Tobacco gene NbHIRP1 as well as silencing sequence, silencing vector and application thereof

By designing a silencing sequence and vector for NbHIRP1 in tobacco and using VIGS technology to silence the NbHIRP1 gene expression, the problem of tobacco's susceptibility to Phytophthora infestation was solved, resulting in a significant enhancement of disease resistance and a 65% reduction in lesion area.

CN122060733APending Publication Date: 2026-05-19SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SOUTH CHINA AGRICULTURAL UNIVERSITY
Filing Date
2026-02-04
Publication Date
2026-05-19

AI Technical Summary

Technical Problem

Tobacco plants are susceptible to Phytophthora infestation, leading to severe Phytophthora disease, which is difficult to control effectively with existing technologies.

Method used

The silencing sequence and silencing vector of the tobacco gene NbHIRP1 were designed and transiently expressed in tobacco through VIGS-mediated expression to silence the expression of the NbHIRP1 gene, thereby enhancing plant disease resistance using engineered Agrobacterium.

Benefits of technology

It effectively reduces the infection effect of Phytophthora capsici, enhances the resistance of tobacco to Phytophthora capsici, significantly reduces the lesion area, and has a silencing efficiency of 65%.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122060733A_ABST
    Figure CN122060733A_ABST
Patent Text Reader

Abstract

The invention discloses a tobacco gene NbHIRP1 as well as a silent sequence, a silent vector and application thereof. The tobacco gene NbHIRP1 is separated from tobacco, the full-length cDNA (complementary deoxyribonucleic acid) of the gene is 996bp, and protein coded by the gene is repeated receptor-like protein rich in leucine and composed of 331 amino acids in full length. The gene is transiently expressed in tobacco, phytophthora capsici is inoculated after two days, and the expression of the gene can promote infection of the phytophthora capsici. A target sequence for silencing the gene is designed, after VIGS-mediated transfer into a tobacco leaf for transient expression, sequencing verification proves that the expression of the gene can be effectively silenced, and a phytophthora capsici infection experiment result shows that after the expression of the gene is silenced, the infection effect of phytophthora capsici can be effectively reduced, and the infection effect of the phytophthora capsici can be effectively improved. It is proved that the effect of enhancing resistance is achieved by silencing expression of the gene.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering, and specifically relates to a tobacco gene NbHIRP1, its silencing sequence, silencing vector, and applications. Background Technology

[0002] Tobacco, as an important economic crop, has a long history of cultivation worldwide. It not only impacts the agricultural economies of many tobacco-producing regions but also, due to its unique leaf characteristics, makes it a target for various pathogens. During its growth, especially in warm and humid climates, tobacco plants are highly susceptible to infection by various fungi and oomycetes. Among these, Phytophthora blight is one of the most threatening diseases, often causing severe losses to tobacco production.

[0003] Phytophthora diseases are primarily caused by the fungus Phytophthora, a type of oomycete. Although often mistaken for fungi, its biological characteristics differ significantly from those of fungi. Phytophthora produces zoospores that spread rapidly with the aid of water, infecting multiple parts of the plant, including the roots, stems, and leaves. Under suitable conditions, the disease spreads extremely quickly, potentially leading to wilting, rotting, and even widespread death of plants. This type of disease not only affects tobacco but also widely damages other crops, making it a historically significant and difficult-to-control disease in agricultural production.

[0004] When tobacco is infected with Phytophthora, it often creates a highly destructive combination. The large leaves and dense growth of tobacco plants easily create a humid microclimate in the field, providing ideal conditions for the reproduction and spread of Phytophthora. After infecting tobacco, Phytophthora often leads to typical diseases such as black shank, causing the base of the stem to turn black and rot, ultimately resulting in the entire plant collapsing and dying. Historically, Phytophthora has repeatedly broken out in tobacco-growing areas, causing large-scale yield losses, and it remains a significant biological threat in tobacco agriculture that requires continuous monitoring and control. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings and deficiencies of the prior art and provide a tobacco gene NbHIRP1.

[0006] Another object of the present invention is to provide a silencing sequence and silencing vector for the tobacco gene NbHIRP1.

[0007] Another object of the present invention is to provide the application of the above-mentioned silencing sequence and silencing vector of the tobacco gene NbHIRP1.

