantigen” or “autoantigen” refers to an antigen or epitope naturally occurring in mammals and immunogenic in said mammals.
[0205] "Cancer" refers to a wide variety of diseases characterized by the uncontrolled growth of abnormal cells in the body. Unregulated cell division and growth lead to the formation of malignant tumors that can invade adjacent tissues and can also metastasize to distant parts of the body via the lymphatic system or bloodstream. "Cancer" or "cancer tissue" can include tumors. Some cancers may respond to chemotherapy or radiation therapy, or cancers may be refractory. Refractory cancers are those that are not suitable for surgical intervention and that initially did not respond to chemotherapy or radiation therapy, or that became unresponsive over time.
[0206] As used herein, the terms “circRNA,” “circular polynucleotide,” “circular RNA,” “circulated RNA,” and “oRNA” are used interchangeably and refer to a single-stranded RNA polynucleotide in which the 3' and 5' ends, typically present in linear RNA polynucleotides, are (e.g., covalently) linked together. As used herein, such terms also include preparations containing circRNA. The meaning of these terms also encompasses precursor RNA polynucleotides capable of circulization to produce covalently closed circular RNA molecules. Such precursor RNA polynucleotides may include sequence elements that mediate or promote polynucleotide circulization, including group I intron regions (e.g., 3' and 5' group I intron regions), spacer sequences, internal double-stranded regions, polyA sequences, polyC sequences, polyAC sequences, polypyrimidine bundles, etc.
[0207] As used herein, the term "cyclization efficiency" refers to a measure of the rate at which the amount of cyclic polynucleotides formed is obtained compared to its linear starting material.
[0208] The expression sequence in a polynucleotide construct can be separated by a "cleavage site" sequence, which allows the polypeptide encoded by the expression sequence to be expressed by the cell alone once translated. A "self-cleaving peptide" is a peptide that is translated without a peptide bond between two adjacent amino acids, or a peptide whose function allows it to be immediately cleaved or separated into distinct and discrete first and second polypeptides when a polypeptide containing both protein and self-cleaving peptide is produced, without requiring any external cleavage activity.
[0209] As used herein, “coding element,” “coding sequence,” “coding nucleic acid,” or “coding region” is a region located within an expressed sequence that encodes one or more proteins or peptides (e.g., therapeutic proteins). As used herein, “non-coding element,” “non-coding sequence,” “non-coding nucleic acid,” or “non-coding nucleic acid” is a region located within an expressed sequence. This sequence itself does not encode a protein or peptide but may have other regulatory functions, including but not limited to allowing the entire polynucleotide to act as a biomarker or adjuvant for a specific cell.
[0210] As used herein, the term "DNA template" refers to a DNA sequence capable of transcribing linear RNA polynucleotides. For example, but not intended to be limiting, a DNA template may include a DNA vector, a PCR product, or a plasmid.
[0211] As used herein, the terms “double-stranded,” “double-stranded,” and “hybrid” are used interchangeably and refer to a double-stranded nucleic acid formed by the hybridization of two single-stranded nucleic acids containing complementary sequences. The sequences of the two single-stranded nucleic acids may be fully complementary or partially complementary. In some embodiments, the nucleic acids provided herein may be fully double-stranded or partially double-stranded. In most cases, genomic DNA is double-stranded.
[0212] As used herein, two “double-stranded sequences,” “double-stranded formation sequences,” “double-stranded regions,” “double-stranded formation areas,” “homologous arms,” or “homologous regions” are complementary, or are fully or partially complementary to each other when the two regions share a sufficient level of sequence identity with each other’s anti-complementary sequences to serve as substrates for hybridization. In some embodiments, the two double-stranded formation sequences are thermodynamically favorable for cross-pairing in sequence-specific interactions. As used herein, polynucleotide sequences are “homologous” when they are identical to or share sequence identity with their anti-complementary or “complementary” sequences. The percentage of sequence identity between a homologous region and its corresponding anti-complementary sequence can be any percentage of sequence identity that allows hybridization to occur. In some embodiments, the internal double-stranded formation regions of the polynucleotides disclosed herein are capable of forming double strands with another internal double-stranded formation region but not with external double-stranded formation regions.
[0213] As used herein, the term "encoding" broadly refers to any process in which information in a polymer macromolecule is used to guide the production of a second molecule that differs from the first molecule. The second molecule may have a chemical structure that differs from the chemical properties of the first molecule. For example, a DNA template (e.g., a DNA vector) may encode an RNA polynucleotide; a precursor RNA polynucleotide (e.g., a linear precursor RNA polynucleotide) may encode a mature RNA polynucleotide (e.g., a circular RNA polynucleotide).
[0214] As used herein, the term "expression sequence" refers to a nucleic acid sequence that encodes a product (e.g., a peptide or polypeptide, a regulatory nucleic acid, or a non-coding nucleic acid). An exemplary expression sequence encoding a peptide or polypeptide may comprise multiple nucleotide triplets, each triplet encoding one amino acid and referred to as a "codon".
[0215] As used herein, "internal ribosome entry site" or "IRES" refers to an RNA sequence or structural element ranging in size from 10 nt to 1000 nt or larger that can initiate polypeptide translation in the absence of a typical RNA cap structure. IRES are typically about 500 nt to about 700 nt in length. IRES may contain naturally occurring sequences and / or synthetic, non-natural sequences.
[0216] As used herein, a “leading untranslated sequence” is a polynucleotide sequence region of 1 to several hundred nucleotides located at the top 5' end of a polynucleotide sequence. The sequence can be specific or random. Leading untranslated sequences are non-coding. As used herein, a “terminal untranslated sequence” is a polynucleotide sequence region of 1 to several hundred nucleotides located at the bottom 3' end of a polynucleotide sequence. The sequence can be specific or random. Terminal untranslated sequences are non-coding.
[0217] As used in this article, a "miRNA site" refers to a segment of polynucleotides that can form a double helix with at least eight nucleotides of the natural miRNA sequence.
[0218] The term "nucleotide" refers to ribonucleotides, deoxyribonucleotides, their modified forms, or analogs. Nucleotides include the class of purines (e.g., adenine, hypoxanthine, guanine) and their derivatives and analogs, and pyrimidines (e.g., cytosine, uracil, thymine) and their derivatives and analogs. Nucleotide analogs include nucleotides with modifications in the chemical structure of their bases, sugars, and / or phosphate esters, including but not limited to 5'-pyrimidine modifications, 8'-purine modifications, modifications at the amine site outside the cytosine ring, and substitution of 5-bromouracil; and 2'-sugar modifications, including but not limited to sugar-modified ribonucleotides, wherein the 2'-OH is replaced by a group such as H, OR, R, halogen, SH, SR, NH2, NHR, NR2, or CN, wherein R is an alkyl moiety as defined herein. Nucleotide analogs are also intended to include nucleotides containing bases, such as inosine, piracetam, and xanthine; sugars, such as 2'-methylribose; and non-natural phosphodiester bonds, such as methylphosphonates, thiophosphates, and peptide bonds. Nucleotide analogs include 5-methoxyuridine, 1-methylpseuuridine, and 6-methyladenosine.
[0219] All nucleotide sequences disclosed herein may represent RNA sequences or their corresponding DNA sequences. It should be understood that deoxythymidine (dT or T) in DNA is transcribed into uridine (U) in RNA. Therefore, "T" and "U" are used interchangeably in the nucleotide sequences herein.
[0220] The terms “nucleic acid” and “polynucleotide” are used interchangeably herein to describe polymers (e.g., greater than about 2 bases, greater than about 10 bases, greater than about 100 bases, greater than about 500 bases, greater than 1000 bases, or up to about 10,000 bases or more) of any length (e.g., as described in U.S. Patent No. 5,948,902 and the references cited therein) that can hybridize with naturally occurring nucleic acids in a sequence-specific manner similar to that of two naturally occurring nucleic acids, for example, by participating in Watson-Crick base pairing interactions. An “oligonucleotide” is a polynucleotide containing fewer than 1000 nucleotides, such as a polynucleotide containing fewer than 500 nucleotides or fewer than 100 nucleotides. Naturally occurring nucleic acids are composed of nucleotides, including nucleotides containing guanine, cytosine, adenine, thymine, and uracil (G, C, A, T, and U, respectively). As used herein, “polyA” refers to a polynucleotide or part of a polynucleotide consisting of a nucleotide containing adenine. As used herein, “polyT” refers to a polynucleotide or part of a polynucleotide consisting of a nucleotide containing thymine. As used herein, “polyAC” refers to a polynucleotide or part of a polynucleotide consisting of a nucleotide containing adenine or cytosine.
[0221] As used herein, the term "ribosomal jumping element" refers to a nucleotide sequence that encodes a short peptide sequence capable of causing the translation of an RNA molecule into two peptide chains. While not wishing to be bound by theory, it is assumed that ribosomal jumping elements function by: (1) terminating the translation of the first peptide chain and restarting the translation of the second peptide chain; or (2) cleaving peptide bonds in the peptide sequence encoded by the ribosomal jumping element by the intrinsic protease activity of the peptide encoding the peptide or by another protease in the environment (e.g., the cytosol).
[0222] As used herein, the term “sequence identity” refers to the degree to which sequences are identical on a nucleotide-by-nucleotide or amino acid-by-amino acid basis within a comparison window. Therefore, the “sequence identity percentage” can be calculated as follows: Compare two best-aligned sequences within a comparison window, determine the number of positions in the two sequences where the same nucleic acid base (e.g., A, T, C, G, I) or the same amino acid residue (e.g., Ala, Pro, Ser, Thr, Gly, Val, Leu, Ile, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gln, Cys, and Met) occurs to generate a number of matching positions, divide the number of matching positions by the total number of positions in the comparison window (i.e., the window size), and multiply the result by 100 to obtain the sequence identity percentage. Includes nucleotides and polypeptides having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any of the reference sequences described herein, wherein the polypeptide variant typically retains at least one biological activity of the reference polypeptide.
[0223] As used herein, a "spacer region" refers to a region of a polynucleotide sequence that separates two other elements along the sequence, ranging from one nucleotide to hundreds or thousands of nucleotides. The sequence can be defined or random. Spacer regions are typically non-coding. In some embodiments, spacer regions include double-stranded regions.
[0224] As used in this article, the term "terminus box" refers to one or more stop codons present in two or more open reading boxes.
[0225] As used herein, the term "splicing site" refers to a dinucleotide that is partially or completely contained within a group I intron and in which the phosphodiester bond is cleaved during RNA cyclization.
[0226] As used herein, the term "therapeutic protein" refers to any protein that, when administered directly or indirectly to a subject in the form of translated nucleic acids, has therapeutic, diagnostic, and / or preventative effects and / or induces desired biological and / or pharmacological effects.
[0227] As used herein, the term "transfect" or "transfection" refers to the intracellular introduction of one or more encapsulating materials (e.g., nucleic acids and / or polynucleotides) into a cell, or preferably into a target cell. The term "transfection efficiency" refers to the relative amount of such encapsulating material (e.g., polynucleotide) taken up, introduced, and / or expressed by the transfected target cells. In some embodiments, transfection efficiency can be estimated by the amount of reporter polynucleotide product produced by the target cells after transfection. In some embodiments, the transfer medium has high transfection efficiency. In some embodiments, the transfer medium has a transfection efficiency of at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%.
[0228] As used herein, “transfer medium” includes any of the standard drug carriers, diluents, excipients, etc., which are generally intended for use in conjunction with the administration of a bioactive agent, including nucleic acids. In some embodiments of the invention, transfer mediums (e.g., lipid nanoparticles) are prepared to encapsulate one or more materials or therapeutic agents (e.g., circRNA). The process of incorporating a desired therapeutic agent (e.g., circRNA) into a transfer medium is referred to herein as “loading” or “encapsulation” (Lasic et al., FEBS Lett., 312:255-258, 1992). The material loaded or encapsulated in the transfer medium (e.g., circRNA) may be located wholly or partially within the internal space of the transfer medium, within the bilayer membrane of the transfer medium, or associated with the outer surface of the transfer medium.
[0229] As used herein, the terms “treatment” and “prevention”, and words derived therefrom, do not necessarily imply 100% or complete treatment or prevention. Rather, there are varying degrees of treatment or prevention that a person skilled in the art would consider to have potential benefit or therapeutic effect. Treatment or prevention provided by the methods disclosed herein may include treatment or prevention of one or more conditions or symptoms of a disease. Furthermore, for the purposes of this document, “prevention” may encompass delaying the onset of a disease or its symptoms or conditions. As used herein, the terms “upstream” and “downstream” refer to the relative positions of the genetic code (e.g., nucleotides, sequence elements) in a polynucleotide sequence. In some embodiments, in RNA polynucleotides, upstream faces the 5' end of the polynucleotide and downstream faces the 3' end. In some embodiments, in DNA polynucleotides, upstream faces the 5' end of the coding strand of the gene in question and downstream faces the 3' end. The meaning of the “upstream” and “downstream” sequences as used herein will be readily understood by a person skilled in the art.
[0230] A. lipid definition
[0231] As used herein, the phrase "biodegradable lipids" or "degradable lipids" refers to any of the many types of lipids that are broken down in the host environment on a scale of minutes, hours, or days, ideally making them less toxic and less likely to accumulate in the host over time. Common modifications to lipids include ester bonds and disulfide bonds to increase their biodegradability.
[0232] As used herein, the phrase "biodegradable PEG lipids" or "degradable PEG lipids" refers to any of many types of lipids in which PEG molecules are cleaved from the lipid in the host environment on a scale of minutes, hours, or days, ideally resulting in low immunogenicity. Common modifications to PEG lipids include ester bonds and disulfide bonds to increase the biodegradability of the lipids.
[0233] As used herein, the term “cationic lipid” or “ionizable lipid” refers to any of the many types of lipids that carry a net positive charge at a selected pH (such as physiological pH 4) and a neutral charge at other pH (such as physiological pH 7).
[0234] As used herein, the term “PEG” refers to any polyethylene glycol or other polyalkylene ether polymer.
[0235] As generally defined herein, “PEG-OH lipids” (also referred to herein as “hydroxy-PEGylated lipids”) are PEGylated lipids having one or more hydroxyl (-OH) groups on their lipids.
[0236] As used in this article, "phospholipid" is a lipid that includes a phosphate ester portion and one or more carbon chains (such as unsaturated fatty acid chains).
[0237] As used herein, the term “structural lipid” refers to sterols, and also to lipids containing sterol moieties. As defined herein, “sterol” is a subgroup of steroid alcohols.
[0238] The terms “head group” and “tail group” when used herein to describe compounds of the present invention (e.g., lipids), and particularly functional groups contained in such compounds, are used for ease of reference to describe the orientation of such compounds or the orientation of one or more functional groups relative to other functional groups. For example, in some embodiments, a hydrophilic head group (e.g., guanidinyl) is bound to a cleavable functional group (e.g., a disulfide group) (e.g., via one or more of hydrogen bonds, van der Waals forces, ionic interactions, and covalent bonds), which in turn is bound to a hydrophobic tail group (e.g., cholesterol). In some embodiments, the compounds disclosed herein comprise, for example, at least one hydrophilic head group and at least one hydrophobic tail group, each bound to at least one cleavable group, thereby making such compounds amphiphilic.
[0239] As used herein, the term "amphiphilic" means the ability to dissolve in both polar (e.g., water) and nonpolar (e.g., lipid) environments. For example, in some embodiments, the compounds disclosed herein (e.g., lipids) comprise at least one lipophilic tail group (e.g., cholesterol or C6-). 20 An alkyl group and at least one hydrophilic head group (e.g., imidazole) are each combined with a cleavable group (e.g., disulfide).
[0240] As used herein, the term "hydrophilic" is used in a qualitative sense to indicate that a functional group is water-preferred, and that such groups are generally water-soluble. For example, this document discloses compounds (e.g., ionizable lipids) comprising a cleavable group (e.g., a disulfide (SS) group) in combination with one or more hydrophilic groups (e.g., hydrophilic head groups), wherein such hydrophilic groups comprise or are selected from the group consisting of imidazoles, guanidines, amino groups, imines, enamines, optionally substituted alkylamino groups (e.g., alkylamino groups such as dimethylamino), and pyridyl groups.
[0241] As used herein, the term "hydrophobic" is used qualitatively to indicate that a functional group is water-repellent, and typically such groups are not water-soluble. In some embodiments, at least one functional group comprising a portion of a compound disclosed herein is inherently hydrophobic (e.g., comprising a hydrophobic tail group of a naturally occurring lipid such as cholesterol). For example, this document discloses compounds comprising a cleavable functional group (e.g., a disulfide (SS) group) in combination with one or more hydrophobic groups (e.g., ionizable lipids), wherein such hydrophobic groups may comprise or be selected from one or more naturally occurring lipids such as cholesterol, optionally substituted variable-saturated or unsaturated C6-C... 20 Alkyl and / or optionally substituted C6-C saturated or unsaturated 20 Acyl group.
[0242] As used herein, the term "liposome" generally refers to a vesicle composed of lipids (e.g., amphiphilic lipids) arranged in one or more spherical bilayers. Such liposomes can be monolayered or multilayered vesicles having a membrane formed of lipophilic material and an aqueous interior containing encapsulated circRNA to be delivered to one or more target cells, tissues, and organs.
[0243] As used herein, the phrase “lipid nanoparticles” refers to a transfer medium comprising one or more cationic or ionizable lipids, stabilized lipids, structural lipids, and auxiliary lipids.
[0244] In some embodiments, the compositions described herein comprise one or more liposomes or lipid nanoparticles. Examples of suitable lipids (e.g., ionizable lipids) that can be used to form the liposomes and lipid nanoparticles of consideration include one or more of the compounds disclosed herein.
[0245] In some embodiments, the lipids disclosed herein (e.g., ionizable lipids) comprise one or more cleavable groups. The terms “cleavable” and “cleavable” are used herein to mean that one or more chemical bonds (e.g., one or more of covalent, hydrogen, van der Waals, and / or ionic interactions) in or between atoms adjacent to the subject functional group are cleaved (e.g., hydrolyzed) or capable of cleaving upon exposure to selected conditions (e.g., enzymatic conditions). In some embodiments, the cleavable group is a disulfide functional group, and in a specific embodiment, it is a disulfide group capable of being cleaved upon exposure to selected biological conditions (e.g., intracellular conditions). In some embodiments, the cleavable group is an ester functional group capable of being cleaved upon exposure to selected biological conditions. For example, the disulfide group may be enzymatically cleaved or cleaved by hydrolysis, oxidation, or reduction. Upon cleavage of such a disulfide functional group, one or more functional moieties or groups (e.g., one or more of head and / or tail groups) bound thereto may be released. Exemplary cleavable groups may include, but are not limited to, disulfide groups, ester groups, ether groups, and any derivatives thereof (e.g., alkyl and aryl esters). In some embodiments, the cleavable group is not an ester group or an ether group. In some embodiments, the cleavable group is bonded to one or more functional moieties or groups (e.g., at least one head group and at least one tail group) (e.g., via one or more of hydrogen bonds, van der Waals forces, ionic interactions, and covalent bonds). In some embodiments, at least one of the functional moieties or groups is hydrophilic (e.g., a hydrophilic head group comprising one or more of imidazole, guanidine, amino, imine, enamine, optionally substituted alkylamino, and pyridyl groups).
[0246] B. Chemical Definition
[0247] When describing the invention, it may include compounds and pharmaceutically acceptable salts thereof, pharmaceutical compositions containing such compounds, and methods of using such compounds and compositions. Unless otherwise stated, the following terms (if present) shall have the following meanings. It should also be understood that, as described herein, any portion defined below may be substituted with various substituents, and the corresponding definitions are intended to include such substituted portions within the scope listed below. Unless otherwise stated, the term “substituted” is defined as listed below. It should be further understood that the terms “group” and “free radical” are considered interchangeable when used herein.
[0248] The compounds described herein may also contain one or more isotopic substitutions. For example, H can be in any isotopic form, including 1 H, 2 H (D or deuterium) and 3 H (T or tritium); C can be any isotopic form, including 12 C 13 C and 14 C and O can be in any isotopic form, including 16 O and 18 O; F can be any isotopic form, including 18 F and 19 F, etc.
[0249] When listing a range of values, the aim is to cover every value within that range and its subranges. For example, "C 1-6 "Alkyl" is intended to encompass C1, C2, C3, C4, C5, C6, C 1-6 C 1-5 C 1-4 C 1-3 C 1-2 C 2-6 C 2-5 C 2-4 C 2-3 C 3-6 C 3-5 C 3-4 C 4-6 C 4-5 and C 5-6 alkyl.
[0250] As used herein, the term "alkyl" refers to both straight-chain and branched C-chain structures. 1-40 Hydrocarbons (e.g., C) 6-20Hydrocarbons) both, including saturated and unsaturated hydrocarbons. In some embodiments, the alkyl group may comprise one or more cyclic alkyl groups and / or one or more heteroatoms such as oxygen, nitrogen, or sulfur, and may optionally be substituted with substituents (e.g., one or more of alkyl, halogen, alkoxy, hydroxyl, amino, aryl, ether, ester, or amide). In some embodiments, the alkyl group considered includes (9Z,12Z)-octadec-9,12-diene. Names such as "C 6-20 The use of "" is intended to refer to an alkyl group (e.g., straight-chain or branched and including alkenes and alkyl groups) having the range of carbon atoms described. In some embodiments, the alkyl group has 1 to 10 carbon atoms ("C"). 1-10 Alkyl group (“C”). In some embodiments, the alkyl group has 1 to 9 carbon atoms (“C”). 1-9 Alkyl group (“alkyl”). In some embodiments, the alkyl group has 1 to 8 carbon atoms (“C”). 1-8 Alkyl group (“alkyl”). In some embodiments, the alkyl group has 1 to 7 carbon atoms (“C”). 1-7 Alkyl group (“alkyl”). In some embodiments, the alkyl group has 1 to 6 carbon atoms (“C”). 1-6 Alkyl group (“alkyl”). In some embodiments, the alkyl group has 1 to 5 carbon atoms (“C”). 1-5 Alkyl group (“alkyl”). In some embodiments, the alkyl group has 1 to 4 carbon atoms (“C”). 1-4 Alkyl group (“alkyl”). In some embodiments, the alkyl group has 1 to 3 carbon atoms (“C”). 1-3 Alkyl group (“alkyl”). In some embodiments, the alkyl group has 1 to 2 carbon atoms (“C”). 1-2 Alkyl group (“C1 alkyl”). In some embodiments, the alkyl group has one carbon atom (“C1 alkyl”). 1-6 Examples of alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, pentyl, hexyl, etc.
[0251] As used herein, “alkenyl” refers to a straight-chain or branched hydrocarbon group having 2 to 20 carbon atoms, one or more carbon-carbon double bonds (e.g., 1, 2, 3, or 4 carbon-carbon double bonds) and optionally one or more carbon-carbon triple bonds (e.g., 1, 2, 3, or 4 carbon-carbon triple bonds). 2-20 Alkenyl group (“Alkenyl”). In some embodiments, the alkenyl group does not contain any triple bonds. In some embodiments, the alkenyl group has 2 to 10 carbon atoms (“C”). 2-10 Alkenyl group (“Alkenyl”). In some embodiments, the alkenyl group has 2 to 9 carbon atoms (“C”). 2-9 Alkenyl group (“Alkenyl”). In some embodiments, the alkenyl group has 2 to 8 carbon atoms (“C”). 2-8 Alkenyl group (“Alkenyl”). In some embodiments, the alkenyl group has 2 to 7 carbon atoms (“C”). 2-7Alkenyl group (“Alkenyl”). In some embodiments, the alkenyl group has 2 to 6 carbon atoms (“C”). 2-6 Alkenyl group (“Alkenyl”). In some embodiments, the alkenyl group has 2 to 5 carbon atoms (“C”). 2-5 Alkenyl group (“Alkenyl”). In some embodiments, the alkenyl group has 2 to 4 carbon atoms (“C”). 2-4 Alkenyl group (“Alkenyl”). In some embodiments, the alkenyl group has 2 to 3 carbon atoms (“C”). 2-3 The alkenyl group has two carbon atoms (“C2 alkenyl”). The one or more carbon-carbon double bonds can be internal (such as in 2-butenyl) or terminal (such as in 1-butenyl). 2-4 Examples of alkenyl groups include vinyl (C2), 1-propenyl (C3), 2-propenyl (C3), 1-butenyl (C4), 2-butenyl (C4), butadienyl (C4), etc. 2-6 Examples of alkenyl groups include the aforementioned C 2-4 Alkenyl groups include pentenyl (C5), pentadienyl (C5), and hexenyl (C6). Other examples of alkenyl groups include heptenyl (C7), octenyl (C8), and octtrienyl (C8).
[0252] As used herein, “alkynyl” refers to a straight-chain or branched hydrocarbon group having 2 to 20 carbon atoms, one or more carbon-carbon triple bonds (e.g., 1, 2, 3, or 4 carbon-carbon triple bonds) and optionally one or more carbon-carbon double bonds (e.g., 1, 2, 3, or 4 carbon-carbon double bonds). 2-20 The alkynyl group (“Alynyl”) is present in some embodiments. In some embodiments, the alkynyl group has 2 to 10 carbon atoms (“C”). 2-10 The alkynyl group (“C”) is present in some embodiments. In some embodiments, the alkynyl group has 2 to 9 carbon atoms (“C”). 2-9 The alkynyl group (“C”) is present in some embodiments. In some embodiments, the alkynyl group has 2 to 8 carbon atoms (“C”). 2-8 The alkynyl group (“C”) is present in some embodiments. In some embodiments, the alkynyl group has 2 to 7 carbon atoms (“C”). 2-7 The alkynyl group (“C”) has 2 to 6 carbon atoms in some embodiments. 2-6 The alkynyl group (“C”) is present in some embodiments. In some embodiments, the alkynyl group has 2 to 5 carbon atoms (“C”). 2-5 The alkynyl group (“C”) is present in some embodiments. In some embodiments, the alkynyl group has 2 to 4 carbon atoms (“C”). 2-4 The alkynyl group (“C”) is present in some embodiments. In some embodiments, the alkynyl group has 2 to 3 carbon atoms (“C”). 2-3The alkynyl group has two carbon atoms (“C2 alkynyl”). This one or more carbon-carbon triple bonds can be internal (such as in 2-butynyl) or terminal (such as in 1-butynyl). 2-4 Examples of alkynyl groups include, but are not limited to, ethynyl (C2), 1-propynyl (C3), 2-propynyl (C3), 1-butynyl (C4), and 2-butynyl (C4). 2-6 Examples of alkenyl groups include the aforementioned C 2-4 Alkyne groups include pentynyl (C5), hexynyl (C6), etc. Other examples of alkynyl groups include heptynyl (C7), octynyl (C8), etc.
[0253] As used herein, “alkylene,” “alkenylene,” and “ynynylene” refer to the divalent groups of alkyl, alkenyl, and ynyl groups, respectively. When a range or number of carbons is provided for a particular “alkylene,” “alkenylene,” or “ynynylene” group, it should be understood that the range or number refers to the range or number of carbons in a straight-chain divalent carbon chain. “alkylene,” “alkenylene,” and “ynynylene” groups may be substituted with one or more substituents as described herein or may not be substituted.
[0254] As used herein, the term "alkoxy" refers to an alkyl group (-O(alkyl)) attached to another part via an oxygen atom. Non-limiting examples include, for example, methoxy, ethoxy, propoxy, and butoxy.
