Natural rubber high-yield gene SCL190 of kok-saghyz and application
By overexpressing the SCL190 gene in rubber grass, the root biomass and natural rubber content of rubber grass were increased, solving the problems of low root biomass and low natural rubber content, and achieving a significant increase in the root size and natural rubber yield of rubber grass.
Patent Information
- Application Number
- CN202610193695.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-10
- Publication Date
- 2026-05-19
AI Technical Summary
The small root biomass and low natural rubber content of rubber grass limit the development of the rubber grass industry.
By overexpressing the SCL190 gene in rubber grass to increase the content or activity of SCL190 protein, the overexpression vector was introduced into rubber grass recipient material using Agrobacterium-mediated transformation, resulting in transgenic rubber grass plants with increased root biomass and natural rubber content.
It significantly increased the diameter of the taproot, the number of lateral roots and fibrous roots of rubber grass, increased the dry root weight of each rubber grass plant, and significantly increased the natural rubber content in the roots.
Smart Images

Figure CN122060751A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to the high-yield natural rubber gene SCL190 of rubber grass and its application. Background Technology
[0002] Natural rubber (NR) is an important industrial raw material, its main component being cis-1,4-polyisoprene. This material is both hard and flexible, possessing excellent electrical insulation and waterproof properties, and is widely used in industrial production, daily life, and medical protection, such as in automobile tires, children's toys, and protective gloves. Approximately 2,500 plant species on Earth can produce natural rubber, but commercially available natural rubber primarily comes from the Brazilian rubber tree (Heveabrasiliensis Muell. Arg.). Affected by rubber tree diseases, climate change, and falling prices, the global supply of natural rubber faces severe challenges. To address the natural rubber shortage crisis, there is an urgent need to develop alternative plants capable of synthesizing natural rubber, such as rubber grass (Taraxacum kok-saghyz Rodin, TKS).
[0003] Rubber grass is a fast-growing, easy-to-cultivate perennial herbaceous plant belonging to the genus *Taraxacum* in the family Asteraceae. The natural rubber extracted from its roots is very similar to that extracted from the Brazilian rubber tree in molecular structure and physicochemical properties. However, rubber grass exists in a wild or semi-wild state, resulting in small root biomass and low natural rubber content, which significantly restricts the development of the rubber grass industry. Identifying the genes regulating root development in rubber grass can provide effective genetic resources for cultivating high-quality rubber grass germplasm through molecular design breeding, which is of great significance for accelerating the domestication and improvement of rubber grass.
[0004] The splicing of precursor mRNA occurs within a large RNA-protein complex called the spliceosome, which includes serine / arginine-rich proteins (SR). Phylogenetic and comparative analysis of plant SR genes has revealed six subfamilies (SR, SC, RSZ, SCL, RS2Z, and RS), among which SCL, RS2Z, and RS are plant-specific and possess certain unique domains. These proteins play important roles in plant growth and development (Gu, J., Ma, X., Ma, Q., Xia, Z., Lin, Y., Yuan, J., Li, Y., Li, C., Chen, Y., Wang, W., Zhang, P., and Wang, Z.-Y. 2024. RNA splicing modulates the postharvest physiological deterioration of cassava storage root. Plant Physiology 196, 461-478). The SCL subfamily plays a crucial role in root development, controlling flowering, and seed development and germination. Research on the SCL subfamily in rubber grass is very limited, which greatly restricts the application of SCL subfamily proteins in the genetic improvement of rubber grass. Summary of the Invention
[0005] The purpose of this invention is to increase the root biomass and natural rubber content of rubber grass.
[0006] To achieve the above objectives, the present invention provides a nucleic acid molecule comprising any one of the following nucleotide sequences (a1)-(a4):
[0007] (a1) The nucleotide sequence shown in SEQ ID NO:1;
[0008] (a2) A nucleotide sequence that has at least 90% sequence identity with the nucleotide sequence shown in SEQ ID NO:1;
[0009] (a3) The nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO:2;
[0010] (a4) A nucleotide sequence that encodes an amino acid sequence having at least 90% sequence identity with the amino acid sequence shown in SEQ ID NO:2;
[0011] The nucleic acid molecules described therein can confer higher root biomass and natural rubber content to rubber grass that overexpresses the nucleic acid molecules.
[0012] The nucleic acid molecules can be synthesized artificially or cloned from rubber grass.
[0013] Expression cassettes, vectors, or host bacteria containing the aforementioned nucleic acid molecules are also within the scope of this invention.
[0014] The expression cassette consists of a promoter capable of initiating the expression of the nucleic acid molecule, the nucleic acid molecule, and a transcription terminator.