[0008] The objective of this invention is achieved through the following technical solution:

[0009] A silencing sequence for the tobacco gene NbHIRP1, the nucleotide sequence of which is at least one of the following:

[0010] (a) The nucleotide sequence shown in SEQ ID NO.3;

[0011] (b) Analogs of the nucleotide sequences in (a) above that still retain the function of the silent tobacco gene NbHIRP1, obtained by base insertion, deletion, or substitution.

[0012] A silencing vector for the tobacco gene NbHIRP1, containing the silencing sequence of the aforementioned tobacco gene NbHIRP1.

[0013] The vector backbone of the silencing vector for the tobacco gene NbHIRP1 is pTRV2.

[0014] The aforementioned silencing sequence of the tobacco gene NbHIRP1 and / or the silencing vector of the tobacco gene NbHIRP1, when expressed through VIGS-mediated expression, can knock down the expression of the tobacco gene NbHIRP1.

[0015] An engineered Agrobacterium containing a silencing vector for the aforementioned tobacco gene NbHIRP1.

[0016] A biological agent for enhancing plant disease resistance includes the aforementioned engineered Agrobacterium.

[0017] The biological agents for enhancing plant disease resistance also include Agrobacterium tumefaciens containing the pTRV1 vector.

[0018] The starting strain of Agrobacterium is Agrobacterium GV3101.

[0019] The above-mentioned silencing sequence of the tobacco gene NbHIRP1, the silencing vector of NbHIRP1, engineered Agrobacterium and / or biological agents that enhance plant disease resistance are used to improve plant disease resistance.

[0020] The disease resistance mentioned refers to improving the ability to resist infection by Phytophthora capsici.

[0021] The plant in question is Nicotiana benthamiana.

[0022] A tobacco gene NbHIRP1 has at least one of the following nucleotide sequences:

[0023] (a) The nucleotide sequence shown in SEQ ID NO.2;

[0024] (b) Analogs that still have similar functions obtained by inserting, deleting, or substituting the nucleotide sequences in (a) above.

[0025] A tobacco protein NbHIRP1 is at least one of the following:

[0026] (a) A protein consisting of the amino acid sequence shown in SEQ ID NO.1;

[0027] (b) Analogs that still have similar functions obtained by substituting, inserting, or deleting one or more amino acids of the amino acid sequence shown in SEQ ID NO.1.

[0028] The nucleotide sequence of the gene encoding the tobacco protein NbHIRP1 mentioned above was obtained according to the codon coding rules.

[0029] An expression vector containing the tobacco gene NbHIRP1, comprising the nucleotide sequence shown in SEQ ID NO.2.

[0030] The vector backbone of the expression vector containing the tobacco gene NbHIRP1 is pBin.

[0031] The above-mentioned applications of tobacco gene NbHIRP1, tobacco protein NbHIRP1, and expression vectors containing tobacco gene NbHIRP1 in screening disease-resistant plant species.

[0032] The present invention has the following advantages and effects compared with the prior art:

[0033] The tobacco gene NbHIRP1 in this invention was isolated from tobacco. The full-length cDNA of this gene is 996 bp, and the protein it encodes is a leucine-rich, repetitive receptor-like protein consisting of 331 amino acids. Transient expression of this gene in tobacco, followed by inoculation with *Phytophthora capsici* two days later, showed that gene expression promoted *Phytophthora capsici* infection. Subsequently, a target sequence for silencing this gene was designed and transiently expressed in tobacco leaves via VIGS-mediated transformation. Sequencing verification confirmed the effective silencing of gene expression. Furthermore, *Phytophthora capsici* infection experiments showed that silencing gene expression effectively reduced *Phytophthora capsici* infection, demonstrating that the enhanced resistance is achieved through silencing gene expression. Attached Figure Description

[0034] Figure 1 This is a diagram showing the experimental results of NbHIRP1 and RFP expression on tobacco infected by Phytophthora capsici in Example 2.

[0035] Figure 2 This is a statistical analysis graph showing the effect of NbHIRP1 and RFP expression on the area of ​​tobacco lesions infected by Phytophthora capsici in Example 2.

[0036] Figure 3 This is a diagram showing the results of the *Phytophthora capsici* infection experiment after NbHIRP1 silencing in Example 3.