[0255] As used herein, the term "aryl" refers to an aromatic group (e.g., monocyclic, bicyclic, and tricyclic structures) containing six to ten carbon atoms in the ring moiety. The aryl group may optionally be substituted by available carbon atoms and, in some embodiments, may include one or more heteroatoms, such as oxygen, nitrogen, or sulfur. In some embodiments, the aryl group has six ring carbon atoms ("C6 aryl"; e.g., phenyl). In some embodiments, the aryl group has ten ring carbon atoms ("C6 aryl"). 10 "Aryl"; for example, naphthyl, such as 1-naphthyl and 2-naphthyl).
[0256] The term "cycloalkyl" refers to a monovalent saturated cyclic, bicyclic, or bridged ring (e.g., adamantyl) hydrocarbon group with 3-12, 3-8, 4-8, or 4-6 carbons, referred to herein as, for example, a "C" group derived from cycloalkanes. 4-8 "Cycloalkyl". Exemplary cycloalkyl groups include, but are not limited to, cyclohexane, cyclopentane, cyclobutane, and cyclopropane.
[0257] As used in this article, "cyano" refers to -CN.
[0258] As used herein, “heteroaryl” refers to a group of a 5-10 membered monocyclic or bicyclic 4n+2 aromatic ring system (e.g., having 6 or 10 electrons shared in the ring array), having a ring carbon atom and 1-4 ring heteroatoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5-10 membered heteroaryl”). In heteroaryl groups containing one or more nitrogen atoms, the attachment site can be a carbon or nitrogen atom, where the valence allows. Heteroaryl bicyclic systems may contain one or more heteroatoms in one or both rings. “Heteroaryl” includes ring systems in which a heteroaryl ring as defined above is fused with one or more carbocyclic or heterocyclic groups (where the attachment site is on the heteroaryl ring), and in such cases, the number of ring members continues to specify the number of ring members in the heteroaryl ring system. "Heteroaryl" also includes ring systems in which a heteroaryl ring as defined above is fused with one or more aryl groups (where the attachment site is on the aryl or heteroaryl ring), and in such cases, the number of ring members specifies the number of ring members in the fused (aryl / heteroaryl) ring system. A bicyclic heteroaryl group, where one ring does not contain a heteroatom (e.g., indolyl, quinolinyl, carbazolyl, etc.), may have the attachment site on either ring, i.e., a ring with a heteroatom (e.g., 2-indolyl) or a ring without a heteroatom (e.g., 5-indolyl).
[0259] As used herein, "heterocyclic group" or "heterocycle" refers to a group comprising a 3- to 10-membered nonaromatic ring system having a ring carbon atom and 1 to 4 ring heteroatoms, wherein each heteroatom is independently selected from nitrogen, oxygen, sulfur, boron, phosphorus, and silicon ("3- to 10-membered heterocyclic groups"). In heterocyclic groups containing one or more nitrogen atoms, the attachment point may be a carbon or nitrogen atom, where the valence allows. Heterocyclic groups may be monocyclic ("monocyclic heterocyclic group") or fused, bridged, or spirocyclic systems, such as bicyclic systems ("bicyclic heterocyclic group"), and may be saturated or partially unsaturated. Heterocyclic bicyclic systems may contain one or more heteroatoms in one or both rings. "Heterocyclic group" also includes ring systems in which the heterocyclic ring as defined above is fused with one or more carbocyclic groups (where the attachment point is on the carbocyclic or heterocyclic ring), or ring systems in which the heterocyclic ring as defined above is fused with one or more aryl or heteroaryl groups (where the attachment point is on the heterocyclic ring), and in such cases, the number of ring members continues to specify the number of ring members in the heterocyclic ring system. The terms "heterocycle," "heterocyclic group," "heterocyclic ring," "heterocyclic moiety," and "heterocyclic radical" are used interchangeably.
[0260] As used herein, the terms "halogen" and "halogen" refer to an atom selected from fluorine (F), chlorine (Cl), bromine (Br), and iodine (I). In some embodiments, the halogen group is fluorine or chlorine.
[0261] As used in this article, "oxo" refers to -C=O.
[0262] Generally speaking, the term "substituted," whether or not preceded by the term "optionally," refers to the substitution of at least one hydrogen atom on a group (e.g., a carbon or nitrogen atom) with a permitted substituent (e.g., a substituent that, upon substitution, produces a stable compound (e.g., a compound that does not spontaneously undergo transformations such as rearrangement, cyclization, elimination, or other reactions). Unless otherwise stated, a "substituted" group has substituents at one or more substituted positions of the group, and when more than one position in any given structure is substituted, the substituents may be the same or different at each position.
[0263] As used herein, a “pharmaceutically acceptable salt” means that which, within reasonable medical judgment, is suitable for contact with tissues of humans and lower animals without excessive toxicity, irritation, anaphylactic response, etc., and is proportionate to a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, Berge et al. describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences (1977) 66:1–19. Pharmaceutically acceptable salts of the compounds of the present invention include those derived from suitable inorganic and organic acids and bases. Examples of pharmaceutically acceptable non-toxic acid addition salts are salts formed by reacting an amino group with an inorganic acid (such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid) or with an organic acid (such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid) or by using other methods used in the art (such as ion exchange). Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, hydrogen sulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucono-heptahydrate, glycerophosphate, gluconate, hemisulfate, heptahydrate, hexanoate, hydroiodate, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, dihydroxynaphthalate, pectate, persulfate, 3-phenylpropionate, phosphate, picrate, neopentanoate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate, etc. Pharmaceutically acceptable salts derived from suitable bases include alkali metal, alkaline earth metal, ammonium, and N+(C1-4 alkyl)4 salts. Representative alkali metal or alkaline earth metal salts include sodium, lithium, potassium, calcium, and magnesium. Where appropriate, other pharmaceutically acceptable salts include non-toxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxyl, sulfate, phosphate, nitrate, lower alkyl sulfonate, and aryl sulfonate ions.
[0264] In typical embodiments, the present invention is intended to cover the compounds disclosed herein, as well as pharmaceutically acceptable salts, pharmaceutically acceptable esters, tautomers, polymorphs, and prodrugs of such compounds. In some embodiments, the present invention includes pharmaceutically acceptable addition salts, pharmaceutically acceptable esters, solvates (e.g., hydrates) of addition salts, tautomers, polymorphs, enantiomers, mixtures of enantiomers, stereoisomers, or mixtures of stereoisomers (pure or as racemic or non-racemic mixtures).
[0265] The compounds described herein may contain one or more asymmetric centers and therefore may exist in a variety of isomeric forms, such as enantiomers and / or diastereomers. For example, the compounds described herein may be in the form of individual enantiomers, diastereomers, or geometric isomers, or may be in the form of mixtures of stereoisomers, including racemic mixtures and mixtures rich in one or more stereoisomers. Isomers may be separated from the mixture by methods known to those skilled in the art, including chiral high-performance liquid chromatography (HPLC) and the formation and crystallization of chiral salts; or preferred isomers may be prepared by asymmetric synthesis. See, for example, Jacques et al., Enantiomers, Racemates and Resolutions (Wiley Interscience, New York, 1981); Wilen et al., Tetrahedron 33:2725 (1977); Eliel, Stereochemistry of Carbon Compounds (McGraw–Hill, NY, 1962); and Wilen, Tables of Resolving Agents and Optical Resolutions, p. 268 (edited by Eliel, Univ. of Notre Dame Press, Notre Dame, 1972). This invention further covers the compounds described herein as single isomers substantially free of other isomers, and alternatively as mixtures of various isomers.
[0266] In some embodiments, compounds (e.g., ionizable lipids) and transfer media comprising such compounds (e.g., lipid nanoparticles) exhibit enhanced (e.g., increased) transfection capabilities of one or more target cells. Therefore, methods for transfecting one or more target cells are also provided herein. Such methods typically involve contacting one or more target cells with the compounds and / or pharmaceutical compositions disclosed herein, such that the one or more target cells are transfected with circular RNA encapsulated therein.
[0267] It should be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not restrictive. Unless specifically stated or obvious from the context, the term "or" as used herein should be understood as inclusive. Unless defined herein and in the remainder of the following specification, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0268] 2. DNA template, precursor RNA, and circular RNA
[0269] According to the present invention, transcription of the DNA template provided herein (e.g., comprising a 3' enhancing intron element, a 3' enhancing exon element, a core functional element, a 5' enhancing exon element, and a 5' enhancing intron element) results in the formation of a circularizable precursor linear RNA polynucleotide. In some embodiments, the DNA template comprises a vector, a PCR product, a plasmid, microcircular DNA, a clomid, an artificial chromosome, complementary DNA (cDNA), extrachromosomal DNA (ecDNA), or fragments thereof. In some embodiments, the microcircular DNA may be linearized or non-linearized. In some embodiments, the plasmid may be linearized or non-linearized. In some embodiments, the DNA template may be single-stranded. In other embodiments, the DNA template may be double-stranded. In some embodiments, the DNA template comprises wholly or partially a viral, bacterial, or eukaryotic vector.
[0270] As provided herein, the present invention includes a DNA template that shares the same sequence (e.g., 3' enhancing intron elements, 3' enhancing exon elements, core functional elements, and 5' enhancing exon elements and 5' enhancing intron elements) with the precursor linear RNA polynucleotide prior to splicing. In some embodiments, the linear precursor RNA polynucleotide undergoes splicing, resulting in the removal of the 3' enhancing intron elements and 5' enhancing intron elements during the circularization process. In some embodiments, the resulting circular RNA polynucleotide lacks the 3' enhancing intron segments and 5' enhancing intron segments, but retains the 3' enhancing exon segments, core functional elements, and 5' enhancing exon elements.
[0271] In some embodiments, the precursor linear RNA polynucleotide is in one or more guanosine nucleotides or nucleosides (e.g., GTP) and divalent cations (e.g., Mg). 2+ Circularization occurs during incubation in the presence of [a specific element]. In some embodiments, 3' enhancing exon elements, 5' enhancing exon elements, and / or core functional elements fully or partially promote the circularization of precursor linear RNA polynucleotides to form the circular RNA polynucleotides provided herein.
[0272] In some embodiments, the circular RNA provided herein is generated intracellularly. In some embodiments, the precursor RNA is transcribed in the cytoplasm by phage RNA polymerase using a DNA template (e.g., in some embodiments, using the vector provided herein), or in the cell nucleus by host RNA polymerase II, and then circularized.
[0273] In some embodiments, the circular RNA provided herein is injected into an animal (e.g., a human) such that the polypeptide encoded by the circular RNA molecule is expressed in the animal.
[0274] In some embodiments, the lengths of the DNA (e.g., vector), linear RNA (e.g., precursor RNA), and / or circular RNA polynucleotides provided herein are between 300 and 10000, 400 and 9000, 500 and 8000, 600 and 7000, 700 and 6000, 800 and 5000, 900 and 5000, 1000 and 5000, 1100 and 5000, 1200 and 5000, 1300 and 5000, 1400 and 5000, and / or 1500 and 5000 nucleotides. In some embodiments, the polynucleotide length is at least 300 nt, 400 nt, 500 nt, 600 nt, 700 nt, 800 nt, 900 nt, 1000 nt, 1100 nt, 1200 nt, 1300 nt, 1400 nt, 1500 nt, 2000 nt, 2500 nt, 3000 nt, 3500 nt, 4000 nt, 4500 nt, or 5000 nt. In some embodiments, the polynucleotide length does not exceed 3000 nt, 3500 nt, 4000 nt, 4500 nt, 5000 nt, 6000 nt, 7000 nt, 8000 nt, 9000 nt, or 10000 nt. In some implementations, the DNA, linear RNA, and / or circular RNA polynucleotides provided herein are approximately 300 nt, 400 nt, 500 nt, 600 nt, 700 nt, 800 nt, 900 nt, 1000 nt, 1100 nt, 1200 nt, 1300 nt, 1400 nt, 1500 nt, 2000 nt, 2500 nt, 3000 nt, 3500 nt, 4000 nt, 4500 nt, 5000 nt, 6000 nt, 7000 nt, 8000 nt, 9000 nt, or 10000 nt in length.
[0275] In some embodiments, the circular RNAs provided herein exhibit higher functional stability than mRNAs containing the same expression sequence. In some embodiments, the circular RNAs provided herein exhibit higher functional stability than mRNAs containing the same expression sequence, 5 molU modification, optimized UTR, cap, and / or polyA tail.
[0276] In some embodiments, the circular RNA polynucleotides provided herein have a functional half-life of at least 5 hours, 10 hours, 15 hours, 20 hours, 30 hours, 40 hours, 50 hours, 60 hours, 70 hours, or 80 hours. In some embodiments, the circular RNA polynucleotides provided herein have a functional half-life of 5-80, 10-70, 15-60, and / or 20-50 hours. In some embodiments, the functional half-life of the circular RNA polynucleotides provided herein is greater than the functional half-life of equivalent linear RNA polynucleotides encoding the same protein (e.g., at least 1.5 times, at least 2 times). In some embodiments, the functional half-life can be assessed by detecting functional protein synthesis.
[0277] In some embodiments, the circular RNA polynucleotides provided herein have a half-life of at least 5 hours, 10 hours, 15 hours, 20 hours, 30 hours, 40 hours, 50 hours, 60 hours, 70 hours, or 80 hours. In some embodiments, the circular RNA polynucleotides provided herein have a half-life of 5-80, 10-70, 15-60, and / or 20-50 hours. In some embodiments, the half-life of the circular RNA polynucleotides provided herein is greater than the half-life of equivalent linear RNA polynucleotides encoding the same protein (e.g., at least 1.5 times, at least 2 times). In some embodiments, the circular RNA polynucleotide or its pharmaceutical composition has a functional half-life in human cells greater than or equal to a predetermined threshold. In some embodiments, the functional half-life is determined by a functional protein assay. For example, in some embodiments, the functional half-life is determined by an in vitro luciferase assay, wherein the activity of Gausssia luciferase (GLuc) is measured in a culture medium of human cells (e.g., HepG2) expressing a circular RNA polynucleotide at 1, 2, 6, 7, or 14 days at 1, 2, 6, 12, or 24 hours. In other embodiments, the functional half-life is determined by an in vivo assay, wherein the level of the protein encoded by the expression sequence of the circular RNA polynucleotide is measured in a patient serum or tissue sample at 1, 2, 6, 12, or 24 hours within 1, 2, 3, 4, 5, 6, 7, or 14 days. In some embodiments, a predetermined threshold is the functional half-life of a reference linear RNA polynucleotide containing the same expression sequence as the circular RNA polynucleotide.
[0278] In some embodiments, the circular RNAs provided herein may have higher expression levels than equivalent linear mRNAs, for example, higher expression levels 24 hours after RNA administration to cells. In some embodiments, the circular RNAs provided herein have higher expression levels than mRNAs containing the same expression sequence, 5 molU modification, optimized UTR, cap, and / or polyA tail.
[0279] In some embodiments, the circular RNAs provided herein may exhibit lower immunogenicity than equivalent mRNAs upon exposure to the immune system or certain types of immune cells of an organism. In some embodiments, the circular RNAs provided herein are associated with the production of regulated cytokines upon exposure to the immune system or certain types of immune cells of an organism. For example, in some embodiments, the circular RNAs provided herein are associated with reduced production of IFN-β1, RIG-I, IL-2, IL-6, IFNγ, and / or TNFα upon exposure to the immune system or certain types of immune cells of an organism, compared to mRNAs containing the same expression sequence. In some embodiments, the circular RNAs provided herein are associated with less transcriptional induction of IFN-β1, RIG-I, IL-2, IL-6, IFNγ, and / or TNFα upon exposure to the immune system or certain types of immune cells of an organism, compared to mRNAs containing the same expression sequence. In some embodiments, the circular RNAs provided herein have lower immunogenicity than mRNAs containing the same expression sequence. In some implementations, the circular RNA provided herein has lower immunogenicity than mRNA containing the same expression sequence, 5 molU modification, optimized UTR, cap and / or polyA tail.
[0280] In some embodiments, the circular RNA provided herein can be transfected into cells as is, or it can be transfected into a DNA vector and transcribed in cells. The circular RNA can be transcribed from the transfected DNA vector via an added polymerase or a polymerase encoded by the nucleic acid transfected into the cells, or preferably via an endogenous polymerase.
[0281] A. Enhanced intron elements and enhanced exon elements
[0282] The polynucleotides provided herein may contain one or more enhancing intronic elements and / or one or more enhancing exon elements. In some embodiments, the enhancing intronic elements and enhancing exon elements may contain spacer regions, double-stranded regions, affinity sequences, intronic segments, exon segments, and / or various non-translational elements. These sequences within the enhancing intronic elements or enhancing exon elements are arranged to optimize circularization or protein expression.
[0283] a. Interval
[0284] In some embodiments, the provided polynucleotide (e.g., DNA template, precursor RNA polynucleotide, or circular RNA polynucleotide) includes one or more spacer regions. In some embodiments, the polynucleotide includes a first (5') spacer region and / or a second (3') spacer region. In some embodiments, the polynucleotide (e.g., DNA template or precursor linear RNA polynucleotide) includes one or more spacer regions within an enhanced intron element. In some embodiments, the polynucleotide (e.g., DNA template, precursor linear RNA polynucleotide, or circular RNA polynucleotide) includes one or more spacer regions within an enhanced exon element. In some embodiments, the polynucleotide includes a spacer region in a 3' enhanced intron segment and a spacer region in a 5' enhanced intron segment. In some embodiments, the polynucleotide includes a spacer region in a 3' enhanced exon segment and another spacer region in a 5' enhanced exon segment to facilitate circularization or protein expression due to the symmetry generated throughout the sequence.
[0285] In some embodiments, including a spacer region between the 3' group I intron and the core functional element can protect the secondary structures in those regions by preventing them from interacting, thereby increasing splicing efficiency. In some embodiments, the first spacer region (between the 3' group I intron and the core functional element) and the second spacer region (between the two expressed sequences and the core functional element) contain additional base-pairing regions that are predicted to pair with each other but not with the first and second double-stranded regions. In other embodiments, the first spacer region (between the 3' group I intron and the core functional element) and the second spacer region (between one of the core functional elements and the 5' group I intron) contain additional base-pairing regions that are predicted to pair with each other but not with the first and second double-stranded regions. In some embodiments, such spacer region base pairing brings the group I introns closer together, thereby further increasing splicing efficiency. Additionally, in some embodiments, the combination of base pairings between the first and second double-stranded regions, and the base pairings between the first and second spacer regions individually, promote the formation of splice bubbles in group I intron segments containing adjacent regions with side-paired base pairings. A typical spacer region is a continuous sequence having one or more of the following properties: 1) predicts avoidance of interference with proximal structures, such as IRES, expression sequences, aptamers, or introns; 2) at least 7 nt long and no longer than 100 nt; 3) located after and adjacent to a 3' intron segment and / or before and adjacent to a 5' intron segment; and 4) containing one or more of the following: a) an unstructured region at least 5 nt long, b) a base-paired region at least 5 nt long with the distal sequence, including another spacer region, and c) a structured region at least 7 nt long, the extent of which is limited to the sequence of the spacer region. The spacer region may have several regions, including unstructured regions, base-paired regions, hairpin / structured regions, and combinations thereof. In one embodiment, the spacer region has a structured region with a high GC content. In one embodiment, a region within the spacer region pairs base-to-base with another region within the same spacer region. In another embodiment, a region within the spacer region pairs base-to-base with a region within another spacer region. In one embodiment, the spacer region comprises one or more hairpin structures. In one embodiment, the spacer region comprises one or more hairpin structures having a stem of 4 to 12 nucleotides and a loop of 2 to 10 nucleotides. In one embodiment, an additional spacer region exists between the 3' group I intron segment and the core functional element. In one embodiment, this additional spacer region prevents the structured regions of the IRES of the TIE or the aptamer from interfering with or reducing the extent to which this occurs in the 3' group I intron segment. In some embodiments, the 5' spacer region sequence is at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, or 30 nucleotides in length.In some embodiments, the length of the 5' spacer sequence does not exceed 100, 90, 80, 70, 60, 50, 45, 40, 35, or 30 nucleotides. In some embodiments, the length of the 5' spacer sequence is 5 to 50, 10 to 50, 20 to 50, 20 to 40, and / or 25 to 35 nucleotides. In some embodiments, the length of the 5' spacer sequence is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. In one embodiment, the 5' spacer sequence is a polyA sequence. In another embodiment, the 5' spacer sequence is a polyAC sequence. In one embodiment, the spacer contains about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% polyAC. In another embodiment, the spacer contains about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% polypyrimidine (C / T or C / U).
[0286] b. Double-stranded region
[0287] In some embodiments, the polynucleotides provided herein (e.g., DNA templates, precursor linear RNA polynucleotides, or circular RNA polynucleotides) comprise one or more double-stranded regions. In some embodiments, the polynucleotide comprises a first (5') double-stranded region and a second (3') double-stranded region. In some embodiments, the polynucleotide comprises a 5' outer double-stranded region within a 3' enhanced intron segment and a 3' outer double-stranded region within a 5' enhanced intron segment. In some embodiments, the polynucleotide comprises a 5' inner double-stranded region within a 3' enhanced exon segment and a 3' inner double-stranded region within a 5' enhanced exon segment. In some embodiments, the polynucleotide comprises a 5' outer double-stranded region, a 5' inner double-stranded region, a 3' inner double-stranded region, and a 3' outer double-stranded region.
[0288] In some embodiments, the first and second double-stranded regions may form perfect or imperfect double strands. Therefore, in some embodiments, at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the first and second double-stranded regions are base-paired with each other. In some embodiments, the double-stranded region is predicted to have less than 50% (e.g., less than 45%, less than 40%, less than 35%, less than 30%, less than 25%) base pairing with unexpected sequences in the RNA (e.g., non-double-stranded sequences). In some embodiments, such double-stranded regions are included at the ends of the precursor RNA strand and are adjacent to or very close to Group I intron segments, such that the Group I intron segments are close to each other, thereby increasing splicing efficiency. In some embodiments, the length of the double-stranded region is 3 to 100 nucleotides (e.g., 3-75 nucleotides, 3-50 nucleotides, 20-50 nucleotides, 35-50 nucleotides, 5-25 nucleotides, or 9-19 nucleotides). In some embodiments, the length of the double-stranded region is about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. In some embodiments, the double-stranded region has a length of about 9 to about 50 nucleotides. In one embodiment, the double-stranded region has a length of about 9 to about 19 nucleotides. In some embodiments, the double-stranded region has a length of about 20 to about 40 nucleotides. In some embodiments, the double-stranded region has a length of about 30 nucleotides.
[0289] In other implementations, the polynucleotide does not contain any double-stranded regions to optimize translation or cyclization.
[0290] c. Affinity sequence
[0291] As provided herein, the provided polynucleotides (e.g., DNA template, precursor linear RNA polynucleotide, or circular RNA polynucleotide) may contain an affinity sequence (or affinity tag). In some embodiments, the affinity tag is located in a 3' enhanced intron element. In some embodiments, the affinity tag is located in a 5' enhanced intron element. In some embodiments, each of the two (3' and 5') enhanced intron elements contains an affinity tag. In one embodiment, the affinity tag of the 3' enhanced intron element is the same length as the affinity tag in the 5' enhanced intron element. In some embodiments, the affinity tag of the 3' enhanced intron element has the same sequence as the affinity tag in the 5' enhanced intron element. In some embodiments, the affinity sequence is placed to optimize oligo-dT purification.
[0292] In some implementations, one or more affinity tags present in the precursor linear RNA polynucleotide are removed during circularization. See, for example... Figure 89A and Figure 89B In some embodiments, after RNA circularization, an affinity tag is added to the remaining linear RNA. In some such embodiments, the affinity tag is enzymatically added to the linear RNA. The presence of one or more affinity tags in the linear RNA and their absence in the circular RNA can facilitate the purification of the circular RNA. In some embodiments, this purification is performed using negative selection or affinity purification methods. In some embodiments, this purification is performed using a binding agent that preferentially or specifically binds to the affinity tag.
[0293] In some embodiments, the affinity tag comprises a polyA sequence. In some embodiments, the polyA sequence is at least 15, 30, or 60 nucleotides long. In some embodiments, the affinity tag containing the polyA sequence is present at two locations in the precursor linear RNA. In some embodiments, one or both polyA sequences are 15-50 nucleotides long. In some embodiments, one or both polyA sequences are 20-25 nucleotides long. In some embodiments, the polyA sequence is removed during circularization. Therefore, oligonucleotides that hybridize with the polyA sequence, such as deoxythymidine oligonucleotides (oligo(dT)) conjugated to a solid surface (e.g., resin), can be used to separate circular RNA from its precursor RNA.
[0294] In some embodiments, the affinity tag contains a sequence not present in the circular RNA product. In some such embodiments, the sequence not present in the circular RNA product is a dedicated binding site (DBS). In some embodiments, the DBS is an unstructured sequence, i.e., a sequence that does not form defined structural elements, such as a hairpin loop, a continuous dsRNA region, or a triple helix. In some embodiments, the DBS sequence forms a random coil. In some embodiments, the DBS contains at least 25% GC, at least 50% GC, at least 75% GC, or at least 100% GC. In some embodiments, the DBS contains at least 25% AC, at least 50% AC, at least 75% AC, or 100% AC. In some embodiments, the DBS is at least 15, 30, or 60 nucleotides long. In some embodiments, the affinity tag containing the DBS is present at two locations in the precursor linear RNA. In some embodiments, the DBS sequences are each independently 15-50 nucleotides long. In some embodiments, the DBS sequences are each independently 20-25 nucleotides long.
[0295] In some implementations, the DBS sequence is removed during circularization. Therefore, binding agents containing oligonucleotides with sequences complementary to DBS can be used to facilitate the purification of circular RNA. For example, the binding agent may contain oligonucleotides complementary to DBS conjugated to a solid surface (e.g., resin).
[0296] In some embodiments, an affinity sequence or other type of affinity stalk (such as biotin) is added to the linear RNA by ligation. In some embodiments, an oligonucleotide containing the affinity sequence is ligated to the linear RNA. In some embodiments, an oligonucleotide conjugated to an affinity stalk is ligated to the linear RNA. In some embodiments, a solution containing linear RNA conjugated to an affinity sequence or stalk and circular RNA not containing an affinity sequence or stalk is contacted with a binding agent comprising a solid support conjugated to an oligonucleotide complementary to the affinity sequence or to a binding partner of the affinity stalk, such that the linear RNA binds to the binding agent and the circular RNA is eluted or separated from the solid support.
[0297] Any purification method for the circular RNA described herein may include one or more buffer exchange steps. In some embodiments, the buffer exchange is performed after in vitro transcription (IVT) and before further purification steps. In some such embodiments, the IVT reaction solution buffer is exchanged for a buffer containing Tris. In some embodiments, the IVT reaction solution buffer is exchanged for a buffer containing one or more monovalent salts (such as NaCl or KCl) greater than 1 mM or greater than 10 mM and optionally containing EDTA. In some embodiments, the buffer exchange is performed after the purification of the circular RNA is complete. In some embodiments, the buffer exchange is performed after IVT and after the purification of the circular RNA. In some embodiments, the buffer exchange performed after the purification of the circular RNA includes exchanging the circular RNA into water or a storage buffer. In some embodiments, the storage buffer contains 1 mM sodium citrate at pH 6.5.