[0015] The vector can be a cloning vector, containing the aforementioned nucleic acid molecules and other elements required for plasmid replication. The vector can also be an expression vector, containing the aforementioned nucleic acid molecules and other elements enabling successful protein expression. The expression vector can be any suitable plant expression vector, such as the pFGC5941 vector.
[0016] The host bacterium can be a host bacterium containing the above-mentioned cloning vector, such as E. coli DH5α. The nucleic acid molecules are replicated by culturing the host bacterium under appropriate conditions. Alternatively, the host bacterium can be a host bacterium containing the above-mentioned expression vector, such as Agrobacterium tumefaciens AGL1. The expression vector is transferred into rubber grass recipient material using Agrobacterium tumefaciens-mediated genetic transformation technology to obtain transgenic rubber grass plants.
[0017] The application of the nucleic acid molecules in cultivating rubber grass plants with increased root biomass and natural rubber content also falls within the scope of this invention.
[0018] The application of the nucleic acid molecules in the production of natural rubber also falls within the scope of this invention.
[0019] The present invention also provides a method for increasing the root biomass and natural rubber content of rubber grass, comprising increasing the content or activity of SCL190 protein in rubber grass; wherein the SCL190 protein is as follows (B1) or (B2):
[0020] (B1) A protein with the amino acid sequence shown in SEQ ID NO:2;
[0021] (B2) Proteins with the same function obtained by substituting and / or deleting and / or adding one or more amino acids of the amino acid sequence shown in SEQ ID NO:2.
[0022] In the above method, the content or activity of SCL190 protein in rubber grass can be increased by overexpressing the nucleic acid molecule in rubber grass.
[0023] The present invention also provides a method for obtaining rubber grass with increased root biomass and natural rubber content, comprising: introducing an overexpression vector for overexpressing the nucleic acid molecule into rubber grass recipient material, and culturing to obtain transgenic rubber grass plants with increased root biomass and natural rubber content.
[0024] In the above method, the overexpression vector can be introduced into the rubber grass receptor material via Agrobacterium-mediated transformation.
[0025] The rubber grass recipient material can be any suitable rubber grass (Taraxacum kok-saghyz Rodin, TKS) variety or strain, such as rubber grass genome sequencing strain 1151.
[0026] Transgenic rubber grass plants with increased root biomass and natural rubber content obtained by the method also fall within the scope of this invention.
[0027] The present invention also provides a method for producing natural rubber, comprising: cultivating transgenic rubber grass plants with increased root biomass and natural rubber content and extracting natural rubber from the roots.
[0028] Natural rubber can be extracted from the roots of rubber grass using any suitable method, such as solvent extraction. Any suitable solvent can be used for extraction, such as aliphatic hydrocarbon solvents, aromatic hydrocarbon solvents, etc. In some embodiments, the rubber grass roots are dried and ground into powder, and then toluene is used to extract the natural rubber from the powder.
[0029] The present invention also provides a protein, which is (B1) or (B2) as follows:
[0030] (B1) A protein with the amino acid sequence shown in SEQ ID NO:2;
[0031] (B2) Proteins with the same function obtained by substituting and / or deleting and / or adding one or more amino acids of the amino acid sequence shown in SEQ ID NO:2.
[0032] This invention isolates the natural rubber yield control gene SCL190 (Serine / arginine-rich SC35-like splicing factor 190) from rubber grass. The coding sequence of the SCL190 gene is shown in SEQ ID NO:1, and its encoded amino acid sequence is shown in SEQ ID NO:2. Experiments have shown that overexpression of the SCL190 gene in rubber grass can significantly increase the diameter of the taproot, the number of lateral roots and fibrous roots, and the dry root weight per rubber grass plant. Figure 2 and Figure 3 ), and significantly increased the natural rubber content in the roots of rubber grass ( Figure 5 Therefore, the SCL190 gene can be used for genetic improvement to increase the natural rubber yield of rubber grass. This invention provides new genetic resources and methods for breeding new high-yielding rubber grass varieties. Attached Figure Description
[0033] Figure 1 A heatmap of standardized RPKM values shows the expression pattern of the SCL190 gene in various tissues of rubber grass.
[0034] Figure 2 Figure A shows the transcriptional level of the SCL190 gene in wild-type rubber grass (WT) and the SCL190 overexpressing line (35S::SCL190) detected by qRT-PCR. The vertical axis represents the relative expression level of the SCL190 gene, and the values are mean ± SD (n = 3). The significance analysis was performed using Student's t-test. Compared with wild-type (WT), **P < 0.01, ***P < 0.001; Figure B shows the phenotype of wild-type rubber grass (WT) and the SCL190 overexpressing line (35S::SCL190) after 3 months of growth. The scale bar is 5 cm long.