[0037] Figure 4 This is a statistical analysis graph of the lesion area in the *Phytophthora capsici* infection experiment after NbHIRP1 silencing in Example 3.

[0038] Figure 5 This is a graph showing the NbHIRP1 silencing efficiency results detected by qRT-PCR after NbHIRP1 silencing in Example 3. Detailed Implementation

[0039] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0040] Unless otherwise specified in the following implementation plan, the test conditions are generally as per standard test conditions or the test conditions recommended by the reagent company. Unless otherwise specified, all materials and reagents used are commercially available.

[0041] The Pbin vector and Agrobacterium GV3101 involved in the embodiments of the present invention can be obtained through conventional commercial means.

[0042] Example 1 Cloning and Acquisition of the NbHIRP1 Gene

[0043] (1) A potential functional gene, NbHIRP1, was obtained through screening of a tobacco gene library. Primers (upstream primer NbHIRP1-F and downstream primer NbHIRP1-R) were designed for its sequence, as follows:

[0044] Upstream primer NbHIRP1-F:

[0045] AGCCGGTACCCCATGGCTCGCATTAC;

[0046] Downstream primer NbHIRP1-R:

[0047] TGGTCTTTGTAGTCCCCAACAAGGAAA.

[0048] (2) Total RNA (ribonucleic acid) was extracted from tobacco leaves (Sangon Biotech kit) and then the mRNA was transcribed into cDNA (5*Prime ScriptRT MaterMix amplification reagent). The target sequence was then amplified from the tobacco cDNA by PCR using the above upstream and downstream primers.

[0049] The PCR program was as follows: 95℃, 3 min; 95℃, 15 sec; 57℃, 15 sec; 72℃, 30 sec; 34 cycles; 72℃, 5 min.

[0050] (3) The PCR products were purified and separated by electrophoresis on a 1% agarose gel. The agarose gel containing the target fragment was cut and collected in a 2ml centrifuge tube, and recovered using the Omega Gel Extraction Kit. Sequencing confirmed that the NbHIRP1 gene fragment was successfully obtained, and its nucleotide sequence is shown in SEQ ID NO.2. The corresponding protein amino acid sequence is shown in SEQ ID NO.1.

[0051] Example 2: Transient expression of NbHIRP1 in tobacco

[0052] 2.1 Experimental materials (test strains, plants, and vectors)

[0053] Test strain: The wild-type strain of Phytophthora capsici (Wild Type, abbreviated as WT) is a common Phytophthora fungus that can be obtained through commercial means or isolated in nature;

[0054] Agrobacterium tumefaciens strain GV3101 is commercially available;

[0055] The test grafting plant material was Nicotiana benthamiana, which was propagated in the laboratory. The seed was sown and cultivated in a greenhouse (25℃, 16h light / 8h dark) for 4-6 weeks before being used for inoculation experiments.

[0056] Vector: Pbin::RFP, kindly provided by the Laboratory of Oomycetes and Fungal Molecular Biology, College of Plant Protection, Nanjing Agricultural University.

[0057] 2.2 Ligation of the target fragment to the vector

[0058] The NbHIRP1 target fragment amplified in Example 1 was ligated to the Pbin vector using homologous recombinase (linkage site: SmaI) to obtain the Pbin::NbHIRP1 recombinant plasmid; the RFP sequence was ligated to the Pbin vector using homologous recombinase (linkage site: SmaI) to obtain the recombinant plasmid Pbin::RFP containing the RFP tag. After propagation in Escherichia coli JM109 strain, the plasmids were extracted, and the recombinant plasmids Pbin::RFP and Pbin::NbHIRP1 were transformed into Agrobacterium GV3101.

[0059] 2.3 Transient expression of tobacco

[0060] Single colonies of Agrobacterium containing recombinant plasmids Pbin::RFP and Pbin::NbHIRP1 were picked and placed in 2 ml of LB broth containing kanamycin (50 μg / ml) and incubated at 28°C and 180 rpm for 1–2 days. The bacterial cells were collected by centrifugation at 4000 rpm for 4 min, and the precipitate was gently aerated with pre-cooled MgCl2. The cells were then centrifuged again at 4000 rpm for 4 min, and this process was repeated three times. The OD value of the bacterial culture was adjusted to 0.4–0.6 with MgCl2 before being injected into tobacco leaves, with each type of Agrobacterium injected into half of a tobacco leaf.