[0298] In some embodiments, the 3' enhancing intron element comprises a leader untranslated sequence. In some embodiments, the leader untranslated sequence is the 5' end of the 3' enhancing intron region. In some embodiments, the leader untranslated sequence comprises the last nucleotide of the transcription start site (TSS). In some embodiments, the TSS is selected from viral, bacterial, or eukaryotic DNA templates. In one embodiment, the leader untranslated sequence comprises the last nucleotide of the TSS and 0 to 100 additional nucleotides. In some embodiments, the TSS is a terminal spacer region. In one embodiment, the leader untranslated sequence contains guanosine at its 5' end after translation by RNA T7 polymerase.
[0299] In some embodiments, the 5' enhanced intron element includes a trailing untranslated sequence. In some embodiments, the 5' trailing untranslated sequence is located at the 3' end of the 5' enhanced intron element. In some embodiments, the trailing untranslated sequence is a partially restriction digestion sequence. In one embodiment, the trailing untranslated sequence is wholly or partially a restriction digestion site for linearizing the DNA template. In some embodiments, the restriction digestion site is wholly or partially derived from a natural viral, bacterial, or eukaryotic DNA template. In some embodiments, the trailing untranslated sequence is a terminal restriction site fragment.
[0300] d. Enhanced intronic segments
[0301] In some embodiments, the 3' enhancing intron element and the 5' enhancing intron element each comprise an intronic segment. In some embodiments, the 3' intronic segment is a continuous sequence that is at least 75% homologous (e.g., at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% homologous) to the 3' proximal segment of the natural Group I intron, which includes the 3' splice site dinucleotide. Typically, the 5' intronic segment is a continuous sequence that is at least 75% homologous (e.g., at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% homologous) to the 5' proximal segment of the natural Group I intron, which includes the 5' splice site dinucleotide. In some embodiments, the 3' intron region comprises the first nucleotide of the 3' group I splice site dinucleotide. In some embodiments, the 5' intron region comprises the first nucleotide of the 5' group I splice site dinucleotide. In other embodiments, the 3' intron region comprises the first and second nucleotides of the 3' group I intron splice site dinucleotide; and the 5' intron region comprises the first and second nucleotides of the 3' group I intron region dinucleotide.
[0302] e. Enhanced exon segments
[0303] In some embodiments, the provided polynucleotide (e.g., DNA template, linear precursor RNA polynucleotide, or circular RNA polynucleotide) includes an enhancing exon segment. In some embodiments, the 3' enhancing exon element is located upstream of the core functional element in a 5' to 3' sequence. In some embodiments, the 5' enhancing intron element is located downstream of the core functional element in a 5' to 3' sequence.
[0304] According to the present invention, the 3' enhanced exon element and the 5' enhanced exon element each comprise an exon segment. In some embodiments, the 3' enhanced exon element comprises a 3' exon segment. In some embodiments, the 5' enhanced exon element comprises a 5' exon segment. In some embodiments, as provided herein, the 3' exon segment and the 5' exon segment each comprise a group I intron segment and 1 to 100 nucleotides of the exon sequence. In some embodiments, the 3' intron segment is a continuous sequence that is at least 75% homologous (e.g., at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% homologous) to the 3' proximal fragment of a natural group I intron including a 3' splice site dinucleotide. Typically, the 5' group I intron region is a continuous sequence that is at least 75% homologous (e.g., at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% homologous) to the 5' proximal segment of a natural group I intron including a 5' splice site dinucleotide. In some embodiments, the 3' exon region comprises the second nucleotide of the 3' group I intron splice site dinucleotide and 1 to 100 nucleotides of the exon sequence. In some embodiments, the 5' exon region comprises the first nucleotide of the 5' group I intron splice site dinucleotide and 1 to 100 nucleotides of the exon sequence. In some embodiments, the exon sequence comprises, in whole or in part, naturally occurring exon sequences from viruses, bacteria, or eukaryotic DNA vectors. In other embodiments, the exon sequence further comprises synthetic, genetically modified (e.g., containing modified nucleotides), or other engineered exon sequences.
[0305] In one embodiment, the 3' intron region contains two nucleotides of the 3' group I splice site dinucleotide, and the 5' intron region contains two nucleotides of the 5' group I splice site dinucleotide, while the exon regions located within the 5' enhanced exon element and the 3' enhanced exon element do not contain the group I splice site dinucleotide.
[0306] f. Exemplary substitutions for enhanced intron elements and enhanced exon elements
[0307] By way of example and not intended to be limiting, in some embodiments, the 3' enhanced intron element comprises, in the following 5' to 3' order: a leading untranslated sequence, a 5' affinity tag, an optional 5' outer double-stranded region, a 5' outer spacer region, and a 3' intron segment. In the same embodiment, the 3' enhanced exon element comprises, in the following 5' to 3' order: a 3' exon segment, an optional 5' inner double-stranded region, an optional 5' inner double-stranded region, and a 5' inner spacer region. In the same embodiment, the 5' enhanced exon element comprises, in the following 5' to 3' order: a 3' inner spacer region, an optional 3' inner double-stranded region, and a 5' exon segment. In still the same embodiment, the 3' enhanced intron element comprises, in the following 5' to 3' order: a 5' intron segment, a 3' outer spacer region, an optional 3' outer double-stranded region, a 3' affinity tag, and a trailing untranslated sequence.
[0308] B. Core functional components
[0309] In some embodiments, the provided polynucleotide (e.g., DNA template, linear precursor RNA polynucleotide, or circular RNA polynucleotide) comprises a core functional element. In some embodiments, the core functional element comprises a coding or non-coding element. In some embodiments, the core functional element may comprise both coding and non-coding elements. In some embodiments, the core functional element also comprises a translation initiation element (TIE) upstream of the coding or non-coding element. In some embodiments, the core functional element comprises a termination element. In some embodiments, the termination element is located downstream of the TIE and the coding element. In some embodiments, the termination element is located downstream of the coding element but upstream of the TIE. In some embodiments, where the coding element comprises a non-coding region, the core functional element lacks a TIE and / or a termination element.
[0310] a. Encoded or non-coded elements
[0311] In some embodiments, the polynucleotides provided herein comprise coding or non-coding elements or a combination of both. In some embodiments, the coding element comprises an expressed sequence. In some embodiments, the coding element encodes at least one therapeutic protein.
[0312] In some embodiments, the provided circular RNA encodes two or more polypeptides. In some embodiments, the circular RNA is bicistronic RNA. The sequences encoding two or more polypeptides can be separated by ribosomal jumping elements or nucleotide sequences encoding protease cleavage sites. In some embodiments, the ribosomal jumping elements encode 2A peptides of *Melilothorax muscularis* virus (T2A), *P. spp.* cyclovir-1 (P2A), *F. spp.* foot-and-mouth disease virus (F2A), *E. equine rhinitis A* virus (E2A), cytoplasmic polyhedrosis virus (BmCPV 2A), or *B. spp.* silkworm fibrosis virus (BmIFV 2A).
[0313] b. Translation Initiation Element (TIE)
[0314] As provided in some embodiments herein, the core functional element includes at least one translation initiation element (TIE). The TIE is designed to allow for efficient translation of the protein being encoded. Therefore, the optimal core functional element, which contains only non-coding elements, lacks any TIE. In some embodiments, the core functional element containing one or more coding elements will further include one or more TIEs.
[0315] In some implementations, the TIE comprises naturally occurring sequences and / or synthetically non-natural sequences capable of promoting and / or initiating the translation of the encoded protein.
[0316] In some embodiments, the TIE contains an untranslated region (UTR). In some embodiments, the TIE provided herein contains an internal ribosome entry site (IRES). The inclusion of an IRES allows translation from the circular RNA into one or more open reading frames (e.g., open reading frames forming the expressed sequence). The IRES element attracts the eukaryotic ribosome translation initiation complex and facilitates translation initiation. See, for example, Kaufman et al., Nuc. Acids Res. (1991) 19:4485-4490; Gurtu et al., Biochem. Biophys. Res. Comm. (1996) 229:295-298; Rees et al., BioTechniques (1996) 20:102-110; Kobayashi et al., BioTechniques (1996) 21:399-402; and Mosser et al., BioTechniques 1997 22 150-161.
[0317] i. Natural TIEs: Viral and eukaryotic / intracellular ribosome entry sites (IRES)
[0318] A large number of IRES sequences are available and include sequences derived from a variety of viruses, such as leader sequences from piconemaviruses, such as encephalomyocarditis virus (EMCV) UTR (Jang et al., J.Virol. (1989) 63:1651-1660), polio virus leader sequences, hepatitis A virus leader sequences, hepatitis C virus IRES, human rhinovirus type 2 IRES (Dobrikova et al., Proc. Natl. Acad. Sci. (2003) 100(25):15125-15130), IRES elements from foot-and-mouth disease virus (Ramesh et al., Nucl. Acid Res. (1996) 24:2697-2700), Giardia virus IRES (Garlapati et al., J. Biol. Chem. (2004) 279(5):3389-3397), etc.
[0319] Different IRES sequences have different abilities to drive protein expression, and the ability of any particular identified or predicted IRES sequence to drive protein expression from linear mRNA or circular RNA constructs is unknown and unpredictable. In some embodiments, potential IRES sequences can be bioinformatically identified based on their sequence position within a viral sequence. However, the activity of such sequences has not been previously characterized. As demonstrated herein, such IRES sequences can have different protein expression capabilities depending on cell type, such as in T cells, hepatocytes, or muscle cells. In some embodiments, the novel IRES sequences described herein can increase expression in specific cell types by at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or 100-fold compared to previously described EMCV IRES sequences.
[0320] In some implementations, to drive protein expression, the provided circular RNA contains an IRES operatively linked to a protein-coding sequence.
[0321] In some embodiments, the TIE contains a sequence from a nonviral untranslated region (UTR). In some embodiments, the TIE contains a sequence from a mammalian UTR and is capable of driving protein expression when operatively linked to the coding sequence of the protein. In some embodiments, the TIE contains a sequence from a primate UTR and is capable of driving protein expression when operatively linked to the coding sequence of the protein. In some embodiments, the TIE contains a sequence from a human UTR and is capable of driving protein expression when operatively linked to the coding sequence of the protein. In some embodiments, the TIE contains a sequence from an invertebrate UTR and is capable of driving protein expression when operatively linked to the coding sequence of the protein. In some embodiments, the TIE contains a sequence from a fruit fly UTR and is capable of driving protein expression when operatively linked to the coding sequence of the protein.
[0322] In some embodiments, the IRES comprises a sequence or fragment thereof of any one of the IRES sequences SEQ ID NO:14067-24829. In some embodiments, the IRES comprises at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the sequence of any one of the IRES sequences SEQ ID NO:14067-24829. In some embodiments, the circular RNA disclosed herein comprises an IRES sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the sequence of any one of the IRES sequences SEQ ID NO:14067-24829. In some embodiments, the circular RNA disclosed herein comprises an IRES sequence or fragment thereof of any one of the IRES sequences SEQ ID NO:14067-24829.
[0323] In some embodiments, the IRES comprises the sequence or fragment thereof shown in any one of SEQ ID NO:793, 876, 1017, 1216, and 3291. In some embodiments, the IRES comprises at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the sequence shown in any one of SEQ ID NO:793, 876, 1017, 1216, and 3291. In some embodiments, the circular RNA disclosed herein comprises an IRES sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the sequence shown in any one of SEQ ID NO:793, 876, 1017, 1216, and 3291. In some embodiments, the circular RNA disclosed herein comprises the IRES sequence or a fragment thereof shown in any one of SEQ ID NO: 793, 876, 1017, 1216, and 3291. In some embodiments, the IRES comprises the sequence or a fragment thereof shown in any one of SEQ ID NO: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293, and 3302. In some embodiments, IRES comprises at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the sequence shown in any one of SEQ ID NO: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293, and 3302. In some embodiments, the circular RNA disclosed herein comprises at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical IRES sequences to those shown in any one of SEQ ID NO: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293, and 3302.In some embodiments, the circular RNA disclosed herein comprises an IRES sequence or a fragment thereof as shown in any one of SEQ ID NO: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293, and 3302. In some embodiments, the IRES comprises SEQ ID NO: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293, and 3302. NO:75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874 ,922,959,984,1015,1026,1041,1047,1059,1068,1134,1177,1178,1180,1189,1193 The sequence or a fragment thereof shown in any of the following sequences: 1198, 1263, 1276, 1280, 1282, 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299, and 3301. In some embodiments, IRES comprises a sequence with the SEQ ID. NO:75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 922, 959, 984 ,1015,1026,1041,1047,1059,1068,1134,1177,1178,1180,1189,1193,1198,1263,1276,1280,1282 The sequence shown in any one of 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299 and 3301 is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical.In some implementations, the circular RNA disclosed herein comprises the same as SEQ ID NO: 75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 922, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 1193, 1198, 1263, 1276, 1280, 1282, 2 The sequence shown in any one of 601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299, and 3301 is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the IRES sequence. In some embodiments, the circular RNA disclosed herein comprises SEQ ID [SEQ ID]. NO:75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 922, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 1193, 1 The IRES sequence or fragment thereof shown in any of the following: 198, 1263, 1276, 1280, 1282, 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299 and 3301.
[0324] In some embodiments, the IRES comprises a sequence or fragment thereof selected from SEQ ID NO:1-2983 and 3282-3287. In some embodiments, the IRES comprises at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the sequence selected from SEQ ID NO:1-2983 and 3282-3287. In some embodiments, the circular RNA disclosed herein comprises an IRES sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the sequence selected from SEQ ID NO:1-2983 and 3282-3287. In some embodiments, the circular RNA disclosed herein comprises an IRES sequence or fragment thereof selected from SEQ ID NO:1-2983 and 3282-3287. This document discloses modifications to IRES and associated sequences to increase or decrease IRES activity, for example, by truncating the 5' and / or 3' ends of the IRES, adding a 5' spacer region to the IRES, modifying the 5' of the translation initiation site with 6 nucleotides (Kozak sequence), modifying alternative translation initiation sites, and generating chimeric / hybrid IRES sequences. In some embodiments, the IRES sequences in the circular RNAs disclosed herein contain one or more of these modifications relative to the native IRES (e.g., SEQ ID NO: 1-2983 and 3282-3287). In some embodiments, the IRES contains one or more modifications of any one of SEQ ID NO: 793, 876, 1017, 1216, and 3291. In some implementations, IRES includes one or more modifications of any one of SEQ ID NO: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293 and 3302.In some implementations, IRES includes SEQ ID NO: 75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 922, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 1193 One or more modifications of any one of the following: 1198, 1263, 1276, 1280, 1282, 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299, and 3301.
[0325] In some implementation schemes, IRES refers to Aalivirus, Ailurivirus, Ampivirus, Anativirus, Aphthovirus, Aquamavirus, Avihepatovirus, Avisivirus, Boosepivirus, Bopivirus, Caecilivirus, Cardiacvirus, Coxsackievirus, Crahelivirus, Crohivirus, Danipivirus, Dicipivirus, Diresapivirus, Enterovirus, Erbovirus, Felipivirus, Fipivirus, Gallivirus, Gruhelivirus, and Grusopivirus.Hepatitis virus (HPV), hepatitis virus (HPV), hemipivirus, hepatitis virus (HPV), ... Orphan virus (Parechovirus), Pasivirus, Passerivirus, Pemapivirus, Poecivirus, Potamipivirus, Pygoscepivirus, Rabovirus, Rafivirus, Rajidapivirus, Rohelivirus, Rosavirus, Sakobuvirus, Sapelovirus, Senecavirus, Shanbavirus, Sicinivirus Symapivirus, Teschovirus, Torchivirus, Tottorivirus, Tremovirus, Tropivirus, Hepatitis C virus, Hepatic tropism virus, Pestivirus, Flavivirus, IRES.
[0326] In some implementations, IRES is the IRES sequence of the following viruses: Taura syndrome virus, Triatoma virus, Theiler's encephalomyelitis virus, simian virus 40, Solenopsis invicta virus 1, Rhopalosiphum padi virus, Reticuloendotheliosis virus, Human poliovirus 1, Plautia staliintestine virus, Kashmir bee virus, Human rhinovirus 2, Homalodisca coagulata virus-1, Human immunodeficiency virus type 1, and Himetobi P virus. Hepatitis C virus, Hepatitis A virus, GB virus, Foot-and-mouth disease virus, Human enterovirus 71, Equine rhinitis virus, Ectropis obliqua picorna-like virus, Encephalocarditis virus, Drosophila C virus, Human Coxsackievirus B3, Crucifera tobamovirus, Cricket paralysis virus, Bovine viral diarrhea virus, Black Queen Cell virus, Aphid lethal paralysis virus, Avian encephalomyelitis virus, Acute bee paralysis virus, Hibiscus chlorotic ringspot virus, Classical swine fever virus. fevervirus), human FGF2, human SFTPA1, human AML1 / RUNX1, Drosophila antennae (Drosophila)Antennapedia), Human AQP4, Human AT1R, Human BAG-1, Human BCL2, Human BiP, Human c-IAPl, Human c-myc, Human eIF4G, Mouse NDST4L, Human LEF1, Mouse HIF1α, Human n.myc, Mouse Gtx, Human p27kipl, Human PDGF2 / c-sis, Human p53, Human Pim-1, Mouse Rbm3, Drosophila reaper, Canid Scamper, Drosophila Ubx, Human UNR, Mouse UtrA, Human VEGF-A, Human XIAP, Drosophila hairless, Saccharomyces cerevisiae TFIID, Saccharomyces cerevisiae YAP1, Tobacco etchvirus, Turnip crinkle virus, EMCV-A, EMCV-B, EMCV-Bf, EMCV-Cf, EMCVpEC9, Picobirnavirus, HCV QC64, Human Cosavirus E / D, Human Cosavirus F, Human Cosavirus JMY, Rhinovirus NAT001, HRV14, HRV89, HRVC-02, HRV-A21, Sallyvirus A SH1, Sallyvirus FHB, Sallyvirus NG-J1, Human Paraenterovirus 1, Croxivirus B, Yc-3, Rosavirus M-7, Shanbavirus A, Pasivirus A, Pasivirus A2, Echovirus E14, Human Paraenterovirus 5, Aichi Virus, Hepatitis A Virus HA16, Phopivirus, CVA10, Enterovirus C, Enterovirus D, Enterovirus J, Human Pegivirus 2, GBV-C GT110, GBV-CK1737, GBV-CIowa, Pegivirus A 1220, Pasivirus A3, Sapelovirus, Rosavirus B, Bakunsa Virus, Tremovirus A, Porcine Pasivirus 1, PLV-CHN, Pasivirus A, Sicinivirus, Hepatitis C Virus K, Hepatitis C Virus A, BVDV1, Border Disease Virus, BVDV2, CSFV-PK15C, SF573 Dicistrovirus, Hubei Picorna-like Virus, CRPV, Sally Virus A BN5, Sally Virus AAptamers of BN2, Sallyvirus A02394, Sallyvirus AGUT, Sallyvirus ACH, Sallyvirus ASZ1, Sallyvirus FHB, CVB3, CVB1, Echovirus 7, CVB5, EVA71, CVA3, CVA12, EV24, or eIF4G.
[0327] In some embodiments, the IRES comprises, wholly or partially, eukaryotic or cellular IRES. In some embodiments, the IRES are derived from human genes, wherein the human gene is ABCF1, ABCG1, ACAD10, ACOT7, ACSS3, ACTG2, ADCYAP1, ADK, AGTR1, AHCYL2, AHI1, AKAP8L, AKR1A1, ALDH3A1, ALDOA, ALG13, AMMECR1L, ANGPTL4, ANK3, AOC3, AP4B1, AP4E1, APAF1, APBB1, APC, APH1A, APOBEC3D, APOM, APP, AQP4, ARHGAP36, ARL13B, ARMC8, ARMCX6, AR PC1A, ARPC2, ARRDC3, ASAP1, ASB3, ASB5, ASCL1, ASMTL, ATF2, ATF3, ATG4A, ATP5B, ATP6V0A1, ATXN3, AURKA, AURKA, AURKA, AURKA, B3GALNT1, B3GNT L1, B4GALT3, BAAT, BAG1, BAIAP2, BAIAP2L2, BAZ2A, BBX, BCAR1, BCL2, BCS1L, BET1, BID, BIRC2, BPGM, BPIFA2, BRINP2, BSG, BTN3A2, C12orf43, C14 orf93, C17orf62, C1orf226, C21orf62, C2orf15, C4BPB, C4orf22, C9orf84, CACNA1A, CALCOCO2, CAPN11, CASP12, CASP8AP2, CAV1, CBX5, CCDC120, CCDC17, CCDC186, CCDC51, CCN1, CCND1, CCNT1, CD2BP2, CD9, CDC25C, CDC42, CDC7, CDCA7L, CDIP1, CDK1, CDK11A, CDKN1B, CEACAM7, CEP295NL, CFLA R, CHCHD7, CHIA, CHIC1, CHMP2A, CHRNA2, CLCN3, CLEC12A, CLEC7A, CLECL1, CLRN1, CMSS1, CNIH1, CNR1, CNTN5, COG4, COMMD1, COMMD5, CPEB1, CPS1, CRACR2B, CRBN, CREM, CRYBG1, CSDE1, CSF2RA, CSNK2A1, CSTF3, CTCFL, CTH, CTNNA3, CTNNB1, CTNNB1, CTNND1, CTSL, CUTA, CXCR5, CYB5R3, CYP24A1,CYP3A5、DAG1、DAP3、DAP5、DAXX、DCAF4、DCAF7、DCLRE1A、DCP1A、DCTN1、DCTN2、D DX19B、DDX46、DEFB123、DGKA、DGKD、DHRS4、DHX15、DIO3、DLG1、DLL4、DMDUTR、DMD ex5、DMKN、DNAH6、DNAL4、DUSP13、DUSP19、DYNC1I2、DYNLRB2、DYRK1A、ECI2、ECT2、EIF1AD、EIF2B4、EIF4G1、EIF4G2、EIF4G3、ELAN E、ELOVL6、ELP5、EMCN、ENO1、EPB41、ERMN、ERVV-1、ESRRG、ETFB、E TFBKMT、ETV1、ETV4、EXD1、EXT1、EZH2、FAM111B、FAM157A、FAM213 A、FBXO25、FBXO9、FBXW7、FCMR、FGF1、FGF1、FGF1A、FGF2、FGF2、FG F-9、FHL5、FMR1、FN1、FOXP1、FTH1、FUBP1、G3BP1、GABBR1、GALC、G ART、GAS7、gastrin、GATA1、GATA4、GFM2、GHR、GJB2、GLI1、GLRA2、GMNN、GPAT3、GPATCH3、GPR137、GPR34、GPR55、GPR89A、GPRASP1、G RAP2、GSDMB、GSTO2、GTF2B、GTF2H4、GUCY1B2、HAX1、HCST、HIGD1A 、HIGD1B、HIPK1、HIST1H1C、HIST1H3H、HK1、HLA-DRB4、HMBS、HMGA 1、HNRNPC、HOPX、HOXA2、HOXA3、HPCAL1、HR、HSP90AB1、HSPA1A、HS PA4L、HSPA5、HYPK、IFFO1、IFT74、IFT81、IGF1、IGF1R、IGF1R、IGF 2、IL11、IL17RE、IL1RL1、IL1RN、IL32、IL6、ILF2、ILVBL、INSR、IN TS13、IP6K1、ITGA4、ITGAE、KCNE4、KERA、KIAA0355、KIAA0895L、K IAA1324、KIAA1522、KIAA1683、KIF2C、KIZ、KLHL31、KLK7、KRR1、K RT14、KRT17、KRT33A、KRT6A、KRTAP10-2、KRTAP13-3、KRTAP13-4、KRTAP5-11、KRTCAP2、LACRT、LAMB1、LAMB3、LANCL1、LBX2、LCAT、LDHA、LDHA L6A、LEF1、LINC-PINT、LMO3、LRRC4C、LRRC7、LRTOMT、LSM5、LTB4R、LYRM1、LY RM2、MAGEA11、MAGEA8、MAGEB1、MAGEB16、MAGEB3、MAPT、MARS、MC1R、MCCC1、 METTL12、METTL7A、MGC16025、MGC16025、MIA2、MIA2、MITF、MKLN1、MNT、MORF 4L2、MPD6、MRFAP1、MRPL21、MRPS12、MSI2、MSLN、MSN、MT2A、MTFR1L、MTMR2、 MTRR、MTUS1、MYB、MYC、MYCL、MYCN、MYL10、MYL3、MYLK、MYO1A、MYT2、MZB1、NA P1L1、NAV1、NBAS、NCF2、NDRG1、NDST2、NDUFA7、NDUFB11、NDUFC1、NDUFS1、N EDD4L、NFAT5、NFE2L2、NFE2L2、NFIA、NHEJ1、NHP2、NIT1、NKRF、NME1-NME2、N PAT、NR3C1、NRBF2、NRF1、NTRK2、NUDCD1、NXF2、NXT2、ODC1、ODF2、OPTN、OR1 0R2、OR11L1、OR2M2、OR2M3、OR2M5、OR2T10、OR4C15、OR4F17、OR4F5、OR5H1、O R5K1、OR6C3、OR6C75、OR6N1、OR7G2、p53、P2RY4、PAN2、PAQR6、PARP4、PARP9 PC、PCBP4、PCDHGC3、PCLAF、PDGFB、PDZRN4、HEAD、PEMT、PEX2、PFKM、PGBD4、 PGLYRP3、PHLDA2、PHTF1、PI4KB、PIGC、PIM1、PKD2L1、PKM、PLCB4、PLD3、PLE KHA1、PLEKHB1、PLS3、PML、PNMA5、PNN、POC1A、POC1B、POLD2、POLD4、POU5F1、 PPIG、PQBP1、PRAME、PRPF4、PRR11、PRRT1、PRSS8、PSMA2、PSMA3、PSMA4、PSMD 11、PSMD4、PSMD6、PSME3、PSMG3、PTBP3、PTCH1、PTHLH、PTPRD、PUS7L、PVRIG、QPRT, RAB27A, RAB7B, RABGGTB, RAET1E, RALGDS, RALYL, RARB, RCVRN, REG3G, RFC5, RGL4, RGS19, RGS3, RHD, RINL, RIPOR2, RITA1, RMDN2, RNASE1, RNASE 4.RNF4, RPA2, RPL17, RPL21, RPL26L1, RPL28, RPL29, RPL41, RPL9, RPS11, RPS13, RPS14, RRBP1, RSU1, RTP2, RUNX1, RUNX1T1, RUNX1T1, RUNX2, RUSC1, RX RG, S100A13, S100A4, SAT1, SCHIP1, SCMH1, SEC14L1, SEMA4A, SERPINA1, SERPINB4, SERTAD3, SFTPD, SH3D19, SHC1, SHMT1, SHPRH, SIM1, SIRT5, SLC11A2, SLC12A4, SLC16A1, SLC25A3, SLC26A9, SLC5A11, SLC6A12, SLC6A19, SLC7A1, SLFN11, SLIRP, SMAD5, SMARCAD1, SMN1, SNCA, SNRNP200, SNRPB2, SNX12, SOD1, SOX13, SOX5, SP8, SPARCL1, SPATA12, SPATA31C2, SPN, SPOP, SQSTM1, SRBD1, SRC, SREBF1, SRPK2, SSB, SSB, SSBP1, ST3GAL6, STAB1, STAMBP, STAU1, STAU1, STAU1, STAU1, STK16, STK24, STK38, STMN1, STX7, SULT2B1, SYK, SYNPR, TAF1C, TAGLN, TANK, TAS2R40, TBC1D15, TBXAS1, TCF4, TDGF1, T DP2, TDRD3, TDRD5, TESK2, THAP6, THBD, THTPA, TIAM2, TKFC, TKTL1, TLR10, TM9SF2, TMC6, TMCO2, TMED10, TMEM116, TMEM126A, TMEM159, TMEM208, TMEM 230.TUBB6, TXLNB, TXNIP, TXNL1, TXNRD1, TYROBP, U2AF1, UBA1, UBE2D3, UBE2I, UBE2L3, UBE2V1, UBE2V2, UM PS, UNG, UPP2, USMG5, USP18, UTP14A, UTRN, UTS2, VDR, VEGFA, VEGFA, VEPH1, VIPAS39, VPS29, VSIG10L, W DHD1, WDR12, WDR4, WDR45, WDYHV1, WRAP53, XIAP, XPNPEP3, YAP1, YWHAZ, YY1AP1, ZBTB32, ZNF146, ZNF2 50. ZNF385A, ZNF408, ZNF410, ZNF423, ZNF43, ZNF502, ZNF512, ZNF513, ZNF580, ZNF609, ZNF707 or ZNRD1. ,
[0328] ii. Synthetic TIEs: Aptamer complexes, modified nucleotides, IRES variants, and other engineered TIEs
[0329] As considered herein, in some embodiments, the translation initiation element (TIE) includes a synthetic TIE. In some embodiments, the synthetic TIE comprises an aptamer complex, a synthetic IRES, or other engineered TIE capable of initiating the translation of linear or circular RNA polynucleotides.
