Grifola frondosa strain and method for co-producing extracellular xylanase and cellulase through solid fermentation by using same
By optimizing the culture medium and fermentation conditions, the problem of large-scale cultivation and enzyme synthesis of Grifola frondosa was solved using the Grifola frondosa strain Grifola frondosa SiL91. This enabled the efficient co-production of extracellular xylanase and cellulase, which can be applied in the food, feed and fertilizer fields.
Patent Information
- Application Number
- CN202610189242.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-10
- Publication Date
- 2026-05-19
AI Technical Summary
Existing cultivation methods for Grifola frondosa suffer from problems such as long production cycles, high environmental dependence, large yield fluctuations, and weak stress resistance, making it difficult to meet the needs of large-scale development. Furthermore, enzyme synthesis and accumulation during solid-state fermentation depend on the growth and development of the bacterial strain, and the optimization of the culture medium is insufficient.
Using the Grifola frondosa strain SiL91, solid-state fermentation was carried out to co-produce extracellular xylanase and cellulase by optimizing the activation, liquid and fermentation culture media, including peeled potatoes, glucose, Mongolian oak, sulfate and other components, and optimizing the addition of carbon source, nitrogen source and trace elements.
It increases the yield of extracellular xylanase and cellulase, enhances the enzyme activity of fermentation broth, and achieves efficient degradation of xylan and cellulose, which can be applied in food, feed and fertilizer fields to promote animal growth and food processing.
Smart Images
Figure SMS_1 
Figure SMS_2
Abstract
Description
Technical Field
[0001] This invention relates to a strain of Grifola frondosa, specifically to a strain of Grifola frondosa and a method for co-producing extracellular xylanase and cellulase using the strain through solid-state fermentation. Background Technology
[0002] Grifola frondosa Leafy Crane (Dicks.) Gray, belonging to the kingdom Fungi, phylum Basidiomycota, class Agaromycetes, order Polyporales, family Grifolaceae, genus Grifola. Grifola Commonly known as the maitake mushroom, chestnut mushroom, lotus mushroom, and forest chicken mushroom, the fruiting body of Grifola frondosa is a well-known medicinal and edible fungus. It is rich in polysaccharides, polyphenols, alkaloids, and other components, and has been proven to possess various biological activities such as immunomodulation, antiviral, antitumor, antioxidant, blood pressure stabilization, and blood sugar reduction, making it a promising candidate for market applications.
[0003] Grifola frondosa is a typical temperate to subtropical widespread wood-decaying fungus, distributed throughout both northern and southern my country. It is commonly found on the base of stumps or decaying trunks of Fagaceae trees such as oak, chestnut, and Castanopsis, as well as broadleaf trees. This natural distribution has led to a substrate preference, resulting in a long-term co-evolutionary relationship between Grifola frondosa and hardwoods. This not only gives it a highly efficient ability to degrade hardwood fiber substrates but also provides a core ecological basis for substrate selection in artificial cultivation. Currently, the acquisition of active ingredients from Grifola frondosa mainly relies on fruiting body cultivation, but this method has a long production cycle and is greatly constrained by environmental and seasonal factors, making it difficult to meet the needs of large-scale development.
[0004] Most cultivated varieties of Grifola frondosa in my country are derived from domesticated wild germplasm resources or introduced from Japanese varieties. However, due to the limited research on the genetic background of wild germplasm and the often limited adaptability of introduced Japanese varieties to the local environment, problems such as large yield fluctuations and weak stress resistance are prone to occur during cultivation. Solid-state fermentation technology has advantages such as controllable conditions and ease of large-scale production, making it an effective way to efficiently and stably obtain fungal bioactive substances. However, the synthesis and accumulation of fermentation products are highly dependent on the growth and development of the fungal strain. Optimizing key culture media and conditions, such as carbon and nitrogen sources, during the cultivation process is crucial for improving the metabolism of the strain and the accumulation of organic matter. Summary of the Invention
[0005] To address the aforementioned problems, this invention discloses a strain of Grifola frondosa and a method for co-producing extracellular xylanase and cellulase using this strain through solid-state fermentation.
[0006] This invention is achieved through the following technical solution: In a first aspect, this invention discloses a strain of Grifola frondosa. Grifola. frondosa SiL91 was deposited on February 3, 2026 at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 42572.