[0061] 2.4 Inoculation with Phytophthora capsici

[0062] Two days later, cut off the injected tobacco leaves, punch out Phytophthora capsulatum cakes with a punch, inoculate the underside of the tobacco leaves with the mycelial side down, inoculate one cake on each side of the leaf at the same location, and place them in a plastic box to keep them moist.

[0063] 2.5 Results and Discussion

[0064] Two days later, the size of the lesions infected with Phytophthora capsici was observed under ultraviolet light. The results were as follows: Figures 1-2 As shown, the lesions were significantly larger after NbHIRP1 expression compared to the control, and biostatistical analysis showed a significant difference in lesion area between the two treatments, indicating that NbHIRP1 expression promoted plant infection by Phytophthora capsici.

[0065] Example 3: VIGS-mediated silencing of the Tobacco Benedict gene

[0066] 3.1 Test Materials

[0067] Test strains and plants: Refer to Example 2.

[0068] The media: pTRV1 (NCBI database accession number: AF406990.1, update time 11-JUN-2002) and pTRV2 (NCBI database accession number: AF406991.1, update time 13-NOV-2003). Both media can be obtained through commercial channels.

[0069] 3.2 Construction of expression vector for tobacco-targeted silent genes:

[0070] The optimal target sequence for the target silence gene NbHIRP1 was predicted using the online tool SGN VIGS Tool (SEQ ID NO. 3). The amplified NbHIRP1 target fragment was ligated to the pTRV2 vector using homologous recombinase (linkage site: EcoRI) to obtain the pTRV2::NbHIRP1 recombinant plasmid. Similarly, a silence target sequence (SEQ ID NO. 4) was designed using the GUS gene as a control and ligated to the pTRV2 vector using homologous recombinase (linkage site: EcoRI) to obtain the pTRV2::GUS recombinant plasmid. After propagation in Escherichia coli JM109 strain, the plasmids were extracted, and the recombinant plasmids pTRV2::HIRP1 and pTRV2::GUS were transformed into Agrobacterium GV3101, respectively. Similarly, the helper vector pTRV1 was transformed into Agrobacterium to obtain Agrobacterium transformed with the pTRV1 vector.

[0071] 3.3 Transient expression of tobacco

[0072] Single colonies of Agrobacterium containing recombinant plasmids pTRV2::HIRP1, pTRV2::GUS, and Agrobacterium transformed with the pTRV1 vector were picked and cultured in 2 ml of LB broth containing kanamycin (50 μg / ml) for 1–2 days at 28°C and 180 rpm. Referring to the Agrobacterium-mediated transient expression method for Nicotiana benthamiana in Example 2, section 2.3, Agrobacterium-containing recombinant plasmids pTRV2::HIRP1 or pTRV2::GUS were mixed 1:1 with Agrobacterium-containing pTRV1 and injected into the leaves of 3–4 leaf stage Nicotiana benthamiana seedlings.

[0073] 3.4 Inoculation with Phytophthora capsici

[0074] Two days after the tobacco planted following the injection in 3.3, it was inoculated with Phytophthora capsici according to the method in 2.4 of Example 2. The experimental results were observed and statistically analyzed two days later.

[0075] 3.5 Verifying the efficiency of silence

[0076] (1) Sample preparation

[0077] Three weeks after the tobacco plants were planted following the injection in section 3.3, tobacco leaf samples were collected, ground into powder with liquid nitrogen, and used for subsequent RNA extraction.

[0078] (2) RNA extraction

[0079] RNA extraction was performed using the BBI All-In-One DNA / RNA Mini-Preps Kit, following the kit's instructions. The concentration, OD260 / 280, and OD260 / 230 of the RNA samples were measured using a Thermo Fisher Scientific micro-spectrophotometer.

[0080] (3) cDNA synthesis

[0081] Quality-compliant RNA was used for genomic DNA elimination and reverse transcription cDNA synthesis using the FastKing cDNA First-Strand Synthesis Kit (Tiangen). The gDNA removal reaction system was prepared as follows and incubated at 42℃ for 3 min: 2 μL of 5 × gDNA Buffer, 1000 ng of Total RNA, and up to 10 μL of RNase-Free ddH2O.