[0330] In some embodiments, one or more aptamer sequences are capable of binding to components of eukaryotic initiation factors to enhance or initiate translation. In some embodiments, the aptamer can be used to enhance in vivo and in vitro translation by promoting specific eukaryotic initiation factors (eIFs) (e.g., the aptamer in WO 2019 / 081383A1 is capable of binding eukaryotic initiation factor 4F (eIF4F)). In some embodiments, the aptamer or aptamer complex may be capable of binding to EIF4G, EIF4E, EIF4A, EIF4B, EIF3, EIF2, EIF5, EIF1, EIF1A, 40S ribosome, PCBP1 (polyC-binding protein), PCBP2, PCBP3, PCBP4, PABP1 (polyA-binding protein), PTB, the Argonaute protein family, HNRNPK (nuclear heterogeneous ribonucleoprotein K), or La protein.
[0331] iii. TIE Common Sequence
[0332] In some embodiments, the TIE disclosed herein comprises naturally occurring and / or synthetic sequences and includes an IRES concordant sequence. In some embodiments, the TIE comprises a concordant sequence as shown in the exemplary concordant sequence list below, where N is any nucleotide (e.g., according to IUPAC). In some embodiments, the TIE comprises at least 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 600 nucleotides, or at least 700 nucleotides (e.g., continuous nucleotides) of the concordant sequence.
[0333] Example public sequence list (Table A)
[0334]
[0335]
[0336]
[0337]
[0338]
[0339]
[0340]
[0341]
[0342]
[0343]
[0344]
[0345]
[0346] c. Termination sequence
[0347] In some embodiments, the core functional element includes a termination sequence. In some embodiments, the termination sequence includes a stop codon. In one embodiment, the termination sequence includes a termination box. In some embodiments, the termination box includes at least two stop codons. In some embodiments, the termination box includes frames of at least two stop codons. In the same embodiment, each frame of the stop codons in the termination box includes one, two, or more stop codons. In some embodiments, the termination box includes a LoxP or RoxStopRox, or a frt-flanked termination box. In the same embodiment, the termination box includes a lox-stop-lox termination box.
[0348] C. variants
[0349] In some embodiments, the provided polynucleotide (e.g., DNA template, precursor RNA polynucleotide, or cyclic RNA polynucleotide) comprises modified nucleotides and / or modified nucleosides. In some embodiments, the modified nucleosides are m 5 C(5-methylcytidine). In another embodiment, the modified nucleoside is m 5 U(5-methyluridine). In another embodiment, the modified nucleoside is m 6 A(N 6 -methyladenosine). In another embodiment, the modified nucleoside is S... 2 U(2-thiouridine). In another embodiment, the modified nucleoside is Ψ(pseudouridine). In another embodiment, the modified nucleoside is Um(2′-O-methyluridine). In other embodiments, the modified nucleoside is m. 1 A(1-methyladenosine); m 2 A (2-methyladenosine); Am (2′-O-methyladenosine); ms 2 m 6 A(2-methylthio-N) 6 -methyladenosine); i 6 A(N 6 -Isopentene adenosine); ms 2 i6A (2-methylthio-N) 6 Isoprene adenosine; io 6 A (N 6 -(cis-hydroxyisopentene)adenosine); ms 2 io 6 A(2-methylthio-N) 6 -(cis-hydroxyisopentene)adenosine); g 6 A(N 6 -glycylcarbamoyladenosine); t 6 A(N 6 -Threonylcarbamoyladenosine); ms 2 t 6 A(2-methylthio-N) 6 -Threonylcarbamoyladenosine); m 6 t 6 A(N 6 -Methyl-N 6 -Threonylcarbamoyladenosine); hn 6 A(N 6 -hydroxyn-valinecarbamoyladenosine); ms 2 hn 6 A(2-methylthio-N)6 -hydroxyvaline carbamoyl adenosine); Ar(p)(2'-O-riboadenosine (phosphate)); I(inosine); m 1 I(1-methylinosine); m 1 Im(1,2'-O-dimethylinosine); m 3 C(3-methylcytidine); Cm(2'-O-methylcytidine); s 2 C(2-thiocytidine); ac 4 C(N 4 -Acetylcytidine); f 5 C(5-formylcytidine); m 5 Cm(5,2′-O-dimethylcytidine); ac 4 Cm(N 4 -acetyl-2'-O-methylcytidine); k 2 C (Racine); m 1 G(1-methylguanosine); m 2 G(N 2 -methylguanosine); m 7 G(7-methylguanosine); Gm(2′-O-methylguanosine); m 2 2G(N 2 N 2 -dimethylguanosine); m 2 Gm(N 2 ,2'-O-dimethylguanosine); m 2 2Gm(N 2 N 2 ,2'-O-trimethylguanosine); Gr(p)(2'-O-riboguanosine (phosphate)); yW (huaitin); o2yW (peroxyhuaitin); OHyW (hydroxyhuaitin); OHyW* (undermodified hydroxyhuaitin); imG (huaoside); mimG (methylhuaoside); Q (pigmentin); oQ (epoxypigmentin); galQ (galactosylpigmentin); manQ (mannosylpigmentin); preQ0 (7-cyano-7-deazoguanosine); preQ1 (7-aminomethyl-7-deazoguanosine); G + (Ancient purine); D (dihydrouridine); m 5 Um(5,2'-O-dimethyluridine); s 4 U(4-thiouridine); m 5 s 2 U(5-methyl-2-thiouridine); s 2 Um (2-thio-2'-O-methyluridine); acp 3 U(3-(3-amino-3-carboxypropyl)uridine); ho 5 U(5-hydroxyuridine); mo 5U(5-methoxyuridine); cmo 5 U (uridine 5-oxyacetic acid); mcmo 5 U (uridine 5-oxyacetic acid methyl ester); chm 5 U(5-(carboxyhydroxymethyl)uridine)); mchm 5 U(5-(carboxyhydroxymethyl)uridine methyl ester); mcm 5 U(5-methoxycarbonylmethyluridine); mcm 5 Um(5-methoxycarbonylmethyl-2'-O-methyluridine); mcm 5 s 2 U(5-methoxycarbonylmethyl-2-thiouridine); nm 5 S 2 U(5-aminomethyl-2-thiouridine); mnm 5 U(5-methylaminomethyluridine); mnm 5 s 2 U(5-methylaminomethyl-2-thiouridine); mnm 5 se 2 U(5-methylaminomethyl-2-selenoside); ncm 5 U(5-carbamoylmethyluridine); ncm 5 Um(5-carbamoylmethyl-2′-O-methyluridine); cmnm 5 U(5-carboxymethylaminomethyluridine); cmnm 5 Um(5-carboxymethylaminomethyl-2′-O-methyluridine); cmnm 5 s 2 U(5-carboxymethylaminomethyl-2-thiouridine); m 6 2A(N 6 N 6 -dimethyladenosine); Im(2'-O-methylinosine); m 4 C(N 4 -methylcytidine); m 4 Cm(N 4 ,2'-O-dimethylcytidine); hm 5 C(5-hydroxymethylcytidine); m 3 U(3-methyluridine); cm 5 U(5-carboxymethyluridine); m 6 Am(N 6 ,2'-O-dimethyladenosine); m 6 2Am(N 6 N 6 (,O-2'-trimethyladenosine); m 2,7 G(N 2 ,7-Dimethylguanosine); m 2,2,7 G(N2 N 2 ,7-Trimethylguanosine); m 3 Um(3,2'-O-dimethyluridine); m 5 D(5-methyldihydrouridine); f 5 Cm(5-formyl-2'-O-methylcytidine); m 1 Gm(1,2'-O-dimethylguanosine); m 1 Am(1,2'-O-dimethyladenosine); τm 5 U(5-Taurine methyluridine); τm 5 s 2 U (5-Tauratemethyl-2-thiouridine); imG-14 (4-Demethylwyoside); imG2 (Isowyoside); or ac 6 A(N 6 - Acetyladenosine.
[0350] In some embodiments, the modified nucleoside may include compounds selected from the group consisting of: pyridine-4-ketoribonucleotide, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyluridine, 1-carboxymethyl-pseudouridine, 5-propynyluridine, 1-propynyl-pseudouridine, 5-taurylmethyluridine, 1-taurylmethyl-2-thiouridine, 1-taurylmethyl-4-thiouridine, 5-methyluridine, 1-methyl-pseudouridine, 4-thio-1-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deoxyuridine Nitrogen-pseudouridine, 2-thio-1-methyl-1-denitro-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, 5-aza-cytidine, pseudoisocytidine, 3-methylcytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methylcytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-denitro-pseudoisocytidine, 1 -Methyl-1-denitro-pseudoisocytidine, zabrain, 5-aza-zabrain, 5-methyl-zabrain, 5-aza-2-thio-zabrain, 2-thio-zabrain, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, 2-aminopurine, 2,6-diaminopurine, 7-denitro-adenine, 7-denitro-8-aza-adenine, 7-denitro-2-aminopurine, 7-denitro-8-aza-2-aminopurine, 7-denitro-2,6-diaminopurine, 7-denitro-8-aza-2,6-diaminopurine, 1-methyladenosine, N6-methyladenosine, N6-isopentene adenosine, N6-(cis-hydroxy) (Isopentene) adenosine, 2-methylthio-N6-(cis-hydroxyisopentene) adenosine, N6-glycylcarbamoyl adenosine, N6-threonylcarbamoyl adenosine, 2-methylthio-N6-threonylcarbamoyl adenosine, N6,N6-dimethyl adenosine, 7-methyladenine, 2-methylthio-adenine, 2-methoxy-adenine, inosine, 1-methyl-inosine, woyoside, woyoside, 7-deazo-guanosine, 7-deazo-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deazo-guanosine, 6-thio-7-deazo-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1-methylguanosine, N2-methylguanosine, N2,N2-Dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2,N2-dimethyl-6-thio-guanosine. In another embodiment, the modification is independently selected from the group consisting of 5-methylcytosine, pseudouridine, and 1-methylpseudouridine.
[0351] In some embodiments, the modified ribonucleosides include 5-methylcytidine, 5-methoxyuridine, 1-methyl-pseuuridine, N6-methyladenosine, and / or pseudouridine. In some embodiments, such modified ribonucleosides provide additional stability and resistance to immune activation.
[0352] In specific implementations, the polynucleotide may be codon-optimized. A codon-optimized sequence may be a sequence in which codons in a polynucleotide encoding a polypeptide have been substituted to increase the expression, stability, and / or activity of the polypeptide. Factors influencing codon optimization include, but are not limited to, one or more of the following: (i) changes in codon bias between two or more organisms or genes or between bias tables constructed synthetically; (ii) changes in the degree of codon bias within an organism, gene, or genome; (iii) systematic changes in codons including context; (iv) codon changes based on its decoding of tRNA; (v) codon changes based on the GC% of a position in the whole or a triplet; (vi) changes in the degree of similarity to a reference sequence (e.g., a naturally occurring sequence); (vii) changes in codon frequency cutoff values; (viii) structural characteristics of mRNA transcribed from a DNA sequence; (ix) prior knowledge of the function of the DNA sequence on which the design of the codon substitution set is based; and / or (x) systematic changes in the codon set for each amino acid. In some implementations, codon-optimized polynucleotides can minimize ribozyme collisions and / or limit structural interference between the expressed sequence and core functional elements.
[0353] 3. Payload
[0354] In some embodiments, the expressed sequence encodes a therapeutic protein. In some embodiments, the therapeutic protein is selected from the proteins listed in Table 1.
[0355] Table 1: Payload
[0356]
[0357]
[0358]
[0359]
[0360]
[0361]
[0362]
[0363]
[0364]
[0365] In some embodiments, a sequence encoding a therapeutic protein is expressed. In some embodiments, a sequence encoding a cytokine is expressed, such as IL-12p70, IL-15, IL-2, IL-18, IL-21, IFN-α, IFN-β, IL-10, TGF-β, IL-4, or IL-35, or a functional fragment thereof. In some embodiments, a sequence encoding an immune checkpoint inhibitor is expressed. In some embodiments, a sequence encoding an agonist (e.g., a member of the TNFR family, such as CD137L, OX40L, ICOSL, LIGHT, or CD70) is expressed. In some embodiments, a sequence encoding a chimeric antigen receptor is expressed. In some embodiments, a sequence encoding an inhibitory receptor agonist (e.g., PDL1, PDL2, galactolectin-9, VISTA, B7H4, or MHCII) or an inhibitory receptor (e.g., PD1, CTLA4, TIGIT, LAG3, or TIM3) is expressed. In some embodiments, a sequence encoding an inhibitory receptor antagonist is expressed. In some embodiments, the expressed sequence encodes one or more TCR chains (α and β chains or γ and δ chains). In some embodiments, the expressed sequence encodes a secretory T cell or immune cell adaptor (e.g., a bispecific antibody, such as BiTE, targeting, for example, CD3, CD137, or CD28, and a tumor-expressed protein, such as CD19, CD20, or BCMA). In some embodiments, the expressed sequence encodes a transcription factor (e.g., FOXP3, HELIOS, TOX1, or TOX2). In some embodiments, the expressed sequence encodes an immunosuppressive enzyme (e.g., IDO or CD39 / CD73). In some embodiments, the expressed sequence encodes GvHD (e.g., an anti-HLA-A2 CAR-Treg).
[0366] In some embodiments, the therapeutic protein is an antigen-binding protein, including but not limited to antibodies or antigen-binding fragments thereof. The antigen-binding proteins disclosed herein may be monoclonal or polyclonal. In some embodiments, the antigen-binding protein is monoclonal. In some embodiments, the antigen-binding protein is polyclonal. In a specific embodiment, the antigen-binding protein disclosed herein is a human antibody.
[0367] In some embodiments, the antibody is a complete immunoglobulin molecule, such as a human antibody, and those portions of a humanized Ig molecule containing an antigen-binding site (i.e., a complementary site) or a single heavy chain and a single light chain, including those portions known in the art, such as Fab, Fab', F(ab)', F(ab')2, Fd, scFv, variable heavy chain domain, variable light chain domain, variable NAR domain, single-chain binding peptide, dAb fragment, nanobody, VHH, and other portions also referred to as antigen-binding fragments. When constructing a polynucleotide encoding an immunoglobulin molecule or a fragment thereof, in some embodiments, the polynucleotide encoding a variable region or a portion thereof is linked or otherwise conjugated with a polynucleotide encoding one or more constant regions or portions thereof to produce any of the antibodies or fragments thereof described herein. Therefore, in some embodiments, the antigen-binding fragment of any of the above-described antibodies is Fab, Fab', F(ab)', F(ab')2, Fd, scFv, a variable heavy chain domain, a variable light chain domain, a variable NAR domain, a dAb fragment, a nanobody, VHH, a single-chain binding peptide (e.g., scFv having an Fc moiety), or any other functional fragment thereof as described herein.
[0368] In some embodiments, the antibody belongs to any immunoglobulin class, and therefore, in some embodiments, it has γ, μ, α, δ, or ε heavy chains. In some embodiments, the γ chain is γ1, γ2, γ3, or γ4. In some embodiments, the α chain is α1 or α2.
[0369] In some embodiments, the antibody disclosed herein is IgA immunoglobulin. In some embodiments, the antibody disclosed herein belongs to any IgA subclass. In some embodiments, the antibody is IgA1. In some embodiments, the antibody is IgA2. In some embodiments, the antibody disclosed herein is IgD immunoglobulin. In some embodiments, the antibody disclosed herein is IgE immunoglobulin. In some embodiments, the antibody disclosed herein is IgG immunoglobulin. In some embodiments, the antibody disclosed herein is any IgG subclass. In some embodiments, the antibody is IgG1. In some embodiments, the antibody is IgG2. In some embodiments, the antibody is IgG3. In some embodiments, the antibody is IgG4. In some embodiments, the antibody disclosed herein is IgM immunoglobulin.
[0370] In some embodiments, the antigen-binding protein of this disclosure comprises a variable light chain of κ or λ. In some embodiments, the λ chain is any subtype, including, for example, λ1, λ2, λ3, and λ4. In some embodiments, the light chain is κ.
[0371] In some embodiments, the antigen-binding protein of this disclosure is single-specific. An exemplary single-specific antigen-binding protein binds to an epitope of a single antigen.
[0372] In some embodiments, the antigen-binding protein of this disclosure is bispecific or multispecific (e.g., trispecific). A bispecific antigen-binding protein has binding specificity to at least two different epitopes. In some embodiments, an exemplary bispecific antigen-binding protein binds to two different epitopes of a single antigen. In some embodiments, other such antigen-binding proteins combine a first antigen binding site with a second antigen binding site. In some embodiments, a bispecific antigen-binding protein binds to at least two different epitopes.
[0373] In some embodiments, the antigen-binding protein of this disclosure has two or more valences, also referred to as multivalent. In some embodiments, the antigen-binding protein of this disclosure is trispecific. In some embodiments, the antigen-binding protein of this disclosure is a multivalent antibody or fragment thereof (e.g., a tetravalent antibody) having three or more antigen-binding sites. In some embodiments, the multivalent antigen-binding protein comprises a dimerizing domain and three or more antigen-binding sites. In some embodiments, the dimerizing domain comprises an Fc region or a hinge region (or is composed of therewith). In this scenario, the antigen-binding protein will comprise an Fc region and three or more antigen-binding sites at the N-terminus of the Fc region. In some embodiments, the multivalent antigen-binding protein of this document comprises about three to about eight, but preferably four, antigen-binding sites. The multivalent antigen-binding protein comprises at least one polypeptide chain (and preferably two polypeptide chains), wherein the polypeptide chain comprises two or more variable regions. For example, the polypeptide chain comprises VD1-(X1). n -VD2-(X2) n -Fc, where VD1 is the first variable region, VD2 is the second variable region, Fc is a polypeptide chain of the Fc region, X1 and X2 represent amino acids or polypeptides, and n is 0 or 1. In some embodiments, the polypeptide chains each independently contain: V H -C H 1-Flexible Joint-V H -C H 1-Fc chain; or V H -C H 1-V H -C H1-Fc region chain. In some embodiments, the multivalent antigen-binding protein described herein further comprises at least two (and preferably four) light chain variable region polypeptides. In some embodiments, the multivalent antigen-binding protein described herein comprises about two to about eight light chain variable region polypeptides. In some embodiments, the light chain variable region polypeptides described herein comprise light chain variable regions. In some embodiments, the light chain variable region polypeptides described herein further comprise C L Structural domain.
[0374] In some embodiments, the antigen-binding protein of this disclosure is a SMIP or binding domain immunoglobulin fusion protein specific to a target protein. These constructs are single-chain polypeptides containing an antigen-binding domain fused to an immunoglobulin domain necessary for performing antibody effector functions.
[0375] In some embodiments, the antigen-binding protein of this disclosure comprises a single-chain binding polypeptide having a heavy chain variable region and / or a light chain variable region of an immunoglobulin Fc region that binds to the epitopes disclosed herein. Such a molecule is a single-chain variable fragment (scFv) that optionally has effector function or an increased half-life by the presence of an immunoglobulin Fc region.
[0376] As described above, this disclosure also provides antibody fragments. In some cases, using antibody fragments instead of whole antibodies has advantages. For example, the smaller size of the fragment allows for rapid clearance and results in improved entry into certain tissues, such as organs (e.g., lungs, kidneys, liver, or heart). Examples of antibody fragments include: Fab, F(ab'), F(ab')2, and Fv fragments, biantibodies, linear antibodies, single-chain antibodies, and multispecific antibodies formed from antibody fragments.
[0377] The chosen antigen-binding protein can be a single-chain Fv fragment (scFv). Fv and sFv are the only types with complete binding sites but lacking constant regions. Therefore, they are suitable for reducing nonspecific binding during in vivo use. sFv fusion proteins can be constructed to produce a fusion of effector protein at the amino or carboxyl terminus of the sFv. The antigen-binding protein fragment can also be a “linear antibody.” In some embodiments, such linear antibody fragments are monospecific or bispecific.
[0378] In some embodiments, the polynucleotide encodes a protein composed of subunits encoded by more than one gene. For example, the protein may be a heterodimer, wherein each chain or subunit of the protein is encoded by a separate gene. It is possible to deliver more than one circRNA molecule in a transfer medium, and each circRNA encodes a separate subunit of the protein. Alternatively, a single circRNA may be engineered to encode more than one subunit. In some embodiments, separate circRNA molecules encoding individual subunits may be administered in separate transfer media.
[0379] A. antigen recognition receptor
[0380] a. Chimeric antigen receptor (CAR)
[0381] In some embodiments, the provided RNA polynucleotide encodes one or more chimeric antigen receptors (CARs or CAR-Ts). CARs are genetically engineered receptors. These engineered receptors can be inserted into and expressed by immune cells (including T cells) via circular RNA as described herein. Using CARs, a single receptor can be programmed to recognize a specific antigen and, upon binding to that antigen, activate immune cells to attack and destroy cells carrying that antigen. When these antigens are present on tumor cells, CAR-expressing immune cells can target and kill tumor cells. In some embodiments, the CAR encoded by the polynucleotide comprises (i) an antigen-binding molecule that specifically binds to the target antigen, (ii) a hinge domain, a transmembrane domain, and an intracellular domain, and (iii) an activation domain.
[0382] In some embodiments, the orientation of the CAR according to this disclosure includes an antigen-binding domain (such as scFv) in tandem with a co-stimulatory domain and an activation domain. The co-stimulatory domain may include one or more of an extracellular portion, a transmembrane portion, and an intracellular portion. In other embodiments, multiple co-stimulatory domains may be used in tandem.
[0383] i. Antigen-binding domain
[0384] CARs can be engineered to bind antigens (such as cell surface antigens) by incorporating antigen-binding molecules that interact with the target antigen. In some embodiments, the antigen-binding molecule is its antibody fragment, such as one or more single-chain antibody fragments (scFvs). scFvs are single-chain antibody fragments having variable regions of the heavy and light chains of an antibody linked together. See U.S. Patents 7,741,465 and 6,319,494 and Eshhar et al., Cancer Immunol Immunotherapy (1997) 45:131-136. scFvs retain the ability of the parent antibody to specifically interact with the target antigen. scFvs can be used in chimeric antigen receptors because they can be engineered to be expressed as part of a single chain along with other CAR components. See also Krause et al., J. Exp. Med., Vol. 188, No. 4, 1998 (619-626); Finney et al., Journal of Immunology, 1998, 161:2791-2797. It should be understood that antigen-binding molecules are typically contained within the extracellular portion of a CAR, enabling it to recognize and bind to antigens of interest. Bispecific and multispecific CARs are considered within the scope of this invention, possessing specificity for more than one target of interest.
[0385] In some embodiments, the antigen-binding molecule comprises a single chain, wherein the heavy chain variable region and the light chain variable region are linked by a linker. In some embodiments, VH is located at the N-terminus of the linker, and VL is located at the C-terminus of the linker. In other embodiments, VL is located at the N-terminus of the linker, and VH is located at the C-terminus of the linker. In some embodiments, the linker comprises at least about 5, at least about 8, at least about 10, at least about 13, at least about 15, at least about 18, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, or at least about 100 amino acids.
[0386] In some embodiments, the antigen-binding molecule includes a nanobody. In some embodiments, the antigen-binding molecule includes DARPin. In some embodiments, the antigen-binding molecule comprises anticline or other synthetic protein capable of specifically binding to the target protein.