[0007] Secondly, this invention discloses a method for co-producing extracellular xylanase and cellulase using the Grifola frondosa strain SiL91 through solid-state fermentation, comprising the following steps: (1) Inoculate the Grifola frondosa strain onto an activation medium and activate it for culture; (2) The activated strain is inoculated onto a liquid culture medium and cultured to prepare a seed suspension; (3) Inoculate the seed suspension onto the fermentation medium and culture to obtain a fermentation broth containing xylanase and cellulase.
[0008] Furthermore, the activation culture medium consisted of: 300g peeled potatoes, 20g glucose, 20g agar, 1g potassium dihydrogen phosphate, 1L deionized water, pH 5, 1×10⁻⁶. 5 Autoclave at 30 min; incubate at 28℃ for 10 days.
[0009] Furthermore, the liquid culture medium consisted of: 300g peeled potatoes, 20g glucose, 1g potassium dihydrogen phosphate, 1L deionized water, pH 5, 1×10⁻⁶. 5 Autoclaving at 30 min; followed by incubation at 28°C with shaking at 150 rpm for 7 days.
[0010] Furthermore, the fermentation medium consisted of: 20g peeled potato, 10g glucose, 5g Mongolian oak, 1g potassium dihydrogen phosphate, 0.3g zinc sulfate heptahydrate, 0.6g magnesium sulfate heptahydrate, 0.6g copper sulfate pentahydrate, 7g wheat bran, 10g ammonium chloride, 0.2g manganese chloride tetrahydrate, 3mg sodium molybdate dihydrate, 0.1g ferric citrate, 2mg cobalt chloride hexahydrate, 75mL deionized water, pH 5, 1×10⁻⁶. 5 Autoclaving at 30 min; inoculation amount: 10% seed suspension (by volume); incubation at 28°C for 6 weeks.
[0011] Thirdly, this invention discloses the application of Grifola frondosa strains that co-produce xylanase and cellulase in the preparation of xylan- and cellulose-degrading products.
[0012] Furthermore, the product in question is food, feed, or fertilizer, etc.
[0013] Beneficial effects This invention optimizes key culture media and conditions such as carbon and nitrogen sources during the cultivation process, improves strain metabolism and organic matter accumulation, and co-produces extracellular xylanase and cellulase, resulting in higher enzyme production.
[0014] The strains of this invention are of significant value for the industrial utilization of cellulase and xylanase resources. For example, adding them to feed can efficiently degrade indigestible components in feed ingredients such as straw and wheat bran, improving the overall digestibility and utilization of feed, promoting animal absorption and utilization, and thus promoting animal growth and development. Alternatively, they can be applied to food processing to directionally degrade cellulose and xylan in raw materials, which can improve the juice yield of fruits and vegetables, the water solubility of grain products, and can also prepare functional oligosaccharides, enriching the nutrition and quality of food.
[0015] Microbial strain preservation information Preservation period: February 3, 2026; Preservation institution: China General Microbiological Culture Collection Center, China Committee on the Preservation and Management of Microbial Culture Collections; Accession number: CGMCC No. 42572; Address of the depositary: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing; Category Naming: Grifola. frondosa (Dicks.) Gray. Detailed Implementation
[0016] The technical solution of the present invention will be further illustrated below through specific embodiments. Those skilled in the art should understand that the embodiments described are merely illustrative of the present invention and should not be construed as limiting the invention in any way.
[0017] In the following embodiments, unless otherwise specified, the reagents and consumables used were purchased from conventional reagent manufacturers in the art; unless otherwise specified, the experimental methods and techniques used were conventional methods and techniques in the art.
[0018] Example 1: Isolation and Screening of Strains Test strain: Grifola frondosa G. frondosa Strain SiL91 was collected from Xiaowutai Nature Reserve, Zhangjiakou City, Hebei Province, with Mongolian oak as its host. Quercus mongolica The specimen, *Dalbergia odorifera*, was deposited on February 3, 2026, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 42572.