[0082] Prepare the following reverse transcription reaction mixture and add it to the gDNA removal reaction system, mixing thoroughly by pipetting: 10×King RT Buffer 2 μL, FastKing RT Enzyme Mix 1 μL, FQ-RT Primer Mix 2 μL, RNase-Free ddH2O 5 μL. The reaction conditions are: 42℃ for 15 min; 95℃ for 3 min, to obtain reverse transcribed cDNA.

[0083] Using the Primer 3 online primer design website (http: / / bioinfo.ut.ee / primer3-0.4.0 / ), NbHIRP1 gene-specific primers, NbHIRP1-qRTF and NbHIRP1-qRTR, were designed. Using the tobacco NbEF1α gene as an internal control, quantitative primers NbEF1α-qRTF and NbEF1α-qRTR were designed, and silencing efficiency was determined using qPCR. The above cDNA was used as a template for qRT-PCR analysis. The SYBR Premix Ex Taq™ kit from Takara was used for qRT-PCR, and the following reaction system was prepared:

[0084] SYBR Premix Ex TaqTM 10 μL, Template 2 μL, Forward primer 0.8 μL, Reverse primer 0.8 μL, RNase-Free ddH2O 6.4 μL.

[0085] After preparing the reaction mixture, run the qTOWER3 Real-Time PCR thermal cyclers (AnalytikJena) program. Amplification program: pre-denaturation 95℃ for 30 s; PCR reaction 95℃ for 5 s, 60℃ for 30 s, 40 cycles.

[0086] Upstream primer NbEFla-qRTF:

[0087] 5-'TTGCTTGCTTTCACCCTTGG-3'

[0088] Downstream primer NbEFla-qRTR:

[0089] 5-'TCGAAACCAGAGATGGGGAC-3'

[0090] Upstream primer: NbHIRP1-qRTF:

[0091] 5-' CTGACGCCTTCTACAAGCAC -3'

[0092] Downstream primer NbHIRP1-qRTR:

[0093] 5-' ACCTAGGTACACTTGCGGAT -3'

[0094] 3.6 Results and Discussion

[0095] Results of the Phytophthora capsici inoculation test: Figures 3-4 As shown, silencing NbHIRP1 significantly reduced lesions compared to the negative control GUS, and biostatistical analysis revealed a significant difference in lesion area between the two treatments, indicating that NbHIRP1 silencing enhanced plant resistance to Phytophthora capsici. qRT-PCR results are shown below. Figure 5 As shown, the experimental results demonstrate that NbHIRP1 in tobacco Benzoenta was successfully silenced using VIGS technology, with a silencing efficiency of 65%. This proves that the enhanced resistance effect is achieved by silencing the expression of this gene, and that silencing the expression of this gene can effectively reduce the infection effect of Phytophthora capsici.

[0096] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A silenced sequence for the tobacco gene NbHIRP1, characterized in that: Its nucleotide sequence is shown in SEQ ID NO.

3.

2. A silencing vector for the tobacco gene NbHIRP1, characterized in that: It contains the silenced sequence of the tobacco gene NbHIRP1 as described in claim 1.

3. The silencing vector for the tobacco gene NbHIRP1 according to claim 2, characterized in that: The vector backbone of the silencing vector for the tobacco gene NbHIRP1 is pTRV2.

4. An engineered Agrobacterium, characterized in that: A silencing vector containing the tobacco gene NbHIRP1 as described in claim 2 or 3.

5. A biological agent for improving plant disease resistance, comprising the engineered Agrobacterium as described in claim 4.

6. The biological agent for enhancing plant disease resistance according to claim 5, characterized in that: It also includes helper Agrobacterium containing the pTRV1 vector.

7. The application of the silenced sequence of tobacco gene NbHIRP1 as described in claim 1, the silenced vector of NbHIRP1 as described in claims 2-3, the engineered Agrobacterium as described in claim 4, and / or the biological agents for improving plant disease resistance as described in claims 5-6 in improving plant disease resistance.

8. A tobacco gene NbHIRP1, characterized in that: Its nucleotide sequence is shown in SEQ ID NO.

2.

9. A tobacco protein NbHIRP1, characterized in that: Its amino acid sequence is shown in SEQ ID NO.

1.

10. The use of the tobacco gene NbHIRP1 of claim 8 and / or the tobacco protein NbHIRP1 of claim 9 in screening disease-resistant plant species.