[0387] In some implementations, the CAR includes an antigen-binding domain specific to antigens selected from the group consisting of: CD19, CD123, CD22, CD30, CD171, CS-1, C-type lectin-like molecule-1, CD33, epidermal growth factor receptor variant III (EGFRvIII), ganglioside G2 (GD2), ganglioside GD3, TNF receptor family member B cell maturation (BCMA), and Tn antigen ((Tn) (Ag) or (GaINAca-Ser / Thr)), prostate-specific membrane antigen (PSMA), receptor tyrosine kinase-like orphan receptor 1 (ROR1), Fms-like tyrosine kinase 3 (FLT3), tumor-associated glycoprotein 72 (TAG72), CD38, CD44v6, carcinoembryonic antigen (CEA), epithelial cell adhesion molecule (EPCAM), B7H3 (CD276), KIT (CD117), interleukin-13 receptor subunit α-2, mesothelin, interleukin-11 receptor α (IL-11Ra), prostate stem cell antigen (P SCA), protease serine 21, vascular endothelial growth factor receptor 2 (VEGFR2), Lewis (Y) antigen, CD24, platelet-derived growth factor receptor β (PDGFR-β), stage-specific embryonic antigen-4 (SSEA-4), CD20, folate receptor α, HER2, HER3, cell surface-associated mucin 1 (MUC1), epidermal growth factor receptor (EGFR), neural cell adhesion molecule (NCAM), prostate enzymes, prostate acid phosphatase (PAP), mutated elongation factor 2 (ELF2M), Ephrin B2, fibroblast activation protein α (FAP), insulin-like growth factor 1 receptor (IGF-I receptor), carbonic anhydrase IX (CAIX), proteasome (Macropain) subunit β-type 9 (LMP2), glycoprotein 100 (gp100), oncogene fusion protein (bcr-abl) composed of breakpoint cluster region (BCR) and Abelson murine leukemia virus oncogene homolog 1 (Abl), tyrosinase, ephrin type A receptor 2 (EphA2), fucose GM1, sialic acid Lewis adhesion molecule (sLe), ganglioside GM3, transglutaminase 5 (TGS5), high molecular weight melanoma-associated antigen (HMWMAA), o-acetyl GD2 ganglioside (OAcGD2), folate receptor β, tumor endothelial marker 1 (TEM1 / CD248), tumor endothelial marker 7 associated with (TEM7R), claudin6 (CLDN6), thyroid-stimulating hormone receptor (TSHR), G protein-coupled receptor class C group 5 member D (GPRC5D), chromosome X open reading frame 61 (CXORF61), CD97, CD179a, anaplastic lymphoma kinase (ALK), placental specific polysialic acid 1 (PLAC1), the hexose moiety of globoH glycoceramide (GloboH), breast differentiation antigen (NY-BR-1), uroplakin 2 (UPK2), hepatitis A virus cell receptor 1 (HAVCR1), adrenaline receptor β3 (ADRB3), pan-connector 3 (PANX3), G protein-coupled receptor 20 (GPR20), lymphocyte antigen 6 complex locus K 9 (LY6K), olfactory receptor 51E2 (OR51E2), TCRγ alternating reading frame protein (TARP), nephroblastoma protein (WT1), cancer / testis antigen 1 (NY-ESO-1), cancer / testis antigen 2 (LAGE-1a), MAGE family members (including MAGE-A1, MAGE-A3, and MAGE-A4), ETS translocation variant gene 6 located on chromosome 12p (ETV6-AML), spermin 17 (SPA17), X antigen family member 1A (XAGE1), angiopoietin-binding cell surface receptor 2 (Tie 2) Melanoma cancer testis antigen-1 (MAD-CT-1), melanoma cancer testis antigen-2 (MAD-CT-2), Fos-associated antigen 1, tumor protein p53 (p53), p53 mutant, prostein, susceptin, telomerase, prostate cancer tumor antigen-1, melanoma antigen 1 recognized by T cells, rat sarcoma (Ras) mutant, human telomerase reverse transcriptase (hTERT), sarcoma translocation breakpoint, melanoma inhibitor of apoptosis (ML-IAP), ERG (transmembrane protease, serine 2 (TMPRSS2) ETS fusion gene), N-acetylglucosamine transferase V (NA17), pairing box protein Pax-3 (PAX3), androgen receptor, cyclin B1, v-myc avian myeloma virus oncogene neuroblastoma-derived homolog (MYCN), Ras homolog family member C (RhoC), tyrosinase-associated protein 2 (TRP-2), cytochrome P450CYP1B1, CCCTC-binding factor (zinc finger protein)-like squamous cell carcinoma antigen 3 (SART3) recognized by T cells, pairing box protein Pax-5 (PAX5), proacrosin-binding protein sp32 (OY-TES1), lymphocyte-specific protein tyrosine kinase (LCK), A kinase anchoring protein 4 (AKAP-4), synovial sarcoma X breakpoint 2 (SSX2), receptor for advanced glycation end products (RAGE-1), renal universal protein 1 (RU1), renal universal protein 2 (RU2), legumain, human papillomavirus E6 (HPV E6), human papillomavirus E7 (HPV E7), intestinal carboxylesterase, mutant heat shock protein 70-2 (mut HSP70-2), CD79a, CD79b, CD72, leukocyte-associated immunoglobulin-like receptor 1 (LAIR1), Fc fragment of IgA receptor (FCAR or CD89), leukocyte immunoglobulin-like receptor subfamily A member 2 (LILRA2), CD300 molecular-like family member f (CD300LF), C-type lectin domain family 12 member A (CLEC12A), bone marrow stromal cell antigen 2 (BST2), mucin-like hormone receptor-like 2 containing EGF-like modules (EMR2), lymphocyte antigen 75 (LY75), phosphatidylinositol proteoglycan-3 (GPC3), Fc receptor-like 5 (FCRL5), MUC16, 5T4, 8H9, αvβθ integrin, αvβ6 integrin, alpha-fetoprotein (AFP), B7-H6, CA-125, CA9, CD44. CD44v7 / 8, CD52, E-cadherin, EMA (epithelial membrane antigen), epithelial glycoprotein-2 (EGP-2), epithelial glycoprotein-40 (EGP-40), ErbB4, epithelial tumor antigen (ETA), folate-binding protein (FBP), kinase insertion domain receptor (KDR), κ-light chain, L1 cell adhesion molecule, MUC18, NKG2D, carcinoembryonic antigen (h5T4), tumor / testis antigen 1B, GAGE, GAGE-1, BAGE, SCP-1, CTZ9, SAGE, CAGE, CT10, MART-1, immunoglobulin λ-like polypeptide 1 (IGLL1), hepatitis B surface antigen-binding protein (HBsAg), viral capsid antigen (VCA), early antigen (EA), EBV nuclear antigen (EBNA), HHV-6p41 early antigen, HHV-6B U94 latent antigen, HHV-6BThe antigens include p98 late antigen, cytomegalovirus (CMV) antigen, large T antigen, small T antigen, adenovirus antigen, respiratory syncytial virus (RSV) antigen, hemagglutinin (HA), neuraminidase (NA), parainfluenza type 1 antigen, parainfluenza type 2 antigen, parainfluenza type 3 antigen, parainfluenza type 4 antigen, human metapneumovirus (HMPV) antigen, hepatitis C virus (HCV) core antigen, HIV p24 antigen, human T-lymphovirus (HTLV-1) antigen, Merkel cell polyomavirus small T antigen, Merkel cell polyomavirus large T antigen, Kaposi's sarcoma-associated herpesvirus (KSHV) lysing nuclear antigen, and KSHV latent nuclear antigen. In some embodiments, the antigen-binding domain comprises an amino acid sequence selected from SEQ ID NO:3162-3176.
[0388] ii. Hinge / Gap Zone Structural Domain
[0389] In some embodiments, the CAR of this disclosure comprises a hinge or spacer region domain. In some embodiments, the hinge / spacer region domain may comprise a truncated hinge / spacer region domain (THD), which is a truncated form of the complete hinge / spacer region domain (“CHD”). In some embodiments, the extracellular domain is derived from or originates from (e.g., comprising all or fragments thereof) ErbB2, blood group glycoprotein A (GpA), CD2, CD3δ, CD3ε, CD3γ, CD4, CD7, CD8a, CD8[T CD1a (IT GAL), CD1b (IT GAM), CD1lc (IT GAX), CD1ld (IT GAL), CD1ld (IT GAL), CD11l (IT GAM), CD11l (IT GAX ...GAD), CD18(ITGB2), CD19(B4), CD27(TNFRSF7), CD28, CD28T, CD29(ITGB1), CD30(TNFRSF8), CD40(TNFRSF5), CD48 (SLAMF2), CD49a(ITGA1), CD49d(ITGA4), CD49f(ITGA6), CD66a(CEACAM1), CD66b(CEACAM8), CD66c(CEACAM6), CD6 6d (CEACAM3), CD66e (CEACAM5), CD69 (CLEC2), CD79A (B cell antigen receptor complex-associated α chain), CD79B (B cell antigen receptor complex-associated β chain), CD84 (SLAMF5), CD96 (Tactile), CD100 (SEMA4D), CD103 (ITGAE), CD134 (OX40), CD137 (4-1BB), CD150 (SLAMF1), CD158A (KIR2DL1) , CD158B1(KIR2DL2), CD158B2(KIR2DL3), CD158C(KIR3DP1), CD158D(KIRDL4), CD158F1(KIR2DL5A), CD158F2(KIR 2DL5B), CD158K (KIR3DL2), CD160 (BY55), CD162 (SELPLG), CD226 (DNAM1), CD229 (SLAMF3), CD244 (SLAMF4), CD247 ( CD3-ζ), CD258(LIGHT), CD268(BAFFR), CD270(TNFSF14), CD272(BTLA), CD276(B7-H3), CD279(PD-1), CD314(NKG2 D), CD319(SLAMF7), CD335(NK-p46), CD336(NK-p44), CD337(NK-p30), CD352(SLAMF6), CD353(SLAMF8), CD355(CRT AM), CD357 (TNFRSF18), inducible T cell co-stimulatory molecules (ICOS), LFA-1 (CD11a / CD18), NKG2C, DAP-10, ICAM-1, NKp80 (KLRF1), IL-2Rβ, IL-2Rγ, IL-7Rα, LFA-1, SLAMF9, LAT, GADS (GrpL), SLP-76 (LCP2), PAG1 / CBP, CD83 ligand, Fcγ receptor, MHC class 1 molecules, MHCClass 2 molecules, TNF receptor proteins, immunoglobulin proteins, cytokine receptors, integrins, activated NK cell receptors, Toll ligand receptors, and fragments or combinations thereof. Hinge or spacer domains may be of natural or synthetic origin.
[0390] In some embodiments, the hinge or spacer region domain is located between the antigen-binding molecule (e.g., scFv) and the transmembrane domain. In this orientation, the hinge / spacer region domain provides the distance between the antigen-binding molecule and the cell membrane surface on which the CAR is expressed. In some embodiments, the hinge or spacer region domain is derived from or originates from immunoglobulins. In some embodiments, the hinge or spacer region domain is selected from the hinge / spacer regions of IgG1, IgG2, IgG3, IgG4, IgA, IgD, IgE, IgM, or fragments thereof. In some embodiments, the hinge or spacer region domain comprises, is derived from, or originates from the hinge / spacer region of CD8α. In some embodiments, the hinge or spacer region domain comprises, is derived from, or originates from the hinge / spacer region of CD28. In some embodiments, the hinge or spacer region domain comprises a fragment of the hinge / spacer region of CD8α or a fragment of the hinge / spacer region of CD28, wherein the fragment is any fragment smaller than the entire hinge / spacer region. In some embodiments, the fragment of the CD8α hinge / spacer region or the fragment of the CD28 hinge / spacer region comprises an amino acid sequence excluding at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 amino acids at the N-terminus or C-terminus of the CD8 hinge / spacer region or the CD28 hinge / spacer region.
[0391] iii. Transmembrane domain
[0392] The CAR disclosed herein may also include a transmembrane domain and / or an intracellular signaling domain. The transmembrane domain may be designed to fuse with an extracellular domain of the CAR. It may similarly fuse with an intracellular domain of the CAR. In some embodiments, a transmembrane domain naturally associated with one of the domains in the CAR is used. In some cases, the transmembrane domain may be selected or modified (e.g., by amino acid substitution) to prevent such domains from binding to transmembrane domains of the same or different surface membrane proteins, thereby minimizing interactions with other members of the receptor complex. The transmembrane domain may be derived from a natural or synthetic source. In the case of a natural source, the domain may be derived from any membrane-binding or transmembrane protein.
[0393] The transmembrane region may originate from (i.e., contain) receptor tyrosine kinases (e.g., ErbB2), blood group glycoprotein A (GpA), 4-1BB / CD137, activated NK cell receptor, immunoglobulin protein, B7-H3, BAFFR, BFAME (SEAMF8), BTEA, CD100 (SEMA4D), CD103, CD160 (BY55), CD18, CD19, CD19a, CD2, CD247, CD27, CD276 (B7-H3), CD28, CD29, CD3δ, CD3ε, CD3γ, CD30, CD4, CD40, CD49a, CD49D, CD49f, CD69, CD7, CD84, CD8α, CD8β, CD96 (Tactile), CD11a, CD11b, CD11c, CD11d, CDS, CEACAM1, CRT AM, cytokine receptors, DAP-10, DNAM1 (CD226), Fcγ receptor, GADS, GITR, HVEM (EIGHTR), IA4, ICAM-1, ICAM-1, Igα (CD79a), IE-2Rβ, IE-2Rγ, IE-7Rα, inducible T cell co-stimulatory factor (ICOS), integrin, ITGA4, ITGA4, ITGA6, IT GAD, ITGAE, ITGAE, IT GAM, ITGAX, ITGB2, ITGB7, ITGB1, KIRDS2, EAT, LFA-1, LFA-1, ligand specifically binding to CD83, LIGHT, LIGHT, LTBR, Ly9 (CD229), lymphocyte function-associated antigen-1 (LFA-1; CD1-1a / CD18), MHC Class 1 molecules, NKG2C, NKG2D, NKp30, NKp44, NKp46, NKp80 (KLRF1), OX-40, PAG / Cbp, programmed cell death-1 (PD-1), PSGL1, SELPLG (CD162), signal transduction lymphocyte activation molecules (SLAM proteins), SLAM (SLAMF1; CD150; IPO-3), SLAMF4 (CD244; 2B4), SLAMF6 (NTB-A; Lyl08), SLAMF7, SLP-76, TNF receptor proteins, TNFR2, TNFSF14, Toll ligand receptors, TRANCE / RANKL, VLA1 or VLA-6 or fragments, truncations or combinations thereof.
[0394] In some implementations, suitable intracellular signal transduction domains include, but are not limited to, activated macrophage / myeloid cell receptors CSFR1, MYD88, CD14, TIE2, TLR4, CR3, CD64, TREM2, DAP10, DAP12, CD169, DECTIN1, CD206, CD47, CD163, CD36, MARCO, TIM4, MERTK, F4 / 80, CD91, C1QR, LOX-1, CD68, SRA, BAI-1, ABCA7, CD36, CD31, lactoferrin, or fragments, truncated forms, or combinations thereof.
[0395] In some embodiments, the receptor tyrosine kinase may be derived from (e.g., including) the insulin receptor (InsR), insulin-like growth factor I receptor (IGF1R), insulin receptor-associated receptor (IRR), platelet-derived growth factor receptor α (PDGFRa), platelet-derived growth factor receptor β (PDGFRfi). Other possible sources include the KIT proto-oncogene receptor tyrosine kinase (Kit), colony-stimulating factor 1 receptor (CSFR), fms-associated tyrosine kinase 3 (FLT3), fms-associated tyrosine kinase 1 (VEGFR-1), kinase insertion domain receptor (VEGFR-2), fms-associated tyrosine kinase 4 (VEGFR-3), fibroblast growth factor receptor 1 (FGFR1), fibroblast growth factor receptor 2 (FGFR2), fibroblast growth factor receptor 3 (FGFR3), fibroblast growth factor receptor 4 (FGFR4), protein tyrosine kinase 7 (CCK4), and neurotrophic receptors. Tyrosine kinase 1 (trkA), neurotrophic receptor tyrosine kinase 2 (trkB), neurotrophic receptor tyrosine kinase 3 (trkC), receptor tyrosine kinase-like orphan receptor 1 (ROR1), receptor tyrosine kinase-like orphan receptor 2 (ROR2), muscle-associated receptor tyrosine kinase (MuSK), MET proto-oncogene receptor tyrosine kinase (MET), macrophage-stimulating receptor 1 (Ron), AXL receptor tyrosine kinase (AXL), TYR03 protein tyrosine kinase (Tyro3), MER proto-oncogene tyrosine kinase (Mer), and tyrosine kinases with immunoglobulin-like and EGF-like domains. TEK receptor tyrosine kinase 1 (TIE1), TEK receptor tyrosine kinase 2 (TIE2), EPH receptor A1 (EphA1), EPH receptor A2 (EphA2), (EPH receptor A3)EphA3, EPH receptor A4 (EphA4), EPH receptor A5 (EphA5), EPH receptor A6 (EphA6), EPH receptor A7 (EphA7), EPH receptor A8 (EphA8), EPH receptor A10 (EphA10), EPH receptor B1 (EphB1), EPH receptor B2 (EphB2), EPH receptor B3 (EphB3), EPH receptor B4 (EphB4), EPH receptor B6 (EphB6), ret proto-oncogene (ret) receptor-like tyrosine kinase (RYK), discoid domain receptor tyrosine kinase 1 (DDR1), discoid domain receptor tyrosine kinase 2 (DDR2), c-ros oncogene 1 receptor tyrosine kinase (ROS), apoptosis-associated tyrosine kinase (Lmrl), lemur tyrosine kinase 2 (Lmr2), lemur tyrosine kinase 3 (Lmr3), leukocyte receptor tyrosine kinase (LTK), ALK receptor tyrosine kinase (ALK), or serine / threonine / tyrosine kinase 1 (STYK1).
[0396] iv. Co-stimulatory domains
[0397] In some embodiments, the CAR includes a co-stimulatory domain. In some embodiments, the co-stimulatory domain includes 4-1BB (CD137), CD28, or both, and / or an intracellular T cell signaling domain. In a preferred embodiment, the co-stimulatory domain is human CD28, human 4-1BB, or both, and the intracellular T cell signaling domain is human CD3ζ (ζ). 4-1BB, CD28, and CD3ζ may each contain less than a complete 4-1BB, CD28, or CD3ζ. Chimeric antigen receptors may be incorporated into the co-stimulatory (signaling) domain to increase their potency. See U.S. Patent Nos. 7,741,465 and 6,319,494, and Krause et al. and Finney et al. (ibid.), Song et al., Blood 119:696-706 (2012); Kalos et al., SciTransl. Med. 3:95 (2011); Porter et al., N. Engl. J. Med. 365:725-33 (2011), and Gross et al., Amur. Rev. Pharmacol. Toxicol. 56:59-83 (2016).
[0398] v. Intracellular signal transduction domains
[0399] The intracellular (signal transduction) domain of the engineered T cell disclosed herein can provide signal transduction to the activation domain, which then activates at least one of the normal effector functions of the immune cell. For example, the effector functions of the T cell can be cytolytic activity or helper activity, including cytokine secretion.
[0400] In some implementations, suitable intracellular signal transduction domains include (e.g., contain) but are not limited to 4-1BB / CD137, activated NK cell receptor, immunoglobulin, B7-H3, BAFFR, BLAME (SLAMF8), BTLA, CD100 (SEMA4D), CD103, CD160 (BY55), CD18, CD19, CD19a, CD2, CD247, CD27, CD276 (B7-H3), CD28, CD29, CD3δ, CD3ε, CD3γ, CD30, CD4, CD40, CD49a, CD49D, CD49f, CD69, CD7, CD84, CD8α, CD8β, CD96 (Tactile), CD11a, CD11b, CD11c, CD1 1d, CDS, CEACAM1, CRTAM, cytokine receptors, DAP-10, DNAM1 (CD226), fcγ receptor, GADS, GITR, HVEM (LIGHTR), IA4, ICAM-1, Igα (CD79a), IL-2Rβ, IL-2Rγ, IL-7Rα, inducible T cell co-stimulatory factor (ICOS), integrin, ITGA4, ITGA6, ITGAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB2, ITGB7, ITGB1, KIRDS2, LAT, LFA-1, ligands that specifically bind to CD83, LIGHT, LTBR, Ly9 (CD229), Lyl08, lymphocyte function-associated antigen-1 (LFA-1; CD1-1a / CD18), MHC Class 1 molecules, NKG2C, NKG2D, NKp30, NKp44, NKp46, NKp80 (KLRF1), OX-40, PAG / Cbp, programmed cell death-1 (PD-1), PSGL1, SELPLG (CD162), signal transduction lymphocyte activation molecules (SLAM proteins), SLAM (SLAMF1; CD150; IPO-3), SLAMF4 (CD244; 2B4), SLAMF6 (NTB-A), SLAMF7, SLP-76, TNF receptor proteins, TNFR2, TNFSF14, Toll ligand receptor, TRANCE / RANKL, VLA1 or VLA-6, or fragments, truncated forms or combinations thereof.
[0401] CD3 is a component of the T cell receptor on natural T cells and has been shown to be an important intracellular activating element in CARs. In some embodiments, CD3 is CD3ζ. In some embodiments, the activation domain comprises an amino acid sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to the polypeptide sequence selected from SEQ ID NO:3162-3176.
[0402] bT cell receptor (TCR)
[0403] In some implementations, the provided circular RNA polynucleotide encodes a T-cell receptor. The TCR is described using the International Immunogenetics (IMGT) TCR nomenclature and linked to the IMGT public database of TCR sequences. Natural α-β heterodimeric TCRs have an α-chain and a β-chain. Broadly, each chain may contain a variable region, a linker region, and a constant region, and the β-chain typically also contains a short region of diversity between the variable and linker regions, but this region of diversity is generally considered part of the linker region. Each variable region may contain three CDRs (complementarity-determining regions) embedded in the frame sequence, one of which is a hypervariable region called CDR3. Several types of α-chain variable (Vα) regions and several types of β-chain variable (Vβ) regions exist, distinguished by their frame, CDR1 and CDR2 sequences, and a partially determined CDR3 sequence. The Vα type is designated in the IMGT nomenclature by a unique TRAV number. Therefore, “TRAV21” defines the TCRVα region with a unique frame and CDR1 and CDR2 sequences, as well as a CDR3 sequence that is partially defined by amino acid sequences that remain unchanged between TCRs, but also includes amino acid sequences that vary between TCRs. Similarly, “TRBV5-1” defines the TCR Vβ region with a unique frame and CDR1 and CDR2 sequences, but only with a partially defined CDR3 sequence.
[0404] The connection region of the TCR is similarly defined by the unique IMGT TRAJ and TRBJ nomenclatures, and the constant region is defined by the IMGTTRAC and TRBC nomenclatures.
[0405] In the IMGT nomenclature, the β-chain diversity region is referred to by the abbreviation TRBD, and as mentioned above, tandem TRBD / TRBJ regions are usually considered together as connection regions.
[0406] The unique sequences defined by the IMGT nomenclature are widely known and available to those skilled in the art of TCR. For example, they can be found in the IMGT public database. Sequences defined by the IMGT nomenclature are also disclosed in “T cellReceptor Factsbook”, (2001) by LeFranc and LeFranc, Academic Press, ISBN 0-12-441352-8, but due to their publication date and the resulting time lag, the information therein sometimes needs to be confirmed by referring to the IMGT database.
[0407] Natural TCRs exist as heterodimers in the form of αβ or γδ. However, recombinant TCRs composed of αα or ββ homodimers have previously been shown to bind peptide MHC molecules. Therefore, the TCR of the present invention can be a heterodimer αβ TCR or an αα or ββ homodimer TCR.
[0408] For adoption therapy, the αβ heterodimeric TCR can be transfected, for example, as a full-length chain having both cytoplasmic and transmembrane domains. In some embodiments, the TCR of the present invention may have introduced disulfide bonds between residues of the respective constant domains, as described, for example, in WO 2006 / 000830.
[0409] The TCR of the present invention, particularly the α-β heterodimer TCR, may comprise an α-chain TRAC constant domain sequence and / or a β-chain TRBC1 or TRBC2 constant domain sequence. The α and β chain constant domain sequences may be modified by truncation or substitution to eliminate the native disulfide bond between Cys4 of exon 2 of TRAC and Cys2 of exon 2 of TRBC1 or TRBC2. The α and / or β chain constant domain sequences may also be modified by substituting Thr 48 of TRAC and Ser 57 of TRBC1 or TRBC2 with cysteine residues that form a disulfide bond between the α and β constant domains of the TCR.
[0410] Combining affinity (with equilibrium constant K) D The inverse relationship between the affinity of the TCR and the binding half-life (expressed as T1 / 2) can be determined by any appropriate method. It should be understood that the doubling of the affinity of the TCR leads to K... D Halved. T1 / 2 is calculated as ln 2 divided by the dissociation rate (koff). Therefore, doubling T1 / 2 results in koff being halved. K of TCR DKoff values are typically measured for soluble forms of TCRs (i.e., those truncated to remove cytoplasmic and transmembrane domain residues). Therefore, it should be understood that if the soluble form of a TCR possesses the aforementioned characteristics, then a given TCR has improved binding affinity and / or binding half-life to its parental TCR. Preferably, the binding affinity or binding half-life of a given TCR is measured several times using the same assay protocol, e.g., three or more times, and the results are averaged.
[0411] Since the TCR of the present invention can be used for adoptive therapy, the present invention includes non-naturally occurring and / or purified and / or engineered cells, particularly T cells, that present the TCR of the present invention. Many methods are suitable for transfecting T cells with nucleic acids encoding the TCR of the present invention (such as DNA, cDNA, or RNA) (see, for example, Robbins et al., (2008) J Immunol. 180:6116-6131). T cells expressing the TCR of the present invention will be suitable for adoptive therapy-based cancer treatments, such as those for pancreatic and liver cancers. As is known to those skilled in the art, many suitable methods exist by which adoptive therapy can be performed (see, for example, Rosenberg et al., (2008) Nat Rev Cancer 8(4):299-308).
[0412] As is well known in the art, the TCRs of the present invention can be post-translational modified when expressed by transfected cells. Glycosylation is such a modification, which may include the covalent attachment of oligosaccharide moieties to amino acids defined in the TCR chain. For example, asparagine residues or serine / threonine residues are well-known sites for oligosaccharide attachment. The glycosylation state of a particular protein depends on many factors, including protein sequence, protein conformation, and the availability of certain enzymes. Furthermore, the glycosylation state (i.e., oligosaccharide type, covalent bonds, and total number of attachments) can affect protein function. Therefore, controlling glycosylation is generally desirable when producing recombinant proteins. Glycosylation of transfected TCRs can be controlled by mutations in the transfected gene (Kuball J et al. (2009), J Exp Med 206(2):463-475). Such mutations are also covered in this invention.
[0413] TCR can target MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A5, MAGE-A6, MAGE-A7, MAGE-A8, MAGE-A9, MAGE -A10, MAGE-A11, MAGE-A12, MAGE-A13, GAGE-1, GAGE-2, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7, GA GE-8, BAGE-1, RAGE-1, LB33 / MUM-1, PRAME, NAG, MAGE-Xp2 (MAGE-B2), MAGE-Xp3 (MAGE-B3), MAGE-X p4(AGE-B4), tyrosinase, brain glycogen phosphorylase, Melan-A, MAGE-C1, MAGE-C2, NY-ESO-1, LAGE-1, SSX-1, SSX-2 (HOM-MEL -40), SSX-1, SSX-4, SSX-5, SCP-1, CT-7, α-actin-4, Bcr-Abl fusion protein, Casp-8, β-catenin, cdc27, cdk4, cdkn2a, coa-1, dek-can fusion protein, EF2, ETV6-AML1 fusion protein, LDLR-fucosyltransferase AS fusion protein, HLA-A2, HLA-A11, hsp7 0-2, KIAAO205, Mart2, Mum-2 and 3, neo-PAP, type I myosin, OS-9, pml-RARa fusion protein, PTPRK, K-ras, N-ras, triose phosphate isomer, GnTV, Herv-K-mel, Lage-1, Mage-C2, NA-88, Lage-2, SP17, and TRP2-Int2, (MART-I), gp100 (Pmel 17), TRP-1, TRP-2, MAGE-1, MAGE-3, p15(58), CEA, NY-ESO(LAGE), SCP-1, Hom / Mel-40, p53, H-Ras, HER-2 / neu, BCR-ABL, E2A-PRL, H4-RET, IGH-IGK, MYL-RAR, Epstein-Barr virus antigen, EBNA, human papillomavirus (HPV) antigen E6 and E7, TSP-180, MAGE-4, MAGE-5, MAGE-6, p185erbB2, p180erbB-3, c-met, nm-23H1, PSA, TAG-72-4, CA19-9, CA72-4, CAM 17.1. NuMa, K-ras, β-catenin, CDK4, Mum-1, p16, TAGE, PSMA, PSCA, CT7, telomerase, 43-9F, 5T4, 791Tgp72, α-fetoprotein, 13HCG, BCA225, BTAA, CA125, CA 15-3 (CA 27.29\BCAA), CA 195, CA The antigens in 242, CA-50, CAM43, CD68 / KP1, CO-029, FGF-5, G250, Ga733 (EpCAM), HTgp-175, M344, MA-50, MG7-Ag, MOV18, NB / 170K, NY-CO-1, RCAS1, SDCCAG16, TA-90 (Mac-2 binding protein / cyclic protein C-related protein), TAAL6, TAG72, TLP, and TPS are specific.