[0019] Fruiting body morphological characteristics: Basidiocarp is annual, stalked, with branches from the base forming numerous caps with lateral stalks, imbricate and overlapping, fleshy when fresh, with a nutty aroma, becoming soft and woody when dry; cap petal-shaped, extending 6cm outward, 6cm wide, 0.5cm thick at the base, grayish-white to light brown, smooth, with indistinct radial stripes; margin the same color as the cap surface, wavy, curling downwards when dry; pore surface white to cream-colored, irregular in shape, 2 per mm; margin thin, torn; flesh white to cream-colored, soft and woody, 3mm thick; tubes the same color as the pore surface, brittle, extending to the upper part of the stalk, 2mm long; stalk much-branched, cream-colored, 6cm long, 1.2cm in diameter.
[0020] Microstructural characteristics: Hyphae are a systemic structure with clamp connections, showing no dextrin-like or blue-loving reactions, and remain unchanged in potassium hydroxide; Flesh hyphae are colorless, thick-walled, unbranched, with clamp connections, loosely interwoven, and 3.7–9.2 µm in diameter; Tube hyphae are colorless, thin-walled, sparsely branched, with clamp connections, loosely interwoven, and 2.7–4.7 µm in diameter; No cystidia are present in the hymenium; Basidiospores are long and club-shaped, with four basidiospores at the apex. The pedicel, with clamp connections at the base, is 20.5–27.7 µm long and 5.4–6.7 µm wide. The basidiospores are oval to elliptical, colorless, thin-walled, smooth, and without dextrin or blue-loving reactions. They are (5.1–)5.2–6.7(–6.9) µm long and (3.6–)3.8–4.2(–4.4) µm wide, with an average length of 5.91 µm and an average width of 4.01 µm. The length-to-width ratio is 1.47 (30 spores were measured).
[0021] Strain molecular identification: Genomic DNA was extracted from the isolated strain SiL91 using the FH Plant DNA Kit. Using this DNA as a template, PCR amplification was performed on the internal transcribed spacer (ITS) region. Primers were drawn from the ITS5 (5′−GGAAGTAAAAGTCGTAACAAGG−3′) / ITS4 (5′−TCCTCCGCTTATTGATATGC−3′) genes. The total system volume was 30 μL: 15 μL of 2×EasyTaq PCR SuperMix, 1 μL of primer ITS5 (10 μmol / L), 1 μL of primer ITS4 (10 μmol / L), 1 μL of genomic DNA, and 12 μL of deionized water. The PCR program was as follows: 95℃ pre-denaturation for 3 min; 94℃ denaturation for 40 s, 54℃ annealing for 45 s, 72℃ extension for 1 min, repeated for 34 cycles; final extension at 72℃ for 10 min; and incubation at 4℃. The PCR products were sent to Beijing BGI Genomics Co., Ltd. for sequencing.
[0022] Alignment: The sequencing results were compared using BLAST in the NCBI (National Center for Biotechnology Information) database (https: / / www.ncbi.nlm.nih.gov / ). The result showed the highest similarity to *Grifola frondosa*, therefore strain SiL91 was identified as... Leafy Crane (Dicks.) Gray, GenBank registration number PX916287.
[0023] Example 2: Strains co-producing xylanase and cellulase Enzyme extraction: Add 20 mL of 0.1 mol / L citrate-phosphate buffer (pH 5) to a 500 mL Erlenmeyer flask, shake and extract overnight at 150 r / min, centrifuge at 12000 r / min for 20 min at 4 °C, and obtain the supernatant, which is Grifola frondosa. G. frondosa Extracellular enzyme solution.
[0024] Enzyme activity assay: Accurately weigh 3.15 g of 3,5-dinitrosalicylic acid and dissolve it in 0.5 L of deionized water. Stir for 5 s, heat in a water bath to 45 °C, and then add 0.1 L of 0.2 g / mL sodium hydroxide solution, stirring continuously until the solution is clear and transparent. Then, gradually add 91 g of potassium sodium tartrate tetrahydrate, 2.5 g of phenol, and 2.5 g of sodium sulfite. Heat in a water bath at 45 °C, and add 0.3 L of deionized water, stirring continuously until the added substances are completely dissolved. After the solution cools to room temperature, dilute to 1 L with deionized water and store at 25 °C in the dark for 7 days to obtain the 3,5-dinitrosalicylic acid reagent. Add 0.5 mL of glucose standard solutions at concentrations of 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, and 0.7 mg / mL to 1.5 mL of 3,5-dinitrosalicylic acid reagent. Mix thoroughly and incubate in a boiling water bath for 5 min. After cooling, dilute to 20 mL with deionized water and measure the absorbance at 540 nm. Perform three replicates and calculate the average. Plot a standard curve with the concentration of glucose standard in the reaction system on the x-axis and the absorbance on the y-axis. Calculate the regression equation: y =0.0576 x -0.0136, correlation coefficient R 2 =0.9971.