[0035] Figure 3 The results show the root phenotypic statistics of the SCL190 overexpression line of rubber grass. A represents the taproot diameter of wild-type (WT) and SCL190 overexpression line (35S::SCL190) after 3 months of growth. Values in the figure are mean ± SD (n = 25). The significance analysis was performed using Student's t-test. Compared with wild-type (WT), **P < 0.01. B represents the dry root weight of each plant in wild-type (WT) and SCL190 overexpression line (35S::SCL190) after 3 months of growth. Values in the figure are mean ± SD (n = 25). The significance analysis was performed using Student's t-test. Compared with wild-type (WT), **P < 0.01.
[0036] Figure 4 The results of root sections of the SCL190 overexpressing line of rubber grass are shown in Figure 1. A represents the cross-sectional analysis of roots of wild-type (WT) and SCL190 overexpressing line (35S::SCL190) after 3 months of growth, with a scale bar of 500 μm. B represents the statistical analysis of latex duct cell indices in roots of wild-type (WT) and SCL190 overexpressing line (35S::SCL190) after 3 months of growth. Values in the figure are mean ± SD (n = 9). The significance analysis was performed using Student's t-test. There was no significant difference in ns between the wild-type (WT) and wild-type (WT).
[0037] Figure 5Analysis results of the relative content and yield of natural rubber in the SCL190 overexpression line of Rubbergrass; A shows the relative content of natural rubber in the roots of wild-type Rubbergrass (WT) and SCL190 overexpression line (35S::SCL190) after 3 months of growth. The values in the figure are mean ± SD (n = 3). The significance analysis was performed using Student's t test. Compared with wild-type (WT), ***P < 0.001; B shows the natural rubber yield per plant of wild-type Rubbergrass (WT) and SCL190 overexpression line (35S::SCL190) after 3 months of growth. The values in the figure are mean ± SD (n = 25). The significance analysis was performed using Student's t test. Compared with wild-type (WT), ***P < 0.001. Detailed Implementation
[0038] The present invention will be described in detail below with reference to embodiments. These embodiments are merely illustrative and explanatory and do not limit the scope of the invention in any way.
[0039] Unless otherwise specified, the reagents used in the following examples are all conventional reagents in the art, commercially available or prepared according to conventional methods in the art. Unless otherwise specified, the methods used in the following examples are all conventional methods in the art, and can be found in relevant laboratory manuals, public literature, or manufacturer's instructions. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0040] The rubber grass (Taraxacum kok-saghyz Rodin, TKS) strain 1151 used in the following examples is described in the article "Lin, T., Xu, X., Ruan, J., Liu, S., Wu, S., Shao, X., Wang, X., Gan, L., Qin, B., Yang, Y., et al. (2018). Genome analysis of Taraxacum kok-saghyz Rodin provides new insights into rubber biosynthesis. Natl Sci Rev 5, 78-87." This strain is preserved and propagated in our laboratory and is available to the public from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. It is used solely for verifying the present invention.
[0041] The pFGC5941 vector used in the following examples is an Agrobacterium binary expression vector, described in the article "Lei, X.;Tan, B.; Liu, Z.; Wu, J.; Lv, J.; Gao, C. (2021). ThCOL2 Improves the SaltStress Tolerance of Tamarix hispida. Front Plant Sci 12, 653791." This vector is preserved in our laboratory and is publicly available from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. It is used solely for verifying this invention.
[0042] The Escherichia coli DH5α and Agrobacterium tumefaciens AGL1 strains used in the following examples are commercially available strains.
[0043] Some of the reagents used in the following examples: DNA polymerase KOD Plus was a Toyobo product, catalog number KOD-201. The agarose gel extraction kit was purchased from Beijing Bomei Gene Technology Co., Ltd., catalog number DH101-01. The seamless cloning kit In-Fusion Snap Assembly Master Mix was a Takara product, catalog number 638949. The basic PCR enzyme TaKaRaTaq... TM The following products were purchased: Takara (product number R001A); Plasmid mini-rapid extraction kit (product number DP102-01, Beijing Bomed Gene Technology Co., Ltd.); MS medium (product number M0222.0050, Beijing Qiweiyicheng Technology Co., Ltd.); MES, 6-BA, NAA, and plant gel (product number Sigma-Aldrich); Sucrose (product number Sinopharm Chemical Reagent Co., Ltd.); RNA rapid extraction kit (product number 0416-50, Beijing Huayueyang Biotechnology Co., Ltd.); SuperScript® III First-Strand Synthesis System (product number 18080051, Invitrogen); SsoFast EvaGreen® Supermix (product number 1725201, Bio-Rad); Oil Red O solution (product number O1391, Sigma-Aldrich); and Natural rubber standards (product number 431257-100G, Sigma-Aldrich). Narrow distribution polystyrene standard (NIM-RM2068) was purchased from the National Institute of Metrology, China.