[0414] cB cell receptor (BCR)
[0415] In some embodiments, the provided circular RNA polynucleotide encodes one or more B cell receptors (BCRs). A BCR (or B cell antigen receptor) is an immunoglobulin molecule that forms a type I transmembrane protein on the surface of a B cell. The BCR is able to transmit activation signals to the B cell upon recognition of a specific antigen. Before the B cell binds to the antigen, the BCR remains in an unstimulated or “resting” phase. The binding of the antigen to the BCR leads to signal transduction that initiates a humoral immune response.
[0416] BCRs are expressed by mature B cells. These B cells, along with immunoglobulins (Ig), play a role in the recognition and labeling of pathogens. A typical BCR contains membrane-bound immunoglobulins (e.g., mIgA, mIgD, mIgE, mIgG, and mIgM), as well as the associated Igα / Igβ (CD79a / CD79b) heterodimer (α / β). These membrane-bound immunoglobulins are tetramers composed of two identical heavy chains and two light chains. Within the BCR, membrane-bound immunoglobulins can respond to antigen binding via transmembrane signaling, leading to B cell activation and consequently clonal expansion and the production of specific antibodies (Friess M et al. (2018), Front. Immunol. 2947(9)). The Igα / Igβ heterodimer is responsible for transducing signals into the cellular interior.
[0417] Igα / Igβ heterodimer signaling depends on the presence of an immunoreceptor tyrosine-based activation motif (ITAM) located at the cytoplasmic tail of each heterodimer. The ITAM consists of two tyrosine residues separated by 9–12 amino acids (e.g., tyrosine, leucine, and / or valine). Upon antigen binding, the tyrosine residues of the BCR's ITAM are phosphorylated by Src family tyrosine kinases Blk, Fyn, or Lyn (Janeway C et al., Immunobiology: The Immune System in Health and Disease (Garland Science, 5th ed., 2001)).
[0418] d. Other chimeric proteins
[0419] In addition to the chimeric proteins described above, circular RNA polynucleotides can encode a wide variety of other chimeric proteins available in the art. Chimeric proteins may include recombinant fusion proteins, chimeric mutant proteins, or other fusion proteins.
[0420] B. Immunomodulatory ligands
[0421] In some embodiments, the circular RNA polynucleotide encodes an immunomodulatory ligand. In some embodiments, the immunomodulatory ligand may be immunostimulatory; while in other embodiments, the immunomodulatory ligand may be immunosuppressive.
[0422] a. Cytokines: interferon, chemokines, interleukins, growth factors, etc.
[0423] In some embodiments, circular RNA polynucleotides encode cytokines. In some embodiments, cytokines include chemokines, interferons, interleukins, lymphokines, and tumor necrosis factor. Chemokines are chemokines produced by various cell types in acute and chronic inflammation, which mobilize and activate leukocytes. Interferons comprise a family of secreted α-helical cytokines induced by stimulation of the TLR in response to specific extracellular molecules (Borden, Molecular Basis of Cancer (4th Edition) 2015). Interleukins are cytokines expressed by leukocytes.
[0424] This article provides descriptions and / or amino acid sequences of IL-2, IL-7, IL-10, IL-12, IL-15, IL-18, IL-27β, IFNγ, and / or TGFβ1, and their accession numbers in the www.uniprot.org database are: P60568 (IL-2), P29459 (IL-12A), P29460 (IL-12B), P13232 (IL-7), P22301 (IL-10), P40933 (IL-15), Q14116 (IL-18), Q14213 (IL-27β), P01579 (IFNγ), and / or P01137 (TGFβ1).
[0425] C. transcription factors
[0426] Regulatory T cells (Tregs) are important in maintaining homeostasis, controlling the magnitude and duration of inflammatory responses, and preventing autoimmune and allergic responses.
[0427] Generally, Tregs are thought to primarily participate in suppressing the immune response, partly acting as a "self-check" mechanism of the immune system to prevent overreaction. In particular, Tregs are involved in maintaining tolerance to self-antigens, harmless agents such as pollen or food, and eliminating autoimmune diseases.
[0428] Treg cells are distributed throughout the body, including but not limited to the intestines, skin, lungs, and liver. Furthermore, Treg cells can also be found in certain compartments of the body that are not directly exposed to the external environment, such as the spleen, lymph nodes, and even adipose tissue. Each of these known or suspected Treg cell populations possesses one or more unique characteristics, and further information can be found in Lehtimaki and Lahesmaa, Regulatory T-cells control immune responses through their non-redundant tissue specific features, 2013, FRONTIERS IN IMMUNOL., 4(294):1-10, the contents of which are incorporated herein by reference in their entirety.
[0429] Generally, Tregs are known to require TGF-β and IL-2 for proper activation and development. Tregs expressing high levels of the IL-2 receptor (IL-2R) depend on IL-2 produced by activated T cells. Tregs are known to produce both IL-10 and TGF-β, both of which are potent immunosuppressive cytokines. Additionally, Tregs are known to suppress the ability of antigen-presenting cells (APCs) to stimulate T cells. One proposed mechanism of APC suppression is via CTLA-4 expressed by Foxp3+ Tregs. It is thought that CTLA-4 can bind to B7 molecules on APCs and block these molecules or remove them by inducing internalization, resulting in reduced B7 availability and insufficient co-stimulation for the immune response. Further discussion on the origin, differentiation, and function of Tregs can be found in Dhamne et al., Peripheral and thymic Foxp3+regulatory T-cells in search of origin, distinction, and function, 2013, Frontiers in Immunol., 4(253):1-11, the contents of which are incorporated herein by reference in their entirety.
[0430] D. Checkpoint inhibitors and agonists
[0431] As provided herein, in some embodiments, the coding elements of the circular RNA encode one or more checkpoint inhibitors or agonists.
[0432] In some implementations, the immune checkpoint inhibitor is programmed death-ligand 1 (PD-L1, also known as B7-H1, CD274), programmed death 1 (PD-1), CTLA-4, PD-L2 (B7-DC, CD273), LAG3, TIM3, 2B4, A2aR, B7H1, B7H3, B7H4, BTLA, CD2, CD27, CD28, CD30, CD40, CD70, CD80, CD86, CD137, CD160, CD226, CD276, DR3, GAL9, GITR, HAVCR2, HVEM, IDO1, IDO2, ICOS (inducible T cell co-stimulatory molecule), KIR, LAIR1, LIGHT, MARCO (macrophage receptor with collagen structure), PS (phosphatidylserine), OX-40, SLAM, TIGHT, VISTA, VTCN1, or any combination thereof. In some embodiments, the immune checkpoint inhibitor is an inhibitor of IDO1, CTLA4, PD-1, LAG3, PD-L1, TIM3, or a combination thereof. In some embodiments, the immune checkpoint inhibitor is an inhibitor of PD-L1. In some embodiments, the immune checkpoint inhibitor is an inhibitor of PD-1. In some embodiments, the immune checkpoint inhibitor is an inhibitor of CTLA-4. In some embodiments, the immune checkpoint inhibitor is an inhibitor of LAG3. In some embodiments, the immune checkpoint inhibitor is an inhibitor of TIM3. In some embodiments, the immune checkpoint inhibitor is an inhibitor of IDO1.
[0433] As described herein, at least in one aspect, the present invention covers the use of immune checkpoint antagonists. Such immune checkpoint antagonists include antagonists of immune checkpoint molecules, such as cytotoxic T-lymphocyte antigen 4 (CTLA-4), programmed cell death protein 1 (PD-1), programmed death ligand 1 (PDL-1), lymphocyte activation gene 3 (LAG-3), and T-cell immunoglobulin and mucin domain 3 (TIM-3). Antagonists of CTLA-4, PD-1, PDL-1, LAG-3, or TIM-3 interfere with the function of CTLA-4, PD-1, PDL-1, LAG-3, or TIM-3, respectively. Such antagonists of CTLA-4, PD-1, PDL-1, LAG-3, and TIM-3 may comprise antibodies that specifically bind to CTLA-4, PD-1, PDL-1, LAG-3, and TIM-3 and inhibit and / or block their biological activity and function, respectively.
[0434] E. other
[0435] In some embodiments, the payload encoded within one or more of these coding elements is a hormone, FC fusion protein, anticoagulant, coagulation factor, protein associated with defects and genetic diseases, chaperone protein, antimicrobial protein, enzyme (e.g., metabolic enzyme), structural protein (e.g., channel or nucleoporin), protein variant, small molecule, antibody, nanobody, engineered non-somatic antibody, or a combination thereof.
[0436] 4. Other auxiliary components (sequential components)
[0437] As described in this invention, the polynucleotide (e.g., circular RNA polynucleotide, linear RNA polynucleotide, and / or DNA template) may also include auxiliary elements. In some embodiments, these auxiliary elements may be included within the sequence of the circular RNA, linear RNA polynucleotide, and / or DNA template to enhance circularization, translation, or both. In some embodiments, the auxiliary element is a sequence specifically located between or within an enhancing intron element, enhancing exon element, or core functional element of the respective polynucleotide. As an example, but not intended to be limiting, auxiliary elements include IRES trans-acting factor regions, miRNA binding sites, restriction sites, RNA editing regions, structural or sequence elements, particulate sites, zip-coding elements, RNA transport elements, or other specialized sequences found in the art that enhance and promote the circularization and / or translation of proteins encoded within circular RNA polynucleotides.
[0438] A. IRES trans-acting factor
[0439] In some embodiments, the auxiliary element comprises the IRES trans-acting factor (ITAF) region. In some embodiments, the IRES trans-acting factor region regulates translation initiation by binding to PCBP1-PCBP4 (polyC-binding protein), PABP1 (polyA-binding protein), PTB (polypyrimidine bundle binding protein), the Argonaute protein family, HNRNPK (nuclear heterogeneous ribonucleoprotein K protein), or La protein. In some embodiments, the IRES trans-acting factor region comprises polyA, polyC, polyAC, or polypyrimidine orbitals.
[0440] In some implementations, the ITAF area is located within the core functional element. In other implementations, the ITAF area is located within the TIE.
[0441] B. miRNA binding site
[0442] In some embodiments, the auxiliary element comprises a miRNA binding site. In some embodiments, the miRNA binding site is located within a 5' enhancing intron element, a 5' enhancing exon element, a core functional element, a 3' enhancing exon element, and / or a 3' enhancing intron element.
[0443] In some embodiments, the miRNA binding site is located within a spacer region within an enhanced intron element or an enhanced exon element. In some embodiments, the miRNA binding site encompasses the entire spacer region.
[0444] In some embodiments, the 5' enhancing intron element and the 3' enhancing intron element each contain the same miRNA binding site. In another embodiment, the miRNA binding site of the 5' enhancing intron element contains a miRNA binding site that differs in length or nucleotides from that of the 3' enhancing intron element. In one embodiment, the 5' enhancing exon element and the 3' enhancing exon element contain the same miRNA binding site. In other embodiments, the 5' enhancing exon element and the 3' enhancing exon element contain miRNA binding sites that differ in length or nucleotides.
[0445] In some embodiments, miRNA binding sites are located adjacent to each other within circular RNA polynucleotides, linear RNA polynucleotide precursors, and / or DNA templates. In some embodiments, the first nucleotide of one miRNA binding site follows the last nucleotide of the second miRNA binding site.
[0446] In some embodiments, the miRNA binding site is located within the translation initiation element (TIE) of the core functional element. In one embodiment, the miRNA binding site is located before, after, or within the internal ribosome entry site (IRES). In another embodiment, the miRNA binding site is located before, after, or within the aptamer complex.
[0447] Incorporating miRNA sequences within circular RNA molecules allows for tissue-specific expression of coding sequences within core functional elements. For example, in circular RNAs intended to express proteins in immune cells, a miRNA-binding sequence that results in inhibition of expression in tissues such as the liver or kidney may be required. Such miRNA-binding sequences can be selected based on cellular or tissue expression of the miRNA.
[0448] The unique sequences defined by miRNA nomenclature are widely known and available to technicians in the field of microRNA. For example, they can be found in the miRDB public database.
[0449] 5. Production of polynucleotides
[0450] The DNA templates provided in this article can be prepared using standard molecular biology techniques. For example, various elements of the vectors provided in this article can be obtained using recombinant methods, such as by screening cDNA and genomic libraries from cells, or by deriving polynucleotides from DNA templates known to contain polynucleotides.
[0451] The various elements of the DNA templates provided in this article can also be synthesized based on known sequences, rather than cloned. The complete sequence can be assembled from overlapping oligonucleotides prepared by standard methods. See, for example, Edge, Nature (1981) 292:756; Nambair et al., Science (1984) 223:1299; and Jay et al., J. Biol. Chem. (1984) 259:6311.
[0452] Therefore, using various oligonucleotide synthesis techniques known in the art, such as appropriate site-directed mutagenesis and polymerase chain reaction (PCR) techniques, specific nucleotide sequences can be obtained from a DNA template carrying the desired sequence, either completely or partially synthesized. One method of obtaining a nucleotide sequence encoding a desired DNA template element is by annealing the complementary set of overlapping synthetic oligonucleotides produced in a conventional automated polynucleotide synthesizer, followed by ligation with an appropriate DNA ligase and amplification of the ligated nucleotide sequence via PCR. See, for example, Jayaraman et al., Proc. Natl. Acad. Sci. USA (1991) 88:4084-4088. Alternatively, oligonucleotide-guided synthesis (Jones et al., Nature (1986) 54:75-82), oligonucleotide-guided mutagenesis of pre-existing nucleotide regions (Riechmann et al., Nature (1988) 332:323-327 and Verhoeyen et al., Science (1988) 239:1534-1536), and enzymatic filling of nick oligonucleotides using T4 DNA polymerase (Queen et al., Proc. Natl. Acad. Sci. USA (1989) 86:10029-10033) can be used.
[0453] The precursor RNA provided herein can be generated by incubating a DNA template provided herein under conditions that allow transcription of the precursor RNA encoded by the DNA template. For example, in some embodiments, the precursor RNA is synthesized by incubating a DNA template provided herein containing an RNA polymerase promoter upstream of its 5' double-stranded sequence and / or expression sequence with a compatible RNA polymerase under conditions that allow in vitro transcription. In some embodiments, the DNA template is incubated intracellularly by phage RNA polymerase or in the cell nucleus by host RNA polymerase II.
[0454] In some embodiments, this document provides a method for generating precursor RNA by in vitro transcription using a DNA template provided herein (e.g., a vector provided herein with an RNA polymerase promoter located upstream of the 5' double-stranded region).
[0455] In some embodiments, the resulting precursor RNA can be used to generate circular RNA (e.g., the circular RNA polynucleotide provided herein) by incubation in the presence of magnesium ions and guanosine nucleotides or nucleosides at a temperature (e.g., between 20°C and 60°C) where RNA cyclization occurs.
[0456] Therefore, in some embodiments, this document provides a method for preparing circular RNA. In some embodiments, the method includes synthesizing precursor RNA via transcription (e.g., uncontrolled transcription) using vectors provided herein (e.g., 5' enhancing intron elements, 5' enhancing exon elements, core functional elements, 3' enhancing exon elements, and 3' enhancing intron elements) as templates, and incubating the resulting precursor RNA in the presence of divalent cations (e.g., magnesium ions) and GTP to circularize it to form circular RNA. In some embodiments, the precursor RNA disclosed herein is capable of circularization in the absence of magnesium ions and GTP and / or without the step of incubation with magnesium ions and GTP. It has been found that circular RNA has reduced immunogenicity relative to the corresponding mRNA, at least in part because the mRNA contains an immunogenic 5' cap. When transing DNA vectors from certain promoters (e.g., the T7 promoter) to produce precursor RNA, it should be understood that the 5' end of the precursor RNA is G. To reduce the immunogenicity of circular RNA compositions containing low levels of contaminating linear mRNA, an excess of GMP relative to GTP can be provided during transcription, such that most transcripts contain 5' GMP, which cannot be capped. Therefore, in some embodiments, transcription is performed in the presence of excess GMP. In some embodiments, transcription is performed at a GMP to GTP concentration ratio in the range of about 3:1 to about 15:1, for example, about 3:1 to about 10:1, about 3:1 to about 5:1, about 3:1, about 4:1, or about 5:1.
[0457] In some embodiments, the composition containing circular RNA has been purified. Circular RNA can be purified by any known method commonly used in the art, such as column chromatography, gel filtration chromatography, and size exclusion chromatography. In some embodiments, purification includes one or more of the following steps: phosphatase treatment, HPLC size exclusion purification, and RNase R digestion. In some embodiments, purification sequentially includes the following steps: RNase R digestion, phosphatase treatment, and HPLC size exclusion purification. In some embodiments, purification includes reversed-phase HPLC. In some embodiments, the purified composition contains less double-stranded RNA, DNA clips, triphosphorylated RNA, phosphatase proteins, protein ligases, capping enzymes, and / or nicked RNA than the unpurified RNA. In some embodiments, the purification of circular RNA includes affinity purification or negative selection methods as described herein. In some embodiments, the purification of circular RNA includes isolating linear RNA from the circular RNA using oligonucleotides that are complementary to the sequence in the linear RNA but not to the sequence in the circular RNA. In some embodiments, the purified composition has lower immunogenicity than the unpurified composition. In some embodiments, immune cells exposed to the purified composition produce less TNFα, RIG-I, IL-2, IL-6, IFNγ and / or type 1 interferon, such as IFN-β1, compared to immune cells exposed to the unpurified composition.
[0458] This article describes a method for evaluating RNA translatability using polyribosome profiling. Polyribosome profiling involves the analysis of ribosome-free and polyribosome-bound RNA and can be used to determine the translatability of RNA molecules (see, for example, Leppek et al., Nature Commun. (2022), 13, 1536). Polyribosomes are aggregates of ribosomes involved in the active translation of RNA into proteins and have different molecular weights compared to unbound ribosomes (i.e., non-translating ribosomes not bound to RNA molecules). Given the different molecular weights between bound and unbound polyribosomes, ribosome fractionation can be performed on bound polyribosomes (associated with actively translated RNA) and unbound (non-translated RNA) molecules. In some embodiments, the separation and / or fractionation of polyribosomes can be performed using a sucrose gradient.
[0459] The presence of multiple ribosomes on RNA with multiple binding ribosomes is an indicator of higher translational capacity. In contrast, free RNA not bound to any ribosome or ribosomal subunit is an indicator of lower or no translational capacity. In some embodiments, after cell introduction and isolation, RNA sequences (e.g., circular RNA) may be bound to two or more ribosomes, resulting in sucrose fractionation related to the number of bound ribosomes. In some embodiments, RNA sequences may be bound to a single ribosome, thereby producing the associated sucrose fractionation. In some embodiments, RNA sequences may be bound to a 60S ribosomal subunit, thereby producing the associated sucrose fractionation. In other embodiments, RNA sequences may be bound to a 40S ribosomal subunit, thereby producing the associated sucrose fractionation. Alternatively, in some embodiments, RNA sequences may not be bound to any ribosome or subunit, thereby producing the associated sucrose fractionation.
[0460] In some implementations, RNA polysome loading (i.e., the process of loading RNA of interest onto ribosomes) can be evaluated in a cell-free expression (CFE) environment. CFE is a system by which the transcriptional and translational capacity of polynucleotides can be evaluated in vitro. Such experiments may involve introducing a DNA template into a mixture of cytoplasmic extracts consisting of cell products essential for transcription and translation (see, for example, Garenne et al., Nat. Rev. Methods Primers (2021), 1, 49). Polysomes can then be collected from the system and evaluated using the polysome profiling methods described herein.
[0461] In some embodiments, pools of RNA of interest (e.g., circular RNA) are transfected into cell collections (e.g., mammalian cells) rather than in a CFE environment. In some embodiments, cells undergo lysis to release cytoplasmic polyribosomes, which are then extracted for polyribosome profiling. In some embodiments, after cell lysis, lysed cells and their RNA contents are added to a sucrose gradient and centrifuged to separate RNA molecules based on their ribosome loading (see, for example, Chassé et al., Nucleic Acids Res. (2017), 45(3):e15). The gradient is then graded by pumping the sucrose gradient into a grading collection instrument and collected as separate sucrose / polyribosome fractions. In some embodiments, the properties of these fractions are defined by volume and / or time. A set of reference “ladder” RNA sequences are added to the individual fractions at known concentrations to aid in quantification and for comparison with a raw RNA molecule library. RNA can then be extracted from the individual sucrose gradient fractions for sequencing and analysis (e.g., RNA stability).
[0462] In some embodiments, polyribosome profiling can be used to determine the translatability of one or more RNA molecules. In some embodiments, the RNA molecules analyzed by polyribosome profiling comprise circular RNA and / or linear RNA. In some embodiments, the RNA (e.g., circular RNA) comprises translation initiation elements (TIEs) as described herein. In some embodiments, polyribosome profiling can be used to select and optimize translatability and / or expression in RNA molecules. In some embodiments, a TIE capable of high translation efficiency, for example in circular RNA disclosed herein, refers to high ribosome initiation, loading, and / or recruitment, such as de novo ribosome initiation and / or recruitment, as determined by polyribosome profiling methods disclosed herein and / or known in the art.
[0463] This document provides a method for identifying TIEs capable of initiating, promoting, and / or driving translation, comprising the steps of: (a) obtaining a pool of RNA molecules containing a barcode sequence and a TIE; (b) transfecting the RNA molecules into cells containing one or more ribosomes; (c) lysing the cells and adding the contents of the lysed cells to a gradient for grading based on ribosome loading; and (d) selecting combinations of RNA and TIEs with high ribosome loading. In some embodiments, the RNA is circular RNA.
[0464] This article provides a method for identifying TIEs with high translation efficiency, comprising the following steps: (a) obtaining a pool of RNA molecules containing barcode sequences and TIEs; (b) transfecting RNA molecules into cells containing one or more ribosomes; (c) lysing the cells and adding the contents of the lysed cells to a gradient for grading based on ribosome loading; and (d) selecting combinations of RNA and TIEs with high ribosome loading. In some embodiments, the RNA is circular RNA.
[0465] 6. Overview of transfer media and other delivery mechanisms
[0466] A. Ionizable lipids
[0467] In some embodiments, this document discloses ionizable lipids that can be used as components of transfer mediators to facilitate or enhance the delivery and release of circular RNA to one or more target cells (e.g., by penetrating or fusing with the lipid membranes of such target cells). In some embodiments, the ionizable lipids comprise one or more cleavable functional groups (e.g., disulfides) that allow, for example, the hydrophilic functional head group of a compound to dissociate from the lipophilic functional tail group (e.g., upon exposure to oxidative, reducing, or acidic conditions), thereby facilitating a phase transition in the lipid bilayer of one or more target cells.
[0468] In some embodiments, the ionizable lipid is the lipid described in international patent application PCT / US2018 / 058555.
[0469] In some embodiments, the transfer medium comprises lipid A, lipid B, lipid C, and / or lipid D. In some embodiments, the inclusion of lipid A, lipid B, lipid C, and / or lipid D improves encapsulation and / or endosome escape.
[0470] In some embodiments, the ionizable lipid is lipid A, which is (9Z,12Z)-3-((4,4-bis(octyloxy)butyryl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadec-9,12-dienoate, also known as 3-((4,44-bis(octyloxy)butyryl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadec-9,12-dienoate. Lipid A can be described as:
[0471]
[0472] In some embodiments, the ionizable lipids of this disclosure are selected from Table 2.
[0473] Table 2: Exemplary ionizable lipids
[0474]
[0475]
[0476] Another exemplary ionizable lipid meter (Table B)
[0477]
[0478]
[0479]
[0480]
[0481]
[0482]
[0483]
[0484]
[0485]
[0486]
[0487]
[0488]
[0489]
[0490]
[0491]
[0492]
[0493]
[0494]
[0495]
[0496]
[0497]
[0498]
[0499]
[0500]
[0501]
[0502]
[0503]
[0504]
[0505]
[0506]
[0507]
[0508]
[0509]
[0510] In some implementations, the ionizable lipid is a compound of formula (15):
[0511] Or its pharmaceutically acceptable salt, wherein:
[0512] n * Integers from 1 to 7;
[0513] R a It is hydrogen or hydroxyl;
[0514] R h It is hydrogen or C1-C6 alkyl;
[0515] R 1 For C1-C 30 Alkyl or R 1* ;
[0516] R 2 For C1-C 30 Alkyl or R 2* ;
[0517] R 1* and R 2* Selected independently from:
[0518] –(CH2) q C(O)O(CH2) r C(R 8 (R) 9 (R) 10 ),
[0519] –(CH2) q OC(O)(CH2) r C(R 8 (R) 9 (R) 10 ) and –(CH2) q OC(O)O(CH2) r C(R 8 (R) 9 (R) 10 );
[0520] in:
[0521] q is an integer from 0 to 12.
[0522] r is an integer from 0 to 6, where r appears at least once and is not 0;
[0523] R 8 For H or R 11 ;
[0524] R 9 R 10 and R 11 Each independently is C1-C 20 Alkyl or C2-C 20 -alkenyl; and where (i)R 1 For R 1*(ii)R 2 For R 2* , or (iii)R 1 For R 1* And R 2 For R 2* In some implementations of equation (15), R a Lipids that are hydrogen-rich and ionizable have formula (16):
[0525] Or its pharmaceutically acceptable salt, wherein:
[0526] n* is an integer from 1 to 7.
[0527] In some embodiments of formula (16), the ionizable lipid has formula (17):
[0528]
[0529] Or its pharmaceutically acceptable salt, wherein:
[0530] n is an integer from 1 to 7;
[0531] q and q' are each independent integers from 0 to 12;
[0532] r and r' are each independent integers from 0 to 6, where at least one of r or r' is not 0;
[0533] Z A and Z B Each is independently selected from ^-C(O)O-, ^-OC(O) and -OC(O)O-; where ^ represents -(CH2). q -or-(CH2) q' - Attachment point; and
[0534] R 9A R 9B R 10A and R 10B Each independently is C1-C 20 Alkyl or C2-C 20 Alkenyl group.
[0535] In some implementations of equation (17), Z A and Z B It is ^-C(O)O-, and the ionizable lipid has formula (17a-1).
[0536]
[0537] In some embodiments of equation (17), Z A and Z BIt is ^-OC(O)-, and the ionizable lipid has formula (17a-2).
[0538]
[0539] In some implementations of equation (17), Z A and Z B The form is -O(C)(O)O-, and the ionizable lipid is represented by formula (17a-3):
[0540]
[0541] In some implementations of equation (15), R a The lipid is hydroxyl and ionizable, possessing formula (18):
[0542]
[0543] Or its pharmaceutically acceptable salt, wherein:
[0544] n * Integers from 1 to 7;
[0545] R h It is hydrogen or C1-C6 alkyl;
[0546] R 1 For C1-C 30 Alkyl or R 1* ;
[0547] R 2 For C1-C 30 Alkyl or R 2* ;
[0548] R 1* and R 2* Selected independently from:
[0549] –(CH2) q C(O)O(CH2) r C(R 8 (R) 9 (R) 10 ),
[0550] –(CH2) q OC(O)(CH2) r C(R 8 (R) 9 (R) 10 )and
[0551] –(CH2) q OC(O)O(CH2) r C(R 8 (R)9 (R) 10 );
[0552] in:
[0553] q is an integer from 0 to 12.