[0025] For the determination of xylanase activity, 0.25 mL of the supernatant was added to 0.75 mL of 0.5% (m / V) xylan solution prepared with 0.1 mol / L acetate-sodium acetate buffer (pH 4.6). After thorough mixing, the solution was incubated in a water bath at 50 °C for 30 min. Immediately after incubation, 0.75 mL of 3,5-dinitrosalicylic acid reagent was added, and the solution was boiled for 10 min. After cooling, the solution was diluted to 10 mL with deionized water.
[0026] For the determination of cellulase activity on filter paper, 0.5 mL of the supernatant was taken and 1.5 mL of 0.05 mol / L citrate-phosphate buffer (pH 5) was added. After thorough mixing, the mixture was incubated in a 50°C water bath for 10 min. Then, 0.05 g of filter paper strip (quantitative filter paper, about 1 cm × 6 cm) was added and incubated in a 50°C water bath for 1 h. Immediately after removing the mixture, 1.5 mL of 3,5-dinitrosalicylic acid reagent was added. The mixture was boiled for 5 min and then cooled. The volume was then adjusted to 20 mL with deionized water.
[0027] The absorbance was measured at 540 nm. Three replicates were performed, and the average value was calculated. Blanks and controls were established by replacing the supernatant with deionized water and the 3,5-dinitrosalicylic acid reagent, respectively. The amount of enzyme required to catalyze the production of 1 μmol of glucose within 1 min at 25 °C was defined as one unit (U) of xylanase or filter paper cellulase activity.
[0028] Activation medium preparation: 300g peeled potatoes, 20g glucose, 20g agar, 1g potassium dihydrogen phosphate, 1L deionized water, pH 5, 1×10⁻⁶ 5 Autoclaving at 30 min.
[0029] Liquid culture medium preparation: 300g peeled potatoes, 20g glucose, 1g potassium dihydrogen phosphate, 1L deionized water, pH 5, 1×10⁻⁶ 5 Autoclaving at 30 min.
[0030] Seed suspension preparation: The strain was cultured at 28°C for 10 days on activation medium. 100 mL of liquid medium was dispensed into a 250 mL Erlenmeyer flask, and five 1 cm diameter mycelial discs were inoculated. The cultures were then cultured at 28°C with shaking at 150 rpm for 7 days. The culture was then homogenized in a clean bench using an internal homogenizer at 5000 rpm for 1 minute to form a seed suspension.
[0031] Fermentation medium preparation (specific components are shown in Table 1): 20g peeled potato, 10g glucose, 5g Mongolian oak, 1g potassium dihydrogen phosphate, 0.3g zinc sulfate heptahydrate, 0.6g magnesium sulfate heptahydrate, 0.6g copper sulfate pentahydrate, 5g wheat bran, 10g ammonium chloride, 0.2g manganese chloride tetrahydrate, 3mg sodium molybdate dihydrate, 0.1g ferric citrate, 2mg cobalt chloride hexahydrate, 75mL deionized water, pH 5, 1×10⁻⁶ 5 Autoclaving at 30 min.
[0032] Solid culture: 10% (v / v) seed suspension was inoculated into 500mL Erlenmeyer flasks containing the above fermentation medium and cultured at 28°C for 6 weeks. The enzyme extraction and enzyme activity assay procedures described above were followed to determine the presence of *Grifola frondosa*. G. frondosaThe optimal scheme for the co-production of extracellular xylanase and cellulase.
[0033] Table 1. Levels of each factor and experimental results (Other components are as follows: 20g peeled potato, 10g glucose, 1g potassium dihydrogen phosphate, 0.3g zinc sulfate heptahydrate, 0.6g magnesium sulfate heptahydrate, 10g ammonium chloride, 0.2g manganese chloride tetrahydrate, 2mg cobalt chloride hexahydrate, 75mL deionized water) Enzyme activity units U / L: represent the activity units of xylanase or filter paper cellulase per liter of fermentation broth that can catalyze the degradation of the corresponding substrate xylan or filter paper cellulose.