[0044] Example 1. Cloning of the SCL190 gene in rubber grass
[0045] We identified a gene controlling natural rubber production from the rubber grass genome and named it SCL190. The coding sequence (CDS) of the rubber grass SCL190 gene is shown in SEQ ID NO:1, and its encoded amino acid sequence is shown in SEQ ID NO:2 for the SCL190 protein. To understand the expression pattern of the SCL190 gene in rubber grass in detail, we analyzed RNA-seq data from 12 tissues, including rubber grass flowers, latex, and mature leaves, previously measured by our research group. Figure 1 The relative expression levels of the SCL190 gene in various tissues of rubber grass were shown, indicating that SCL190 is a broad-spectrum expression gene, expressed in all tissues of rubber grass.
[0046] Using root cDNA from wild-type plants of the rubber grass (Taraxacum kok-saghyz Rodin, TKS) 1151 as a template, polymerase chain reaction (PCR) was performed using primers PF-SCL190-F / PF-SCL190-R and DNA polymerase KOD Plus (Toyobo, catalog number KOD-201) to amplify the full-length coding sequence of the SCL190 gene. The nucleotide sequences of the primers are as follows:
[0047] PF-SCL190-F:
[0048] 5'-CAATTACCATGGGGCGCGCC ATGGGACGACACACCAGGTC -3';
[0049] PF-SCL190-R:
[0050] 5'-CTAGACTCACCTAGGATCC TTACATTCTTTCTCGACTGAAGTCACG -3'.
[0051] The PCR system consisted of: 10×KOD Plus Buffer, 5 μL; 2 mM dNTPs, 5 μL; 25 mM MgSO4, 2 μL; DNA polymerase KOD Plus (1.0 U / μL), 1 μL; PF-SCL190-F (10 μM), 0.75 μL; PF-SCL190-R (10 μM), 0.75 μL; cDNA, 2 μL; and ddH2O to a final volume of 50 μL. The PCR program was: 94℃ for 3 min; (98℃ for 10 s, 55℃ for 30 s, 68℃ for 1 min) for 30 cycles; 68℃ for 10 min.
[0052] After the reaction, the PCR products were detected by 1% agarose gel electrophoresis. The SCL190 gene fragment with the correct band size was recovered using an agarose gel recovery kit (Beijing Bomed Gene Technology Co., Ltd., catalog number DH101-01) according to the kit instructions.
[0053] Example 2. Construction of a Rubbergrass SCL190 gene overexpression vector
[0054] Using pFGC5941 plasmid as the original vector, an overexpression vector for the SCL190 gene of rubber grass was constructed. The pFGC5941 plasmid was double-digested with restriction endonucleases BamHI and AscI to obtain the linearized pFGC5941 vector. The SCL190 gene fragment recovered in Example 1 was cloned into the pFGC5941 vector via homologous recombination. The reaction mixture consisted of 150 ng of the SCL190 gene fragment, 150 ng of the pFGC5941 linearized vector, 2 μL of 5× In-Fusion Snap Assembly MasterMix (Takara, catalog number 638949), and ddH2O to a final volume of 10 μL. The reaction conditions were: incubation at 50°C for 15 min to obtain the recombination product, which was then placed on ice.
[0055] E. coli DH5α competent cells stored at -80℃ were placed on ice and thawed. 5 μL of the recombinant reaction product was added, mixed well, and incubated on ice for 30 min. The cells were then heat-shocked at 42℃ for 45 s and incubated on ice for 2 min. 500 μL of antibiotic-free LB broth was added, and the cells were activated at 37℃ and 180 rpm for 1 h. The activated E. coli were centrifuged at 3,000 rpm for 1 min, most of the supernatant was removed, and the cells were resuspended in 100 μL of supernatant. The entire bacterial suspension was then plated onto LB agar plates containing 50 µg / mL kanamycin and incubated overnight at 37℃. Single colonies were picked from LB solid agar plates and inoculated into 500 μL of LB liquid medium containing 50 µg / mL kanamycin. The culture was activated at 37°C and 200 rpm for 3 h. Positive clones were then identified by colony PCR using primers qSCL190-F (SCL190 gene) and PF-R (pFGC5941 vector sequence). The nucleotide sequences of the primers are as follows:
[0056] qSCL190-F: 5'-CCGAGACCGTCGTTTCTAACAC-3';
[0057] PF-R: 5'-CGTGCACAACAGAATTGAAAGC-3'.