[0554] r is an integer from 0 to 6, where r appears at least once and is not 0;
[0555] R 8 Hydrogen or R 11 ;
[0556] R 9 R 10 and R 11 Each independently is C1-C 20 Alkyl or C2-C 20 -Alkenyl;
[0557] Where (i)R 1 For R 1* (ii)R 2 For R 2* , or (iii)R 1 For R 1* And R 2 For R 2* ;and
[0558] Among them, for (iii), (a)R 1* and R 2* Different or (b) for R 1* and R 2* At least one of them, R 9 and R 10 They have different numbers of carbon atoms.
[0559] In some embodiments of formula (18), the ionizable lipid has the following properties:
[0560]
[0561] Or its pharmaceutically acceptable salt, wherein:
[0562] n is an integer from 1 to 7;
[0563] q and q' are each independent integers from 0 to 12...
Claims
1. A circular RNA polynucleotide (oRNA) comprising a translation initiation element (TIE), wherein the TIE comprises a sequence optionally barcode-encoded with a barcode sequence selected from SEQ ID NO:3304-14066 having at least 85% sequence identity with a sequence or fragment thereof shown in any one of SEQ ID NO:14067-24829 (GIRES-1 to GIRES-10762) or having a common sequence shown in any one of SEQ ID NO:24867-24892; or a precursor RNA polynucleotide capable of producing said oRNA.
2. The oRNA or precursor RNA polynucleotide of claim 1, wherein the TIE comprises an internal ribosome entry site (IRES) or a fragment thereof.
3. The oRNA or precursor RNA polynucleotide as described in claim 1 or 2, wherein the IRES is wholly or partially derived from the untranslated region (UTR).
4. The oRNA or precursor RNA polynucleotide of any one of claims 2 to 3, wherein the IRES has at least 90% identity with the sequence shown in any one of SEQ ID NO: 14067-24829.
5. The oRNA or precursor RNA polynucleotide of any one of claims 2 to 4, wherein the IRES has at least 95% identity with the sequence shown in any one of SEQ ID NO: 14067-24829.
6. The oRNA or precursor RNA polynucleotide of any one of claims 2 to 5, wherein the IRES has at least 98% identity with the sequence shown in any one of SEQ ID NO: 14067-24829.
7. The oRNA or precursor RNA polynucleotide as claimed in any one of claims 2 to 6, wherein the IRES comprises the sequence shown in any one of SEQ ID NO: 14067-24829.
8. An oRNA or a precursor RNA polynucleotide capable of producing said oRNA, comprising a core functional element and a pharmaceutically acceptable salt, buffer, diluent, or combination thereof; wherein said core functional element comprises a translation initiation element (TIE), wherein said TIE has at least 85% sequence identity with the sequence shown in any one of SEQ ID NO: 793, 876, 1017, 1216, and 3291, wherein said oRNA is capable of expressing a therapeutic protein in T cells.
9. An oRNA or a precursor RNA polynucleotide capable of producing said oRNA, comprising a core functional element and a pharmaceutically acceptable salt, buffer, diluent, or combination thereof; wherein said core functional element comprises a translation initiation element (TIE), wherein said TIE has at least 85% sequence identity with the sequence shown in any one of SEQ ID NO: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293, and 3302, wherein said oRNA is capable of expressing a therapeutic protein in T cells.
10. An oRNA or a precursor RNA polynucleotide capable of producing said oRNA, comprising a core functional element and a pharmaceutically acceptable salt, buffer, diluent, or combination thereof; wherein the core functional element comprises a translation initiation element (TIE), wherein the TIE is associated with SEQ ID NO: 75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 922, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 1193, 1198, 1263, 1276, The sequences shown in any one of 1280, 1282, 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299 and 3301 have at least 85% sequence identity, wherein the oRNA is capable of expressing a therapeutic protein in T cells.
11. The oRNA or precursor RNA polynucleotide of any one of claims 8 to 10, wherein the TIE comprises an internal ribosome entry site (IRES) or a fragment thereof.
12. The oRNA or precursor RNA polynucleotide of claim 11, wherein the IRES is wholly or partially derived from the untranslated region (UTR).
13. The oRNA or precursor RNA polynucleotide of claim 11 or 12, wherein the IRES sequence has at least 90% sequence identity with the sequence shown in any one of SEQ ID NO: 793, 876, 1017, 1216 and 3291.
14. The oRNA or precursor RNA polynucleotide of any one of claims 11 to 13, wherein the IRES sequence has at least 95% sequence identity with the sequence shown in any one of SEQ ID NO: 793, 876, 1017, 1216 and 3291.
15. The oRNA or precursor RNA polynucleotide of any one of claims 11 to 14, wherein the IRES sequence has at least 98% sequence identity with the sequence shown in any one of SEQ ID NO: 793, 876, 1017, 1216 and 3291.
16. The oRNA or precursor RNA polynucleotide of any one of claims 11 to 15, wherein the IRES sequence has at least 99% sequence identity with the sequence shown in any one of SEQ ID NO: 793, 876, 1017, 1216 and 3291.
17. The oRNA or precursor RNA polynucleotide of any one of claims 11 to 16, wherein the IRES sequence comprises the sequence shown in any one of SEQ ID NO: 793, 876, 1017, 1216 and 3291.
18. The oRNA or precursor RNA polynucleotide of claim 11 or 12, wherein the IRES sequence has at least 90% sequence identity with the sequence shown in any one of SEQ ID NO: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293 and 3302.
19. The oRNA or precursor RNA polynucleotide of any one of claims 11, 12 or 18, wherein the IRES sequence has at least 95% sequence identity with the sequence shown in any one of SEQ ID NO: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293 and 3302.
20. The oRNA or precursor RNA polynucleotide of any one of claims 11, 12, 18 or 19, wherein the IRES sequence has at least 98% sequence identity with the sequence shown in any one of SEQ ID NO: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293 and 3302.
21. The oRNA or precursor RNA polynucleotide of any one of claims 11, 12, or 18 to 20, wherein the IRES sequence has at least 99% sequence identity with the sequence shown in any one of SEQ ID NO: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293, and 3302.
22. The oRNA or precursor RNA polynucleotide of any one of claims 11, 12, or 18 to 21, wherein the IRES sequence comprises the sequence shown in any one of SEQ ID NO: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293, and 3302.
23. The oRNA or precursor RNA polynucleotide of claim 11 or 12, wherein the IRES sequence is associated with SEQ ID NO: 75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 922, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 1193, 11 The sequences shown in any one of 98, 1263, 1276, 1280, 1282, 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299 and 3301 have at least 90% sequence identity.
24. The oRNA or precursor RNA polynucleotide of any one of claims 11, 12, or 23, wherein the IRES sequence is associated with SEQ ID NO: 75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 922, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 1193, 119 The sequence represented by any one of 8, 1263, 1276, 1280, 1282, 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299 and 3301 has at least 95% sequence identity.
25. The oRNA or precursor RNA polynucleotide of any one of claims 11, 12, 23, or 24, wherein the IRES sequence is associated with SEQ ID NO: 75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 922, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 1193, 119 The sequence represented by any one of 8, 1263, 1276, 1280, 1282, 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299 and 3301 has at least 98% sequence identity.
26. The oRNA or precursor RNA polynucleotide of any one of claims 11, 12, 23 to 25, wherein the IRES sequence is associated with SEQ ID NO: 75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 922, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 1193, 119 The sequence represented by any one of 8, 1263, 1276, 1280, 1282, 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299 and 3301 has at least 99% sequence identity.
27. The oRNA or precursor RNA polynucleotide of any one of claims 11, 12, 23 to 26, wherein the IRES sequence comprises SEQ ID NO: 75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 922, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 11 The sequence represented by any one of the following: 93, 1198, 1263, 1276, 1280, 1282, 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299, and 3301.
28. The oRNA or precursor RNA polynucleotide as described in any of the preceding claims, wherein the precursor RNA further comprises an auxiliary element.
29. The oRNA or precursor RNA polynucleotide of claim 28, wherein the auxiliary element comprises a miRNA binding site or a fragment thereof, a restriction site or a fragment thereof, an RNA editing motif or a fragment thereof, a zip coding element or a fragment thereof, an RNA transport element or a fragment thereof, a nuclease site or a fragment thereof, or a combination thereof.
30. The oRNA or precursor RNA polynucleotide of claim 28 or 29, wherein the auxiliary element comprises a binding domain of an IRES trans-acting factor (ITAF) and / or a translation initiation factor.
31. The oRNA or precursor RNA polynucleotide of claim 30, wherein the binding domain comprises a polyA region, a polyC region, a polyAC region, a polypyrimidine bundle, or a combination or variant thereof.
32. The oRNA or precursor RNA polynucleotide of claim 30 or 31, wherein the ITAF comprises poly(rC)-binding protein 1 (PCBP1), PCBP2, PCBP3, PCBP4, poly(A)-binding protein 1 (PABP1), polypyrimidine bundle-binding protein (PTB), a member of the Argonaute protein family, HNRNPK (nuclear heterogeneous ribonucleoprotein K protein), or La protein, or fragments or combinations thereof.
33. The oRNA or precursor RNA polynucleotide as described in any of the preceding claims, wherein the core functional element further comprises a coding sequence and optionally a termination sequence located downstream of the coding sequence.
34. The oRNA or precursor RNA polynucleotide of claim 33, wherein the coding sequence is located downstream of the IRES.
35. The oRNA or precursor RNA polynucleotide of claim 33, wherein the coding sequence is located upstream of the IRES.
36. The oRNA or precursor RNA polynucleotide of any one of claims 33 to 35, wherein the termination sequence is a stop codon or a stop box.
37. The oRNA or precursor RNA polynucleotide of claim 36, wherein the termination box contains one or more stop codons in two or more open reading frames.
38. The precursor RNA polynucleotide as claimed in any of the preceding claims, wherein the precursor RNA polynucleotide comprises: a.5' Enhanced Integral Sub-element, b.5' Enhanced exon element, c. The core functional components d.3' Enhanced exon elements, and e.3' Enhanced intron element.
39. The precursor RNA polynucleotide of claim 38, wherein elements (a)-(e) are arranged in the order of (a) to (e).
40. The precursor RNA polynucleotide of claim 38 or 39, wherein the 5' enhanced exon element and / or the 3' enhanced exon element are each included within the core functional element.
41. The precursor RNA polynucleotide of claim 40, wherein the 5' enhancing exon element and / or the 3' enhancing exon element are each included within the coding sequence.
42. The precursor RNA polynucleotide of any one of claims 38 to 41, wherein the 5' enhanced intron element comprises a 3' intron segment.
43. The precursor RNA polynucleotide of claim 42, wherein the 3' intron region further comprises the first nucleotide or the first nucleotide and the second nucleotide of the 3' group I intron splicing site dinucleotide.
44. The precursor RNA polynucleotide of claim 42 or 43, wherein the 3' intron region is located at the 3' end of the 5' enhanced intron element.
45. The precursor RNA polynucleotide of any one of claims 42 to 44, wherein the 5' enhanced intron element comprises a leader untranslated sequence located at the 5' end.
46. The precursor RNA polynucleotide of claim 45, wherein the leader untranslated sequence comprises a spacer region.
47. The precursor RNA polynucleotide of claim 45 or 46, wherein the leader untranslated sequence comprises the last nucleotide of the transcription start site.
48. The precursor RNA polynucleotide of any one of claims 45 to 47, wherein the leader untranslated sequence comprises 1 to 100 additional nucleotides.
49. The precursor RNA polynucleotide of any one of claims 42 to 48, wherein the 5' enhanced intron element comprises a 5' affinity sequence.
50. The precursor RNA polynucleotide of claim 49, wherein the 5' affinity sequence comprises a polyA, polyAC, or a polypyrimidine sequence.
51. The precursor RNA polynucleotide of claim 49 or 50, wherein the 5' affinity sequence comprises 10 to 100 nucleotides.
52. The precursor RNA polynucleotide of any one of claims 38 to 51, wherein the 5' enhanced intron element comprises a 5' outer spacer sequence.
53. The precursor RNA polynucleotide of claim 52, wherein the 5' outer spacer sequence is located between the 5' affinity sequence and the 3' intron region.
54. The precursor RNA polynucleotide of claim 52 or 53, wherein the 5' outer spacer sequence has a length of about 6 to 60 nucleotides.
55. The precursor RNA polynucleotide of any one of claims 52 to 54, wherein the 5' outer spacer sequence comprises or consists of a sequence selected from or composed of SEQ ID NO:3094-3152.
56. The precursor RNA polynucleotide of any one of claims 38 to 55, wherein the 5' enhanced intron element comprises: a. Leading untranslated sequence; b.5' affinity sequence; c.5' outer spacer sequence; and d. The 3' intron region including the first nucleotide of the 3' group I intron splicing site; The leader untranslated sequence comprises the last nucleotide of the transcription start site and 1 to 100 nucleotides.
57. The precursor RNA polynucleotide of claim 56, wherein (a)-(d) are arranged in the order of (a) to (d).
58. The precursor RNA polynucleotide of any one of claims 38 to 55, wherein the 5' enhanced intron element comprises: a. Leading untranslated sequence; b.5' outer spacer sequence; c.5' affinity sequence; and d. The 3' intron region of the first nucleotide including the 3' group I splice site; The leader untranslated sequence comprises the last nucleotide of the transcription start site and 1 to 100 nucleotides.
59. The precursor RNA polynucleotide of claim 58, wherein (a)-(d) are arranged in the order of (a) to (d).
60. The precursor RNA polynucleotide of any one of claims 38 to 55, wherein the 5' enhanced intron element comprises: a. Leading untranslated sequence; b.5' outer spacer sequence; c.5' affinity sequence; and d. The 3' intron region including the first and second nucleotides of the 3' I splice site; The leader untranslated sequence comprises the last nucleotide of the transcription start site and 1 to 100 nucleotides; and the 5' enhanced exon element comprises a 3' exon segment lacking a second nucleotide at the 3' group I splice site.
61. The precursor RNA polynucleotide of claim 60, wherein (a)-(d) are arranged in the order of (a) to (d).
62. The precursor RNA polynucleotide of any one of claims 38 to 61, wherein the 5' enhanced exon element comprises a 3' exon segment.
63. The precursor RNA polynucleotide of claim 62, wherein the 3' exon segment further comprises a second nucleotide of a 3' group I intron splicing site dinucleotide.
64. The precursor RNA polynucleotide of claim 62 or 63, wherein the 3' exon segment comprises 1 to 100 natural nucleotides derived from natural exons.
65. The precursor RNA polynucleotide of claim 64, wherein the natural exon is derived from a gene containing a group I intron or a fragment thereof.
66. The precursor RNA polynucleotide of claim 64 or 65, wherein the natural exon is derived from Anabaena bacteria, T4 bacteriophage virus, Tovot bacteriophage, Tetrahymena bacteria or Azotobacter bacteria.
67. The precursor RNA polynucleotide of any one of claims 38 to 66, wherein the 5' enhanced exon element comprises a 5' internal spacer sequence located downstream of the 3' exon segment.
68. The precursor RNA polynucleotide of claim 67, wherein the 5' internal spacer sequence is about 6 to 60 nucleotides in length.
69. The precursor RNA polynucleotide of claim 67 or 68, wherein the 5' internal spacer sequence comprises or is composed of a sequence selected from or formed thereof in SEQ ID NO:3094-3152.
70. The precursor RNA polynucleotide of any one of claims 38 to 69, wherein the 5' enhancing exon element comprises, in the following order: a. The 3' exon region of the second nucleotide including the dinucleotide at the 3' group I intron splicing site; and b.5' internal spacer sequence, The 3' exon segment contains 1 to 100 natural nucleotides derived from natural exons.
71. The precursor RNA polynucleotide of any one of claims 38 to 69, wherein the 5' enhancing exon element comprises, in the following order: a.3' exon segment; and b.5' internal spacer sequence, The 3' exon segment comprises 1 to 100 natural nucleotides derived from natural exons; and the 5' enhanced intron element comprises a 3' intron segment containing a first nucleotide and a second nucleotide of a 3' group I splice site dinucleotide.
72. The precursor RNA polynucleotide of any one of claims 38 to 71, wherein the 3' enhanced exon element comprises a 5' exon segment.
73. The precursor RNA polynucleotide of claim 72, wherein the 5' exon segment comprises the first nucleotide of the 5' group I intron segment.
74. The precursor RNA polynucleotide of claim 72 or 73, wherein the 5' exon segment further comprises 1 to 100 nucleotides derived from natural exons.
75. The precursor RNA polynucleotide of claim 74, wherein the natural exon is derived from a gene containing a group I intron or a fragment thereof.
76. The precursor RNA polynucleotide of any one of claims 38 to 75, wherein the 3' enhanced exon element comprises a 3' internal spacer sequence.
77. The precursor RNA polynucleotide of claim 76, wherein the 3' internal spacer sequence is located between the termination sequence and the 5' exon segment.
78. The precursor RNA polynucleotide of claim 76 or 77, wherein the length of the 3' internal spacer region is about 6 to 60 nucleotides.
79. The precursor RNA polynucleotide of any one of claims 76 to 78, wherein the 3' internal spacer region comprises or is composed of a sequence selected from or consisting of SEQ ID NO:3094-3152.
80. The precursor RNA polynucleotide of any one of claims 38 to 79, wherein the 3' enhancing exon element comprises: a.3' Internal Spacing Sequence; and b. The 5' exon segment of the first nucleotide of the dinucleotide including the 5' group I intron splicing site. The 5' exon region contains 1 to 100 nucleotides derived from natural exons.
81. The precursor RNA polynucleotide of any one of claims 38 to 79, wherein the 3' enhancing exon element comprises: a.3' Internal Spacing Sequence; and b.5' exon segment, The 5' exon segment contains 1 to 100 nucleotides derived from natural exons; the 3' enhanced intron element contains a 5' intron segment comprising a first nucleotide and a second nucleotide of a 5' group I intron splicing site dinucleotide.
82. The precursor RNA polynucleotide of any one of claims 38 to 81, wherein the 3' enhanced intron element comprises a 5' intron segment.
83. The precursor RNA polynucleotide of claim 82, wherein the 5' intron region comprises a second nucleotide of a 5' group I intron splicing site dinucleotide.
84. The precursor RNA polynucleotide of any one of claims 38 to 83, wherein the 3' enhanced intron element comprises a trailing untranslated sequence located at the 3' end of the 5' intron.
85. The precursor RNA polynucleotide of claim 84, wherein the trailing untranslated sequence comprises 3 to 12 nucleotides.
86. The precursor RNA polynucleotide of any one of claims 38 to 85, wherein the 3' enhanced intron element comprises a 3' outer spacer sequence.
87. The precursor RNA polynucleotide of claim 86, wherein the 3' outer spacer sequence is located between the 5' intron region and the trailing untranslated sequence.
88. The precursor RNA polynucleotide of claim 86 or 87, wherein the 3' outer spacer sequence is 6 to 60 nucleotides in length.
89. The precursor RNA polynucleotide of any one of claims 86 to 88, wherein the 3' outer spacer sequence comprises or consists of a sequence selected from or composed of SEQ ID NO:3094-3152.
90. The precursor RNA polynucleotide of any one of claims 38 to 89, wherein the 3' enhancing intron element comprises a 3' affinity sequence.
91. The precursor RNA polynucleotide of claim 90, wherein the 3' affinity sequence is located between the 3' outer spacer sequence and the trailing untranslated sequence.
92. The precursor RNA polynucleotide of claim 90 or 91, wherein the 3' affinity sequence comprises a polyA, polyAC, or a polypyrimidine sequence.
93. The precursor RNA polynucleotide of any one of claims 90 to 92, wherein the affinity sequence comprises 10 to 100 nucleotides.
94. The precursor RNA polynucleotide of any one of claims 38 to 93, wherein the 5' enhanced intron element further comprises a 5' outer double-stranded sequence; wherein the 3' enhanced intron element further comprises a 3' outer double-stranded sequence.
95. The precursor RNA polynucleotide of claim 94, wherein the 5' outer double-stranded sequence and the 3' outer double-stranded sequence are completely or partially complementary to each other.
96. The precursor RNA polynucleotide of claim 94 or 95, wherein the 5' outer double-stranded sequence comprises fully or partially synthesized nucleotides.
97. The precursor RNA polynucleotide of any one of claims 94 to 96, wherein the 3' outer double-stranded sequence comprises a fully or partially synthesized nucleotide.
98. The precursor RNA polynucleotide of any one of claims 94 to 97, wherein the 3' outer double-stranded sequence is about 6 to about 50 nucleotides.
99. The precursor RNA polynucleotide of any one of claims 94 to 98, wherein the 5' outer double-stranded sequence is about 6 to about 50 nucleotides.
100. The precursor RNA polynucleotide of any one of claims 38 to 99, wherein the 5' enhanced exon element further comprises a 5' inner double-stranded sequence; wherein the 3' enhanced exon element further comprises a 3' inner double-stranded sequence.
101. The precursor RNA polynucleotide of claim 100, wherein the 5' inner double-stranded sequence and the 3' inner double-stranded sequence are completely complementary to each other.
102. The precursor RNA polynucleotide of claim 100, wherein the 5' inner double-stranded sequence and the 3' inner double-stranded sequence are partially complementary to each other.
103. The precursor RNA polynucleotide of claim 102, wherein the 5' inner double-stranded sequence and the 3' inner double-stranded sequence form a double-stranded structure comprising at least one mismatched nucleotide pair.
104. The precursor RNA polynucleotide of claim 103, wherein the double-stranded double-stranded structure comprises at least two mismatched nucleotide pairs.
105. The precursor RNA polynucleotide of claim 103 or 104, wherein the double-stranded bistranded structure comprises at least three mismatched nucleotide pairs.
106. The precursor RNA polynucleotide of any one of claims 103 to 105, wherein the double-stranded double-stranded structure comprises at least four mismatched nucleotide pairs.
107. The precursor RNA polynucleotide of any one of claims 103 to 106, wherein the double-stranded double-stranded structure comprises at least five mismatched nucleotide pairs.
108. The precursor RNA polynucleotide of any one of claims 100 to 107, wherein the 5' inner double-stranded sequence comprises a fully synthetic nucleotide.
109. The precursor RNA polynucleotide of any one of claims 100 to 108, wherein the 5' inner double-stranded sequence comprises a partially synthesized nucleotide.
110. The precursor RNA polynucleotide of any one of claims 100 to 109, wherein the 3' inner double-stranded sequence comprises a fully synthetic nucleotide.
111. The precursor RNA polynucleotide of any one of claims 100 to 109, wherein the 3' inner double-stranded sequence comprises a partially synthesized nucleotide.
112. The precursor RNA polynucleotide of any one of claims 100 to 111, wherein the 3' inner double-stranded sequence is about 6 to about 19 nucleotides.
113. The precursor RNA polynucleotide of any one of claims 100 to 112, wherein the 5' inner double-stranded sequence is about 6 to about 19 nucleotides.
114. The precursor RNA polynucleotide of any one of claims 38 to 113, wherein the 3' enhancing intron element comprises, in the following order: a. The 5' intron region of the second nucleotide, including the 5' group I intron splicing site dinucleotide; b.3' outer spacer sequence; and c.3' affinity sequence.
115. The precursor RNA polynucleotide of any one of claims 38 to 114, wherein the 3' enhancing exon element comprises, in the following order: a. The 5' intron region of the first and second nucleotides of the dinucleotide including the 5' group I intron splicing site; b.3' outer spacer sequence; and c.3' Affinity Sequence The 3' enhanced exon element comprises a 5' exon segment of the first nucleotide lacking the 5' group I intron splicing site dinucleotide.
116. The precursor RNA polynucleotide of claims 38 to 115, wherein the precursor RNA polynucleotide comprises: a. Leading untranslated sequence; b.5' affinity sequence; c.5' outer double-stranded sequence; d.5' interval sequence; e.3' contains a sub-segment; f.3' exon segment; g.5' Internal Double-Stranded Sequence h.5' internal spacer sequence; i. Translation initiation element; j. Encoded sequence; k. Termination sequence; l.3' internal spacer sequence; m.3' internal double-stranded sequence; n.5' exon segment; o.5' contains a sub-segment; p.3' outer double-stranded sequence; q.3' affinity sequence; and r. Trailing untranslated sequence.
117. The precursor RNA polynucleotide of claim 116, wherein (a)-(r) are arranged in the order (a) to (r).
118. The precursor RNA polynucleotide of any one of claims 38 to 115, wherein the precursor RNA polynucleotide comprises: a. Leading untranslated sequence; b.5' affinity sequence; c.5' outer spacer sequence; d.3' contains a sub-segment; e.3' exon segment; f.5' Internal double-stranded sequence; g.5' internal spacer sequence; h. Translation initiation element; i. Encoded sequence; j. Termination sequence; k.3' internal spacer sequence; l.3' Internal double-stranded sequence; m.5' exon segment; n.5' contains a sub-segment; o.3' outer spacer sequence; p.3' affinity sequence; and q. Trailing non-translated sequence.
119. The precursor RNA polynucleotide of claim 118, wherein (a)-(q) are arranged in the order (a) to (q).
120. The precursor RNA polynucleotide of any one of claims 38 to 115, wherein the precursor RNA polynucleotide comprises: a. Leading untranslated sequence; b.5' affinity sequence; c.5' outer spacer sequence; d.3' contains a sub-segment; e.3' exon segment; f.5' internal spacer sequence; g. Translation initiation element; h. Encoded sequence; i. Termination sequence; j.3' Internal Spacing Sequence; k.5' exon segment; l.5' contains sub-segments; m.3' outer spacer sequence; n. 3' affinity sequence; and o. Trailing untranslated sequence.
121. The precursor RNA polynucleotide of claim 120, wherein (a)-(o) are arranged in the order (a) to (o).
122. The precursor RNA polynucleotide of any one of claims 38 to 115, wherein the precursor RNA polynucleotide comprises: a. Leading untranslated sequence; b.5' affinity sequence; c.5' outer double-stranded sequence; d.5' interval sequence; e.3' contains a sub-segment; f.3' exon segment; g.5' Internal Double-Stranded Sequence h.5' internal spacer sequence; i. Termination sequence; j. Encoded sequence; k. Translation initiation element; l.3' internal spacer sequence; m.3' internal double-stranded sequence; n.5' exon segment; o.5' contains a sub-segment; p.3' outer double-stranded sequence; q.3' affinity sequence; and r. Trailing untranslated sequence.
123. The precursor RNA polynucleotide of claim 122, wherein (a)-(r) are arranged in the order (a) to (r).
124. The precursor RNA polynucleotide of any one of claims 33 to 123, wherein the coding sequence comprises two or more protein-coding regions.
125. The precursor RNA polynucleotide of claim 124, wherein the coding sequence comprises a sequence encoding a proteolytic cleavage site and / or a ribosomal choking element between the first expression sequence and the second expression sequence.
126. The precursor RNA polynucleotide of claim 125, wherein the ribosomal choke element is a self-cleaving spacer region.
127. The precursor RNA polynucleotide of claim 125 or 126, comprising a polynucleotide sequence encoding 2A ribosomal caston peptide.
128. The precursor RNA polynucleotide as claimed in any of the preceding claims, wherein the precursor RNA polynucleotide comprises the following sequences operably linked to and / or operably linked to each other with the IRES: (1) a 3' group I intron region; (2) a coding sequence encoding the therapeutic protein; and (3) a 5' group I intron region.