[0034] As shown in Table 1, in this invention, *Quercus mongolica* serves as one of the carbon sources, providing the carbon element required for the growth of the strain and enzyme production, with an addition amount ranging from 4 to 6 g; copper sulfate pentahydrate, as a trace element additive, participates in the synthesis of the strain's metabolic enzyme system and regulates enzyme production efficiency, with an addition amount ranging from 0.3 to 0.7 g; wheat bran provides carbon and nitrogen sources and is rich in substrates such as cellulose and xylan, which can induce the strain to synthesize xylanase and cellulase, with an addition amount ranging from 5 to 7 g; sodium molybdate dihydrate, as a trace element, assists in regulating the strain's metabolism and promotes the secretion of extracellular enzymes, with an addition amount ranging from 1 to 5 mg; ferric citrate provides iron element, affecting enzyme production efficiency, with an addition amount ranging from 0.025 to 0.175 g. At this point, the extracellular xylanase activity obtained from fermentation ranges from 702.91 to 972.45 U / L, and the filter paper cellulase activity ranges from 815.09 to 1127.64 U / L.
[0035] In this invention, when 5g of Mongolian oak, 0.3g of copper sulfate pentahydrate, 7g of wheat bran, 3mg of sodium molybdate dihydrate, and 0.1g of ferric citrate were added, the highest xylanase activity obtained from fermentation was 972.45U / L, and the highest filter paper cellulase activity was 1127.64U / L.
[0036] The different amounts of fermentation substrate added in this invention have varying effects on the xylanase and filter paper cellulase activities produced by the *Grifola frondosa* strain, providing data for optimizing the fermentation process and increasing enzyme yield. The *Grifola frondosa* strain or fermentation broth of this invention has great potential for use in the degradation of xylan and cellulose.
[0037] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details of the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.
Claims
1. A strain of Grifola frondosa that co-produces cellulase and xylanase, characterized in that, Grifola frondosa strain Grifola. frondosa SiL91 was deposited on February 3, 2026, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 42572.
2. A method for co-producing extracellular xylanase and cellulase using Grifola frondosa strain SiL91 via solid-state fermentation, characterized in that, Includes the following steps: (1) Inoculate the Grifola frondosa strain onto an activation medium and activate it for culture; (2) The activated strain is inoculated onto a liquid culture medium and cultured to prepare a seed suspension; (3) Inoculate the seed suspension onto the fermentation medium and culture to obtain a fermentation broth containing xylanase and cellulase.
3. The method according to claim 2, characterized in that, In step (1), the activation culture medium consisted of 300g peeled potatoes, 20g glucose, 20g agar, 1g potassium dihydrogen phosphate, 1L deionized water, pH 5, and 1×10⁻⁶ ppm. 5 Autoclave at 30 min; incubate at 28℃ for 10 days.
4. The method according to claim 2, characterized in that, In step (2), the liquid culture medium consists of 300g peeled potatoes, 20g glucose, 1g potassium dihydrogen phosphate, 1L deionized water, pH 5, and 1×10⁻⁶ ppm. 5 Autoclaving at 30 min; followed by incubation at 28°C with shaking at 150 rpm for 7 days.
5. The method according to claim 2, characterized in that, In step (3), the fermentation medium is as follows: 20g peeled potato, 10g glucose, 5g Mongolian oak, 1g potassium dihydrogen phosphate, 0.3g zinc sulfate heptahydrate, 0.6g magnesium sulfate heptahydrate, 0.6g copper sulfate pentahydrate, 7g wheat bran, 10g ammonium chloride, 0.2g manganese chloride tetrahydrate, 3mg sodium molybdate dihydrate, 0.1g ferric citrate, 2mg cobalt chloride hexahydrate, 75mL deionized water, pH 5, 1×10⁻⁶ 5 Autoclaving at 30 min; inoculation amount: 10% seed suspension (by volume); incubation at 28°C for 6 weeks.
6. Application of a Grifola frondosa strain that co-produces cellulase and xylanase, or its fermentation broth, in the preparation of xylan- and cellulose-degrading products.
7. The application according to claim 6, characterized in that, The products mentioned are food, feed, or fertilizer.