[0058] The PCR system consisted of: 10 μL of 2×GC Buffer; 2 μL of 2 mM dNTPs; 0.2 μL of DNA polymerase TaKaRa Taq (5 U / μL); 0.3 μL of qSCL190-F (10 μM); 0.3 μL of PF-R (10 μM); 2 μL of bacterial culture; and ddH2O to a final volume of 20 μL. The PCR program was: 94℃ for 3 min; 30 cycles of (94℃ for 30 s, 55℃ for 30 s, 72℃ for 1 min); and 72℃ for 10 min.
[0059] PCR products were detected by agarose gel electrophoresis, and bacterial cultures with correct band sizes were sent to Beijing Ruiboxingke Biotechnology Co., Ltd. for sequencing, yielding positive colonies carrying only the SCL190 recombinant expression vector pFGC5941-SCL190. 200 μL of the correctly sequenced bacterial culture was inoculated into 10 mL of LB broth containing 50 µg / mL kanamycin and incubated overnight at 37°C and 200 rpm. Plasmids were extracted using a rapid plasmid extraction kit (centrifuge column type, Beijing Bomed Gene Technology Co., Ltd., catalog number DP102-01) according to the kit instructions to obtain the recombinant expression vector pFGC5941-SCL190.
[0060] Example 3. Obtaining transgenic plants overexpressing the SCL190 gene of rubber grass
[0061] 1. Preparation of Agrobacterium infection solution
[0062] The recombinant expression vector pFGC5941-SCL190 obtained in Example 2 was introduced into Agrobacterium tumefaciens AGL1 cells using electroporation to obtain recombinant Agrobacterium tumefaciens AGL1-pFGC5941-SCL190. The transformation method was as follows: Agrobacterium tumefaciens AGL1 competent cells stored at -80℃ were thawed in an ice bath. 150 ng of plasmid was added to every 50 μL of competent cells, and the electroporation parameters were adjusted to 1.8 kV. The competent cells were then electroporated, followed by the addition of antibiotic-free LB liquid medium and incubation at 28℃ and 200 rpm for 3 hours. The cultured bacterial culture was centrifuged at 5000 rpm for 1 minute to collect the bacterial cells. Most of the supernatant was discarded, and approximately 100 μL of supernatant was retained. The bacterial cells were resuspended and plated onto YEP solid medium plates containing 25 mg / L rifampin and 50 mg / L kanamycin, and incubated in the dark at 28℃ for 48 h. Select 4-6 single colonies and inoculate them into an appropriate amount of YEP liquid medium containing 25 mg / L rifampin and 50 mg / L kanamycin, and incubate overnight at 28°C with shaking. Inoculate the bacterial suspension at a 1:100 volume ratio into YEP liquid medium containing 25 mg / L rifampin and 50 mg / L kanamycin, and add acetylsuccinone to a final concentration of 100 μM. Incubate until OD500. 600nm = 0.6-0.8. Collect bacterial cells by centrifugation at room temperature, remove supernatant, and fully suspend the bacterial cells in an infection solution containing 100 μM acetylsyleugenol of equal volume to obtain AGL1-pFGC5941-SCL190 infection solution.
[0063] The above-mentioned YEP liquid medium formulation is: peptone 10 g / L + yeast extract 10 g / L + NaCl 5 g / L, pH 7.0. YEP solid medium is the YEP liquid medium with the addition of 15 g / L agar. The above-mentioned infection solution formulation is: MS 4.4 g / L + MES 0.5 g / L + 6-BA 0.5 mg / L + NAA 0.01 mg / L + sucrose 20 g / L + glucose 10 g / L, pH 5.2.
[0064] 2. Obtaining genetically modified rubber grass
[0065] Using the Rubbergrass 1151 strain as the recipient material, the recombinant expression vector pFGC5941-SCL190 was introduced into Rubbergrass via Agrobacterium-mediated genetic transformation. The steps were as follows: Roots from well-grown tissue-cultured seedlings of the Rubbergrass 1151 strain were cut into segments approximately 5 mm in length. These root segments were then infected with the AGL1-pFGC5941-SCL190 inoculum solution for approximately 20 minutes. The infected root segments were then transferred to sterile filter paper to absorb excess inoculum and air-dried. They were then co-cultured at 21-23℃ in the dark for 2-3 days. The co-cultured Rubbergrass root segments were then transferred to a resistant callus induction medium for selection culture until green resistant buds appeared. Afterward, they were transferred to a resistant seedling strengthening medium for selection culture for 1-2 months at 21℃, with a 16-h light / 8-h dark cycle and a light intensity of 80-120 μmol·m⁻¹. -2 ·s -1 Rooted resistant rubber grass seedlings were obtained, namely T0 generation SCL190 overexpression transgenic rubber grass (35S::SCL190).