129. The precursor RNA polynucleotide of claim 128, wherein the 3' group I intron region and the 5' group I intron region are each derived from a bacterial bacteriophage, a viral vector, an organelle genome, or a nuclear rDNA gene.
130. The precursor RNA polynucleotide of claim 129, wherein the 3' group I intron segment and the 5' group I intron segment are each derived from Anabaena bacteria, T4 bacteriophage virus, Tovot bacteriophage, Tetrahymena bacteria or Azotobacter bacteria.
131. The precursor RNA polynucleotide as claimed in any of the preceding claims, wherein the precursor RNA polynucleotide comprises one or more spacer sequences operatively linked to at least one of the 3' group I intron, the IRES sequence, the coding sequence, and the 5' group I intron.
132. The precursor RNA polynucleotide of claim 131, wherein the precursor RNA polynucleotide comprises two spacer sequences.
133. The precursor RNA polynucleotide of claim 132, wherein the two spacer sequences comprise a 5' outer spacer sequence and a 3' outer spacer sequence, or a 5' inner spacer sequence and a 3' inner spacer sequence.
134. The precursor RNA polynucleotide of claim 131, wherein the precursor RNA polynucleotide comprises four spacer sequences.
135. The precursor RNA polynucleotide of claim 134, wherein the four spacer sequences comprise a 5' outer spacer sequence, a 3' outer spacer sequence, a 5' inner spacer sequence, and a 3' inner spacer sequence.
136. The precursor RNA polynucleotide as claimed in any of the preceding claims, wherein the precursor RNA polynucleotide comprises a 5' inner double-stranded sequence and a 3' inner double-stranded sequence.
137. The precursor RNA polynucleotide of claim 136, wherein the 5' inner double-stranded sequence and the 3' inner double-stranded sequence are completely or partially complementary to each other.
138. The precursor RNA polynucleotide as claimed in any of the preceding claims, wherein the precursor RNA polynucleotide comprises a polyA region, a polyC region, a polyAC region, a polypyrimidine bundle, or a combination or variant thereof.
139. The precursor RNA polynucleotide as claimed in any of the preceding claims, wherein the precursor RNA polynucleotide comprises a 3' exon segment and a 5' exon segment, each derived from a natural exon.
140. The precursor RNA polynucleotide of claim 136, wherein the precursor RNA polynucleotide comprises the following elements operatively linked to each other: (a) The 5' outer spacer sequence; (b) The 3' group I contains a sub-segment; (c) the 5' exon segment; (d) The 5' internal double-stranded sequence; (e) the IRES sequence; (f) the encoded sequence; (g) the 3' internal double-stranded sequence; (h) the 3' exon segment; (j) The 5' group I contains sub-segments; and (k) The 3' outer spacer sequence.
141. The precursor RNA polynucleotide of claim 140, wherein elements (a)-(k) are arranged in the order (a)-(k).
142. The precursor RNA polynucleotide of claim 136, wherein the precursor RNA polynucleotide comprises the following elements operatively linked to each other: (a) The 3' group I contains a sub-segment; (b) the 5' exon segment; (c) The 5' internal double-stranded sequence; (d) The 5' internal spacer sequence; (e) the IRES sequence; (f) the encoded sequence; (g) The 3' internal spacer sequence (h) the 3' internal double-stranded sequence; (i) the 3' exon segment; and (j) The 5' group I contains sub-segments.
143. The precursor RNA polynucleotide of claim 142, wherein elements (a)-(j) are arranged in the order (a)-(j).
144. The precursor RNA polynucleotide of claim 136, wherein the precursor RNA polynucleotide comprises the following elements operatively linked to each other: (a) The 5' outer spacer sequence; (b) The 3' group I contains a sub-segment; (c) the 5' exon segment; (d) The 5' internal double-stranded sequence; (e) the 5' internal spacer sequence; (f) The IRES sequence; (g) the encoded sequence; (h) the 3' internal spacer sequence (i) the 3' internal double-stranded sequence; (j) the 5' exon element; (k) The 5' group I contains sub-segments; and (l) The 3' outer spacer sequence.
145. The precursor RNA polynucleotide of claim 144, wherein elements (a)-(l) are arranged in the order (a)-(l).
146. The oRNA or precursor RNA polynucleotide as claimed in any of the preceding claims, wherein the precursor RNA polynucleotide comprises partially synthesized nucleotides.
147. The oRNA or precursor RNA polynucleotide of any one of claims 1 to 145, wherein the precursor RNA polynucleotide comprises fully synthetic nucleotides.
148. The oRNA or precursor RNA polynucleotide according to any one of the preceding claims, wherein the precursor RNA polynucleotide is transcribed from a vector or DNA polynucleotide comprising a PCR product, a linearized plasmid, a nonlinear plasmid, a linearized microloop, a nonlinear microloop, a viral vector, a granule, cDNA, or an artificial chromosome.
149. An oRNA produced using a precursor RNA polynucleotide as described in any of the preceding claims.
150. The oRNA of claim 149, comprising the IRES sequence and the coding sequence.
151. The oRNA of claim 150, wherein the IRES sequence is upstream of the coding sequence.
152. The oRNA of claim 150, wherein the IRES sequence is downstream of the coding sequence.
153. The oRNA of any one of claims 149 to 152, comprising: (a) The 5' exon segment; (b) The 5' internal double-stranded sequence; (c) The 5' internal spacer sequence; (d) The IRES sequence; (e) the encoded sequence; (f) The 3' internal spacer sequence (g) the 3' internal double-stranded sequence; and (h) the 5' exon element.
154. The oRNA of claim 153, wherein (a)-(h) are arranged in the order of (a) to (h).
155. A pharmaceutical composition comprising an oRNA having at least 85% sequence identity with a sequence shown in any one of SEQ ID NO: 14067-24829 or having a concordant sequence shown in any one of SEQ ID NO: 24867-24892, and a pharmaceutically acceptable salt, buffer, diluent, or combination thereof; wherein the oRNA is capable of expressing a therapeutic protein in a cell or a pharmaceutical composition comprising the oRNA as described in any one of claims 1 to 37 or 146 to 154.
156. A pharmaceutical composition comprising an oRNA containing an IRES sequence having at least 85% sequence identity with a sequence shown in any one of SEQ ID NO:14067-24829 or having a common sequence shown in any one of SEQ ID NO:24867-24892, a cell, and a pharmaceutically acceptable salt, buffer, diluent, or combination thereof; wherein the oRNA is capable of expressing a therapeutic protein in the cell.
157. A pharmaceutical composition comprising an oRNA having at least 85% sequence identity with a sequence shown in any one of SEQ ID NO:14067-24829 or having a common sequence shown in any one of SEQ ID NO:24867-24892, a transfer medium capable of delivering the oRNA to cells, and a pharmaceutically acceptable salt, buffer, diluent, or combination thereof; wherein the oRNA is capable of expressing a therapeutic protein in cells.
158. The pharmaceutical composition of any one of claims 155 to 157, wherein the IRES has at least 90% identity with the sequence shown in any one of SEQ ID NO: 14067-24829.
159. The pharmaceutical composition of any one of claims 155 to 158, wherein the IRES has at least 95% identity with the sequence shown in any one of SEQ ID NO: 14067-24829.
160. The pharmaceutical composition of any one of claims 155 to 159, wherein the IRES has at least 98% identity with the sequence shown in any one of SEQ ID NO: 14067-24829.
161. The pharmaceutical composition of any one of claims 155-160, wherein the IRES has at least 99% identity with the sequence shown in any one of SEQ ID NO:14067-24829.
162. The pharmaceutical composition of any one of claims 155-161, wherein the IRES comprises the sequence shown in any one of SEQ ID NO:14067-24829.
163. A pharmaceutical composition comprising an oRNA having at least 85% sequence identity with an IRES sequence shown in any one of SEQ ID NO: 793, 876, 1017, 1216 and 3291, and a pharmaceutically acceptable salt, buffer, diluent or combination thereof, wherein the oRNA is capable of expressing a therapeutic protein in T cells.
164. A pharmaceutical composition comprising an oRNA containing an IRES sequence having at least 85% sequence identity with the sequence shown in any one of SEQ ID NO: 793, 876, 1017, 1216 and 3291, a T cell, and a pharmaceutically acceptable salt, buffer, diluent or combination thereof.
165. A pharmaceutical composition comprising an oRNA having at least 85% sequence identity with an IRES sequence shown in any one of SEQ ID NO: 793, 876, 1017, 1216 and 3291, a transfer medium capable of delivering the oRNA to T cells, and a pharmaceutically acceptable salt, buffer, diluent or combination thereof.
166. The pharmaceutical composition of any one of claims 163 to 165 or 155, wherein the IRES sequence has at least 90% sequence identity with the sequence shown in any one of SEQ ID NO: 793, 876, 1017, 1216 and 3291.
167. The pharmaceutical composition of any one of claims 163 to 166 or 155, wherein the IRES sequence has at least 95% sequence identity with the sequence shown in any one of SEQ ID NO: 793, 876, 1017, 1216 and 3291.
168. The pharmaceutical composition of any one of claims 163 to 167 or 155, wherein the IRES sequence has at least 98% sequence identity with the sequence shown in any one of SEQ ID NO: 793, 876, 1017, 1216 and 3291.
169. The pharmaceutical composition of any one of claims 163 to 168 or 155, wherein the IRES sequence has at least 99% sequence identity with the sequence shown in any one of SEQ ID NO: 793, 876, 1017, 1216 and 3291.
170. The pharmaceutical composition of any one of claims 163 to 169 or 155, wherein the IRES sequence comprises the sequence shown in any one of SEQ ID NO: 793, 876, 1017, 1216 and 3291.
171. A pharmaceutical composition comprising an oRNA having at least 85% sequence identity with an IRES sequence having the sequence shown in any one of SEQ ID NO: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293 and 3302, and a pharmaceutically acceptable salt, buffer, diluent or combination thereof, wherein the oRNA is capable of expressing a therapeutic protein in T cells.
172. A pharmaceutical composition comprising an oRNA having at least 85% sequence identity with an IRES sequence having the sequence shown in any one of SEQ ID NO: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293 and 3302, a T cell, and a pharmaceutically acceptable salt, buffer, diluent or combination thereof.
173. A pharmaceutical composition comprising an oRNA having at least 85% sequence identity with an IRES sequence having the sequence shown in any one of SEQ ID NO: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293 and 3302, a transfer medium capable of delivering said oRNA to T cells, and a pharmaceutically acceptable salt, buffer, diluent or combination thereof.
174. The pharmaceutical composition according to any one of claims 171 to 173 or 155, wherein the IRES sequence has at least 90% sequence identity with the sequence shown in any one of SEQ ID NO: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293 and 3302.
175. The pharmaceutical composition of any one of claims 171 to 174 or 155, wherein the IRES sequence has at least 95% sequence identity with the sequence shown in any one of SEQ ID NO: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293 and 3302.
176. The pharmaceutical composition according to any one of claims 171 to 175 or 155, wherein the IRES sequence has at least 98% sequence identity with the sequence shown in any one of SEQ ID NO: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293 and 3302.
177. The pharmaceutical composition of any one of claims 171 to 176 or 155, wherein the IRES sequence has at least 99% sequence identity with the sequence shown in any one of SEQ ID NO: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293 and 3302.
178. The pharmaceutical composition of any one of claims 171 to 177 or 155, wherein the IRES sequence comprises the sequence shown in any one of SEQ ID NO: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293 and 3302.
179. A pharmaceutical composition comprising the same components as those in SEQ ID NO: 75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 922, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 1193, 1198, 1263, 1276, 1280, 1282, 2601, 261. The oRNA of an IRES sequence having at least 85% sequence identity with any of the sequences shown in any one of 5, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299 and 3301, and a pharmaceutically acceptable salt, buffer, diluent or combination thereof, wherein the oRNA is capable of expressing a therapeutic protein in T cells.
180. A pharmaceutical composition comprising the same components as those in SEQ ID NO: 75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 922, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 1193, 1198, 1263, 1276, 1280, 128 2. The oRNA, T cells, and pharmaceutically acceptable salts, buffers, diluents, or combinations thereof of the IRES sequence having at least 85% sequence identity with any of the sequences shown in any one of 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299, and 3301.
181. A pharmaceutical composition comprising the same components as those in SEQ ID NO: 75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 922, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 1193, 1198, 1263, 1276, 1280, 1282, 2601, 26 The oRNA having at least 85% sequence identity with an IRES sequence of any one of the sequences shown in 15, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299 and 3301, a transfer medium capable of delivering said oRNA to T cells, and a pharmaceutically acceptable salt, buffer, diluent or combination thereof.
182. The pharmaceutical composition of any one of claims 179 to 181, wherein the IRES sequence is associated with SEQ ID NO: 75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 922, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 1193, 11 The sequences shown in any one of 98, 1263, 1276, 1280, 1282, 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299 and 3301 have at least 90% sequence identity.
183. The pharmaceutical composition of any one of claims 179 to 182, wherein the IRES sequence is associated with SEQ ID NO: 75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 922, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 1193, 11 The sequences shown in any one of 98, 1263, 1276, 1280, 1282, 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299 and 3301 have at least 95% sequence identity.
184. The pharmaceutical composition of any one of claims 179 to 183, wherein the IRES sequence is associated with SEQ ID NO: 75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 922, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 1193, 11 The sequences shown in any one of 98, 1263, 1276, 1280, 1282, 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299 and 3301 have at least 98% sequence identity.
185. The pharmaceutical composition of any one of claims 179 to 184, wherein the IRES sequence is associated with SEQ ID NO: 75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 922, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 1193, 11 The sequences shown in any one of 98, 1263, 1276, 1280, 1282, 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299 and 3301 have at least 99% sequence identity.
186. The pharmaceutical composition of any one of claims 179 to 185, wherein the IRES sequence comprises SEQ ID NO: 75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 922, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 1 The sequence represented by any one of 193, 1198, 1263, 1276, 1280, 1282, 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299, and 3301.
187. The pharmaceutical composition of any one of claims 155 to 186, wherein the oRNA comprises, in the following order: (1) the IRES sequence; and (2) a coding sequence encoding a therapeutic protein, wherein elements (1) and (2) are operatively linked to each other.
188. The pharmaceutical composition of any one of claims 155 to 187, wherein the IRES is capable of promoting the expression of the therapeutic protein encoded by a precursor RNA or polynucleotide in cells.
189. The pharmaceutical composition of claim 188, wherein the cell is a T cell.
190. The pharmaceutical composition of claim 188, wherein the IRES is capable of promoting the expression of the therapeutic protein in the cells such that the expression level of the protein in the cells is comparable to or higher than that when a control IRES is used.
191. The pharmaceutical composition of claim 189, wherein the IRES is capable of promoting the expression of the therapeutic protein in the T cells such that the expression level of the protein in the T cells is comparable to or higher than that when a control IRES is used.
192. The pharmaceutical composition of any one of claims 155 to 189, wherein the therapeutic protein comprises a chimeric protein.
193. The pharmaceutical composition of claim 192, wherein the chimeric protein comprises a chimeric antigen receptor (CAR), a T-cell receptor (TCR), a B-cell receptor (BCR), an immune cell activation or inhibition receptor, a recombinant fusion protein, a chimeric mutant protein, or a fusion protein or a combination thereof.
194. The pharmaceutical composition of any one of claims 155 to 193, wherein the therapeutic protein comprises an antibody, a nanobody, a non-antibody protein, an immunomodulatory ligand, a receptor, a structural protein, a growth factor ligand or receptor, a hormone or hormone receptor, a transcription factor, a checkpoint inhibitor or agonist, an Fc fusion protein, an anticoagulant, a coagulation factor, a chaperone protein, an antimicrobial protein, a structural protein, a biochemical enzyme, a tight junction protein, a mitochondrial stress response protein, a cytoskeletal protein, a metal-binding protein, or a small molecule or a combination thereof.
195. The pharmaceutical composition of claim 194, wherein the immunomodulatory ligand comprises interferon, cytokine, chemokine, or interleukin.
196. The pharmaceutical composition of claim 194, wherein the structural protein comprises a channel protein or a nucleoporin.
197. The pharmaceutical composition of any one of claims 187 to 196, wherein the coding sequence is codon-optimized.
198. The pharmaceutical composition of claim 197, wherein the coding sequence is optimized to lack at least one microRNA binding site present in an equivalent pre-optimized polynucleotide.
199. The pharmaceutical composition of claim 197 or 198, wherein the coding sequence is optimized to lack at least one RNA editing susceptibility site present in an equivalent pre-optimized polynucleotide.
200. The pharmaceutical composition of any one of claims 197 to 199, wherein the coding sequence is optimized to have a GC content between 50% and 70%.
201. The pharmaceutical composition of claim 200, wherein the coding sequence is optimized to have a GC content between 55% and 64%.
202. The pharmaceutical composition of any one of claims 155 to 201, wherein the oRNA has a length of about 0.1 to about 15 kilobases.
203. The pharmaceutical composition according to any one of claims 155 to 202, having a duration of in vivo therapeutic effect of at least 20 hours in the human body.
204. The pharmaceutical composition according to any one of claims 155 to 203, having a functional half-life of at least 6 hours.
205. The pharmaceutical composition according to any one of claims 155 to 204, wherein the duration of therapeutic effect in human cells is greater than or equal to that of equivalent linear RNA polynucleotides containing the same expression sequence.
206. The pharmaceutical composition according to any one of claims 155 to 205, wherein the duration of in vivo therapeutic effect in humans is greater than that of equivalent linear RNA polynucleotides having the same expression sequence.
207. The pharmaceutical composition of any one of claims 155 to 206, wherein the oRNA is composed of natural nucleotides.
208. The pharmaceutical composition of any one of claims 155 to 207, wherein the pharmaceutical composition is formulated for delivery to T cells via electroporation.
209. The pharmaceutical composition of any one of claims 155 to 208, wherein the oRNA is contained in a nucleic acid expression vector.
210. The pharmaceutical composition of claim 209, wherein the nucleic acid expression vector is selected from the group consisting of: PCR products, linearized plasmids, nonlinearized plasmids, linearized microloops, nonlinearized microloops, granules, cDNA, or artificial chromosomes.
211. The pharmaceutical composition of any one of claims 155, 157, 165, 173, and 181, wherein the transfer medium comprises nanoparticles.
212. The pharmaceutical composition of claim 211, wherein the nanoparticles are lipid nanoparticles, core-shell nanoparticles, biodegradable nanoparticles, biodegradable lipid nanoparticles, polymer nanoparticles, polymeric complexes, or biodegradable polymer nanoparticles.
213. The pharmaceutical composition of claim 211 or 212, wherein the nanoparticles are lipid nanoparticles, core-shell nanoparticles, or biodegradable nanoparticles.
214. The pharmaceutical composition of any one of claims 211 to 213, wherein the nanoparticles comprise one or more cationic lipids, ionizable lipids, or poly-β-amino esters or combinations thereof.
215. The pharmaceutical composition of any one of claims 211 to 214, wherein the nanoparticles comprise one or more non-cationic lipids.
216. The pharmaceutical composition of any one of claims 211 to 215, wherein the nanoparticles comprise one or more PEG-modified lipids, structural lipids, auxiliary lipids, polyglutamic lipids, or hyaluronic acid lipids, or combinations thereof.
217. The pharmaceutical composition of claim 216, wherein one or more structural lipids comprise cholesterol.
218. The pharmaceutical composition of any one of claims 211 to 217, wherein the nanoparticles comprise arachidonic acid, leukotrienes, oleic acid, or combinations thereof.
219. The pharmaceutical composition of any one of claims 214 to 218, wherein the molar ratio of the ionizable lipids in the transfer medium is about 40 to about 60% of the total lipids present in the transfer medium.
220. The pharmaceutical composition of claims 214 to 219, wherein the molar ratio of the auxiliary lipids in the transfer medium is from about 3.5% to about 14% of the total lipids present in the transfer medium.
221. The pharmaceutical composition of any one of claims 214 to 220, wherein the molar ratio of the PEG-lipid in the transfer medium is about 0.5% to about 5% of the total lipids present in the LNP.
222. The pharmaceutical composition of any one of claims 214 to 221, wherein the structural lipids in the transfer medium comprise about 28% to about 50% of the total lipids present in the transfer medium.
223. The pharmaceutical composition of any one of claims 214 to 222, wherein the molar ratio of ionizable lipid:helper lipid:structural lipid:PEG-lipid is about 45:9:44:2, about 50:10:38.5:1.5, about 41:12:45:2, about 62:4:33:1 or about 53:5:41:
1.
224. The pharmaceutical composition of any one of claims 214 to 223, wherein the nanoparticles have a lipid to phosphate (IL:P) ratio of about 3 to about 6, such as about 3, about 4, about 4.5, about 5, about 5.5, or about 6.
225. The pharmaceutical composition of any one of claims 155 or 157 to 224, wherein the transfer medium is formulated for endosomal release of the circular RNA polynucleotide.
226. The pharmaceutical composition of claims 211 to 225, wherein the nanoparticles comprise a targeting portion operatively connected thereto, wherein the targeting portion mediates receptor-mediated endocytosis, endosome fusion, or direct fusion into T cells in the absence of cell separation or purification.
227. The pharmaceutical composition of claim 226, wherein the targeting portion comprises small molecules, scFv, nanobodies, peptides, cyclic peptides, bicyclic or tricyclic peptides, microantibodies, polynucleotides, aptamers, engineered scaffold proteins, heavy chain variable regions, light chain variable regions, or fragments thereof.
228. The pharmaceutical composition of any one of claims 155 to 227, wherein the transfer medium comprises liposomes, dendritic polymers, carbohydrate carriers, polysaccharide nanomaterials, fusion bodies, exogens, or combinations thereof.
229. The pharmaceutical composition of any one of claims 155 to 228, wherein the T cell is a CD8+ cytotoxic T cell, a CD4+ helper T cell (Th), a regulatory T (Treg) cell, a memory T cell, or a primordial-like T cell.
230. The pharmaceutical composition of claim 229, wherein the Th cell is a Th1 cell, a Th2 cell, a Th17 cell, a Th9 cell, a Tfh cell, or a Th22 cell.
231. The pharmaceutical composition of claim 229, wherein the memory T cell is a central memory T cell (Tcm), an effector memory T cell (Tem), a tissue-resident memory T cell (Trm), or a virtual memory T cell.
232. The pharmaceutical composition of claim 229, wherein the innate-like T cells are natural killer T (NKT) cells, mucosa-associated invariant T (MAIT) cells, or γδT cells (γδT cells).
233. A T cell comprising oRNA or precursor RNA polynucleotide as claimed in any one of claims 1 to 154 or a pharmaceutical composition as claimed in any one of claims 155 to 232.
234. The T cell of claim 233, wherein the T cell is a human T cell.
235. The T cell as described in claim 233 or 234, wherein the T cell is a CD8+ cytotoxic T cell, a CD4+ helper T cell (Th), a regulatory T (Treg) cell, a memory T cell, or a primordial-like T cell.
236. The T cell of claim 235, wherein the Th cell is a Th1 cell, a Th2 cell, a Th17 cell, a Th9 cell, a Tfh cell, or a Th22 cell.
237. The T cell of claim 235, wherein the memory T cell is a central memory T cell (Tcm), an effector memory T cell (Tem), a tissue-resident memory T cell (Trm), or a virtual memory T cell.
238. The T cell of claim 235, wherein the innate-like T cell is a natural killer T (NKT) cell, a mucosa-associated invariant T (MAIT) cell, or a γδT cell.
239. A eukaryotic cell comprising oRNA or precursor RNA polynucleotide as claimed in any one of claims 1 to 154 or a pharmaceutical composition as claimed in any one of claims 155 to 228.
240. The eukaryotic cell of claim 239, wherein the eukaryotic cell is a human cell.
241. The eukaryotic cell of claim 239 or 240, wherein the eukaryotic cell is an immune cell.
242. The eukaryotic cell according to any one of claims 239 to 241, wherein the eukaryotic cell is a T cell, dendritic cell, macrophage, B cell, neutrophil or basophil.
243. A prokaryotic cell comprising oRNA or precursor RNA polynucleotide as claimed in any one of claims 1 to 154 or a pharmaceutical composition as claimed in any one of claims 155 to 228.
244. A method of expressing a therapeutic protein in a cell, comprising contacting the cell with an oRNA or precursor RNA polynucleotide as described in any one of claims 1 to 154 or a pharmaceutical composition as described in any one of claims 155 to 232, thereby expressing the therapeutic protein in the cell.
245. A method for expressing a protein from an oRNA molecule, comprising providing an oRNA containing an IRES adjacent to a sequence selected from any one of SEQ ID NO:14067-24829 or having a common sequence shown in any one of SEQ ID NO:24867-24892.
246. A method for expressing a protein from an oRNA molecule in a T cell, comprising providing the T cell with an oRNA containing an IRES adjacent to a sequence selected from any one of SEQ ID NO: 793, 876, 1017, 1216 and 3291.
247. A method for expressing a protein from an oRNA molecule in T cells, comprising providing the T cells with a protein containing a protein selected from SEQ ID NO: 75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 922, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 1193, 11... The oRNA of IRES for any of the sequences shown in 98, 1263, 1276, 1280, 1282, 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299 and 3301.
248. A method of delivering oRNA or its RNA precursor to T cells, comprising oRNA or precursor RNA polynucleotide as claimed in any one of claims 1 to 154 or a pharmaceutical composition as claimed in any one of claims 155 to 232.
249. The method of claim 248, wherein delivery to the T cells is performed using electroporation.
250. A method of treating a subject suffering from a disease or condition, the method comprising administering to the subject a pharmaceutical composition as described in any one of claims 155 to 232.
251. A method of treating a subject suffering from a disease or condition, the method comprising administering T cells as described in any one of claims 233 to 238 to the subject.
252. The method of any one of claims 250 or 251, wherein the disease or condition is cancer.
253. The method of any one of claims 250 or 251, wherein the disease or condition is an autoimmune disease or condition.
254. The method of any one of claims 250 to 253, wherein the subject is a human being.
255. A method for identifying translation initiation element (TIE) sequences capable of driving protein expression, comprising: a. Obtain a pool of RNA molecules containing TIEs. b. Transfect the RNA molecule into cells containing one or more ribosomes. c. Lyse the cells and add the contents of the lysed cells to a gradient for grading based on ribosome loading, and d. Select a combination of RNA and TIE that can load the RNA into the ribosome.
256. The method of claim 255, wherein the RNA molecule comprises circular RNA or linear RNA.
257. The method of claim 255, wherein the TIE is an internal ribosome entry site (IRES).
258. The method of claim 255, wherein the cell is a mammalian cell.
259. The method of claim 255, wherein the gradient is a sucrose gradient.
260. The method of claim 255, further comprising centrifuging the contents of the lysed cells prior to grading.
261. A method for identifying a circular RNA sequence capable of driving protein expression, comprising: a. Obtain a pool of RNA molecules containing TIEs. b. Transfect the RNA molecule into cells containing one or more ribosomes. c. Lyse the cells and add the contents of the lysed cells to a gradient for grading based on ribosome loading, and d. Select a combination of RNA and TIE that can load the RNA into the ribosome.
262. The method of claim 255, wherein the TIE sequence is used to identify a TIE sequence capable of driving protein expression in a circular RNA, the circular RNA comprising the TIE operatively linked to a sequence encoding the protein.
263. The method of claim 262, used to identify a TIE sequence that, under comparable conditions, can have higher translation efficiency compared to a TIE containing SEQ ID NO:3282.