[0066] The formulation of the above-mentioned resistance callus induction medium is: 400 mg / L Timentin + Basta 10 mg / L + MS 4.4 g / L + MES 0.5 g / L + 6-BA 0.5 mg / L + NAA 0.01 mg / L + sucrose 20 g / L + plant gel 3.6 g / L, pH 5.8. The formulation of the above-mentioned resistance seedling strengthening medium is: 400 mg / L Timentin + Basta 10 mg / L + MS 2.2 g / L + MES 0.5 g / L + sucrose 10 g / L + plant gel 3.6 g / L, pH 5.8. Timentin is an Agrobacterium-mediated growth regulator. Basta is glufosinate-ammonium.
[0067] 3. Identification of SCL190 overexpression transgenic rubber grass
[0068] The T0 generation SCL190 overexpressing transgenic rubber grass was transplanted into a greenhouse for cultivation. The cultivation substrate was a 1:1 (v / v) mixture of nutrient soil and vermiculite. The cultivation conditions were: temperature 21℃, long day (16 h light / 8 h dark), and light intensity 80-120 μmol·m⁻¹. -2 ·s -1After three months of greenhouse cultivation, the roots were dug out of the soil, washed, and dried. A portion of the root tissue was then rapidly frozen in liquid nitrogen and stored at -80°C. Total RNA was extracted from the roots of T0 generation SCL190 overexpressing transgenic rubber grass (35S::SCL190) and wild-type rubber grass using a rapid RNA extraction kit (Beijing Huayueyang, Cat# 0416-50) according to the kit's instructions. The extracted total RNA was then reverse transcribed using the SuperScript® III First-Strand Synthesis System (Invitrogen, Cat# 18080051) according to the kit's instructions to obtain root cDNA.
[0069] Quantitative real-time PCR (qRT-PCR) was performed using root cDNA as a template to detect the relative expression level of the SCL190 gene in rubber grass. The internal control gene was TkGAPDH (http: / / bigd.big.ac.cn / gwh / , accession number PRJCA000437, Gene ID: evm.model.utg9113.3). The qRT-PCR reaction system was prepared according to the product instructions using Bio-Rad's SsoFast EvaGreen® Supermix (Cat#1725201), and the reaction was performed using a Bio-Rad CFX96 real-time PCR instrument.
[0070] The qRT-PCR primers for the SCL190 gene are as follows:
[0071] Upstream primer qSCL190-F: 5'-CCGAGACCGTCGTTCTAACAC-3';
[0072] Downstream primer qSCL190-R: 5'-GGAAGATAGACATCCTTTACAGGGC-3'.
[0073] The qRT-PCR primers for the TkGAPDH gene are as follows:
[0074] Upstream primer qTkGAPDH-F: 5'-AGTTGGTTTCGTGGTATGAC-3';
[0075] Downstream primer qTkGAPDH-R: 5'-ACATGTCAGTGAACAGGTAGAC-3'.
[0076] The PCR system consisted of: 2× SsoFast mix, 5 μL; cDNA, 2 μL; upstream primer (1 μM), 1.5 μL; and downstream primer (1 μM), 1.5 μL. The PCR program was: 98℃, 30 s; (98℃, 5 s → 60℃, 5 s → data acquisition) 40 cycles; 60-95℃, 0.5℃ / 5 s, data acquisition / 5 s. Data were analyzed using BIO-RAD CFX Manager software.
[0077] The results showed that the relative expression level of the SCL190 gene in all lines of the T0 generation SCL190-overexpressing transgenic rubber grass (35S::SCL190) was significantly higher than that in the wild-type rubber grass (WT). Figure 2 A).
[0078] Example 4. Propagation of SCL190 overexpression transgenic rubber grass
[0079] Asexual propagation of rubber grass was carried out through tissue culture. Leaves from vigorous wild-type rubber grass cultivars 1151 and the T0 generation SCL190 overexpressing transgenic rubber grass (35S::SCL190) obtained in Example 3 were taken. After sterilization with 12% (v / v) bleach, excess leaf edges were trimmed, and the leaves were placed in callus induction medium. Once callus emerged from the wounds, it was inoculated into fresh callus induction medium. After the callus grew, it was cut into small pieces, dried, and inoculated into a seedling culture medium, where small buds emerged. After subculturing 2-3 times, the buds differentiated into seedlings. Once the aseptic seedlings rooted, they were transplanted to a greenhouse. The cultivation substrate was a 1:1 (v / v) mixture of nutrient soil and vermiculite. Greenhouse cultivation conditions included a temperature of 21℃, long day (16 h light / 8 h dark), and a light intensity of 80-120 μmol·m⁻¹. -2 ·s -1 .
[0080] The above-mentioned callus induction medium formulation is as follows: MS 4.4 g / L + MES 0.5 g / L + 6-BA 0.5 mg / L + NAA 0.01 mg / L + sucrose 20 g / L + plant gel 3.6 g / L, pH 5.8. The above-mentioned seedling strengthening medium formulation is as follows: MS 2.2 g / L + MES 0.5 g / L + sucrose 10 g / L + plant gel 3.6 g / L, pH 5.8.
[0081] Example 5. Phenotypic analysis of SCL190 overexpression transgenic rubber grass
[0082] 1. Root biomass measurement
[0083] Tissue-cultured aseptic seedlings of wild-type and 35S::SCL190 transgenic rubber grass were transplanted into a greenhouse and cultured for 3 months. The roots were then dug up from the soil, washed, photographed, and the diameter of the taproot was measured using calipers. The roots were then dried in a 50℃ oven until constant weight, and the dry roots of each plant were weighed. Statistical analysis was performed on the taproot diameter and dry root weight. The results showed that compared with wild-type rubber grass (WT), the SCL190 overexpression lines (#1 and #2) had significantly larger root morphology and a significantly increased number of lateral and fibrous roots. Figure 2 B), the diameter of the main root increases significantly ( Figure 3 A), and the weight of the dry roots of each plant also increased significantly ( Figure 3 B).
[0084] 2. Observation of root sections
[0085] After transplanting tissue-cultured aseptic seedlings of wild-type and 35S::SCL190 transgenic rubber grass into a greenhouse for 3 months, the roots were dug up from the soil, washed, and fresh roots with a diameter of about 2-3 mm were taken. Small segments of about 1.5 cm in length were cut with a scalpel and fixed in 80% (v / v) ethanol for 24 h. The segments were then sectioned using a Leica VT1200S microtome to a thickness of 100 μm, stained with Oil Red O for 1 min, rinsed once with 45% (v / v) glacial acetic acid, and then washed twice with distilled water. The sections were mounted with 60% (v / v) glycerol and observed and photographed under a stereomicroscope (OLYMPUS SZX16). The area of latex cells and the area of root sections were counted using ImageJ software, and the latex cell index was calculated. The latex cell index = latex cell area / root section area × 100%. The results showed that, compared with wild-type rubber grass (WT), the root latex cells of the SCL190 overexpressing lines (#1 and #2) did not show significant changes. Figure 4 A), there was no significant difference in the ductal cell index. Figure 4 B).
[0086] 3. Detection of natural rubber content in the roots
[0087] Tissue-cultured aseptic seedlings of wild-type and 35S::SCL190 transgenic rubber grass were transplanted into a greenhouse and cultured for 3 months. Natural rubber was then extracted from the roots. The method was as follows: The roots were dug out of the soil, washed, and dried in a 50℃ oven until constant weight. The dried roots were freeze-ground into powder. 100 mg of the powder was weighed and placed in a 2.0 mL centrifuge tube. The powder was completely suspended with 1 mL of toluene and then vortexed thoroughly for 1 min. Extraction was carried out at 50℃ and 750 rpm for 2 h. The mixture was then centrifuged at 10,000 rpm at room temperature for 10 min. The supernatant was collected to obtain the natural rubber solution.
[0088] The natural rubber content in the roots of wild-type and 35S::SCL190 transgenic rubber grass was determined using Fourier Transform Infrared Spectroscopy (FT-IR) as described in “Rolere, S., Liengprayoon, S., Vaysse, L., Sainte-Beuve, J., and Bonfils, F. (2015). Investigating natural rubber composition with Fourier Transform Infrared (FT-IR) spectroscopy: a rapid and non-destructive method to determine both protein and lipid contents simultaneously. Polym. Test. 43,83-93.”
[0089] First, a standard curve was constructed. Different concentrations (0.5, 1, 2, 4, 6, 8 mg / mL) of natural rubber standard (Sigma-Aldrich, Cat# 431257-100G) were prepared using toluene. 150 μL of each concentration of natural rubber standard solution was mixed with 15 μL of a 10 mg / mL narrow-distribution polystyrene standard (China National Institute of Metrology, NIM-RM2068). 70 μL of the mixture was then pipetted evenly onto potassium bromide wafers pre-pressed using a tablet press and dried in an oven. The wafers were then scanned 32 times using a far-infrared spectrometer (BRUKER, TENSOR 27). After simple atmosphere compensation and baseline correction, the infrared spectrum was calculated to be at 835 cm⁻¹. -1 (Natural rubber absorption peak) and 699cm -1 The peak area ratio of the polystyrene absorption peak. A standard curve was obtained by plotting the peak area ratio and natural rubber concentration as coordinates: X = (Y - 0.0698) / 0.2596, R... 2 = 0.9961, where X represents the concentration of natural rubber (mg / mL) and Y represents 835 cm⁻¹. -1 and 699 cm -1 The peak area ratio.
[0090] The extracted natural rubber solution was analyzed. The method was as follows: 150 µL of the extracted natural rubber solution was placed in a new 1.75 mL centrifuge tube, and 15 μL of a 10 mg / mL narrow-distribution polystyrene standard (National Institute of Metrology, NIM-RM2068, China) solution was added as an external standard. The mixture was shaken and stirred. 75 µL of the sample was evenly dropped onto the circular test area of a potassium bromide wafer pre-pressed using a tablet press, and dried in an oven for approximately 10 minutes. The dried sample was then measured using a Fourier transform infrared spectrometer (BRUKER, TENSOR 27). The wafer was scanned 32 times during the detection process. The obtained infrared spectrum was adjusted for atmosphere compensation, baseline correction, and smoothing, and the 835 cm⁻¹ value was calculated. -1 (Natural rubber absorption peak) and 699 cm⁻¹ -1 The peak area ratio of (polystyrene absorption peak). (835 cm⁻¹) -1 and 699 cm -1 Substituting the peak area ratio into the standard curve above, the concentration of natural rubber was calculated. Then, the relative content of natural rubber in the roots of wild-type and 35S::SCL190 transgenic rubber grass was calculated. Relative content of natural rubber (%) = Natural rubber concentration (mg / mL) × Volume of toluene used to dissolve the rubber (mL) / Mass of root powder used for rubber extraction (mg) × 100%.
[0091] The results showed that the relative content of natural rubber in the roots of the SCL190 overexpression lines (#1 and #2) was significantly increased compared with that of wild-type rubber grass (WT). Figure 5 A). The natural rubber yield per plant was calculated based on the dry root weight test results (natural rubber yield per plant = relative natural rubber content in roots × dry root weight). The results showed that the natural rubber yield of the SCL190 overexpression lines (#1 and #2) was significantly higher than that of the wild-type rubber grass (WT). Figure 5 B).
[0092] The present invention has been described in detail above with reference to specific embodiments. Any modifications or improvements made without departing from the core of the present invention are within the scope of the present invention.
Claims
1. A nucleic acid molecule comprising any of the following nucleotide sequences (a1)-(a4): (a1) The nucleotide sequence shown in SEQ ID NO:1; (a2) A nucleotide sequence that has at least 90% sequence identity with the nucleotide sequence shown in SEQ ID NO:1; (a3) The nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO:2; (a4) A nucleotide sequence that encodes an amino acid sequence having at least 90% sequence identity with the amino acid sequence shown in SEQ ID NO:2; The nucleic acid molecules described therein can confer higher root biomass and natural rubber content to rubber grass that overexpresses the nucleic acid molecules.
2. An expression cassette, vector, or host bacterium containing the nucleic acid molecule of claim 1.
3. The application of the nucleic acid molecule described in claim 1 in cultivating rubber grass plants with increased root biomass and natural rubber content.
4. A method for increasing the root biomass and natural rubber content of rubber grass, comprising increasing the content or activity of SCL190 protein in rubber grass; wherein the SCL190 protein is as follows (B1) or (B2): (B1) A protein with the amino acid sequence shown in SEQ ID NO:2; (B2) Proteins with the same function obtained by substituting and / or deleting and / or adding one or more amino acids of the amino acid sequence shown in SEQ ID NO:
2.
5. The method according to claim 4, characterized in that, The content or activity of SCL190 protein in rubber grass is increased by overexpressing the nucleic acid molecule of claim 1 in rubber grass.
6. A method for obtaining rubber grass with increased root biomass and natural rubber content, comprising: An overexpression vector for overexpressing the nucleic acid molecule of claim 1 was introduced into the rubber grass recipient material, and transgenic rubber grass plants with increased root biomass and natural rubber content were obtained by culturing.
7. The method according to claim 6, characterized in that, The overexpression vector was introduced into the rubber grass receptor material via Agrobacterium-mediated transformation.
8. A transgenic rubber grass plant with increased root biomass and natural rubber content obtained by the method of claim 6 or 7.
9. A method for producing natural rubber, comprising: Transgenic rubber grass plants with increased root biomass and natural rubber content as described in claim 8 were cultivated, and natural rubber was extracted from the roots.
10. A protein, which is either (B1) or (B2): (B1) A protein with the amino acid sequence shown in SEQ ID NO:2; (B2) Proteins with the same function obtained by substituting and / or deleting and / or adding one or more amino acids of the amino acid sequence shown in SEQ ID NO:2.