Gene ZmESKIMO1 influencing corn root development and application thereof

Abstract

The invention relates to a gene ZmESKIMO1 influencing corn root development and application thereof, and belongs to the technical field of plant gene breeding, the nucleotide sequence of the gene ZmESKIMO1 is shown as SEQ ID NO.1, and the amino acid sequence of protein coded by the gene is shown as SEQ ID NO.2. The gene is capable of regulating the growth and development of plants, and overexpression of the gene ZmESKIMO1 enables primary root systems of the plants to be lengthened and the number of lateral roots to be increased, so that the growth and development of the plants are promoted, and the growth and development of the plants are promoted. The biomass of the overground part is increased, and the function of the gene ZmESKIMO1 is lost, so that the primary root system of the plant is shortened, the number of lateral roots is reduced, and the biomass of the overground part is reduced. The invention finds and verifies that the corn ZmESKIMO1 gene has the function of regulating and controlling the growth and development of plants, and the discovery provides a new direction and theoretical support for the breeding of excellent corn varieties.

Description

Technical Field

[0001] This invention belongs to the field of plant gene breeding technology, specifically involving a gene ZmESKIMO1 that affects maize root development and its application. Background Technology

[0002] Maize is one of the major food and economic crops, and its root system is a key organ for absorbing water and nutrients and anchoring the plant. Root length determines the range of deep soil water and nutrients it can absorb. Longer roots significantly improve drought resistance and nutrient utilization efficiency, especially in arid or infertile environments, and are an important foundation for ensuring stable and high maize yields. The number of lateral roots directly relates to the total absorption surface area of ​​the root system. More lateral roots greatly enhance the ability to capture water and key nutrients such as nitrogen and phosphorus, promoting robust plant growth. Together, these factors constitute the plant's ability to anchor itself to the ground, effectively preventing lodging. Therefore, root length and the number of lateral roots are core morphological indicators for evaluating the environmental adaptability, biological stress resistance, and yield potential of maize varieties. However, the genetic and molecular mechanisms controlling maize root elongation remain unclear. To address this, this invention provides a gene ZmESKIMO1 that influences maize root development and its application. Summary of the Invention

[0003] The purpose of this invention is to provide a gene ZmESKIMO1 that affects maize root development and its application in order to solve the above-mentioned problems.

[0004] The present invention achieves the above objectives through the following technical solutions: This invention provides a gene ZmESKIMO1 that affects root development. The nucleotide sequence of the gene ZmESKIMO1 is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.2.

[0005] This invention also provides an application of the gene ZmESKIMO1, which affects root development, in regulating plant growth and development.

[0006] As a further optimization of the present invention, the gene ZmESKIMO1 is adjusting the growth and development of plants.

[0007] As a further optimization of the present invention, overexpression of the gene ZmESKIMO1 causes the primary roots of plants to become longer, the number of lateral roots to increase, and the biomass of the aboveground parts to increase.

[0008] As a further optimization of the present invention, the loss of function of the gene ZmESKIMO1 leads to shorter primary roots, a reduced number of lateral roots, and a decrease in aboveground biomass in plants.

[0009] As a further optimization of the present invention, in the process of plant breeding, a haplotype with high expression of gene ZmESKIMO1 is created or screened from natural ecotypes using genetic engineering technology to obtain plant varieties with well-developed root systems and high aboveground biomass.

[0010] As a further optimization of the present invention, the plant is corn.

[0011] The beneficial effects of this invention are as follows: This invention obtained ZmESKIMO1 gene knockout and overexpression materials using gene editing technology, and cultured corresponding overexpressing plants and knockout mutant plants. By observing plant phenotypes and statistically analyzing multiple growth indicators of the root system and aboveground parts, it was verified that the primary root length, lateral root number, and aboveground biomass of the overexpressing plants were significantly superior to those of the wild type, while the knockout mutants showed the opposite trend. This invention discovered and verified a new function of the maize ZmESKIMO1 gene, and based on this new function, developed novel breeding materials, providing a genetic basis and theoretical support for the breeding of superior maize varieties. Attached Figure Description

[0012] Figure 1 Electrophoresis image of full-length ZmESKIMO1 CDS amplification; Figure 2 The results of the tiled phenotypic plots for KN5585, eskimo1-ko, and ESKIMO1-OE; Figure 3 Phenotypes of the aboveground parts and roots of KN5585 and eskimo1-ko; Figure 4 Phenotypic results of the aboveground parts and roots of KN5585 and ESKIMO1-OE; Figure 5 Statistical results of primary root lengths for KN5585, eskimo1-ko, and ESKIMO1-OE; Figure 6 The statistical results of the number of lateral roots of KN5585, eskimo1-ko and ESKIMO1-OE; Figure 7 The results of apical scanning electron microscopy for KN5585, eskimo1-ko, and ESKIMO1-OE are shown. Detailed Implementation

[0013] The present application will now be described in further detail. It should be noted that the following specific embodiments are only used to further illustrate the present application and should not be construed as limiting the scope of protection of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.

[0014] 1. Experimental materials Unless otherwise specified, all methods used in this invention are conventional methods known to those skilled in the art, and all reagents and materials used are commercially available products.

[0015] 2. Experimental Methods 2.1 Cloning of the ZmESKIMO1 gene Using wild-type maize B73 as material, RNA was extracted, and the extracted total RNA was reverse transcribed to synthesize the first strand of cDNA, which was then used as a template for PCR amplification, yielding a 1668 bp gene fragment (electrophoresis results are shown below). Figure 1 (As shown). The obtained gene fragment was ligated into the pCAMBIA1305-GFP vector to obtain pCAMBIA1305-ZmESKIMO1, which was transformed into E. coli. Positive clones were picked and sequenced. The sequencing results were consistent with the predicted results, and the nucleotide sequence shown in SEQ ID NO.1 and the corresponding amino acid sequence shown in SEQ ID NO.2 were obtained.

[0016] The sequences of the specific primers used for PCR amplification are as follows: SEQ ID NO.3: ZmESKIMO1-F: 5'>ATGCAGCAGCGGCGCAAG<3'; SEQ ID NO.4: ZmESKIMO1-R: 5'>CTACTGCTGGGCCTGGGC<3'.

[0017] 2.2 Obtaining ZmESKIMO1 gene overexpression materials Using the Ubi promoter to drive the 5XGFP tag and the DNA sequence of the target gene ZmESKIMO1, a ZmESKIMO1 overexpression vector was constructed using PBI121 as the backbone vector. The vector was then transformed into callus tissue by Weimi Company to obtain T0 generation plants. The positive transgenic seedlings were amplified and verified using specific primers. The T0 generation plants that were verified to be positive were identified by three consecutive generations of homozygous Sanger sequencing and screened with Bar test strips to obtain the ZmESKIMO1 overexpression homozygous line ESKIMO1-OE, which was used for subsequent experiments.

[0018] The primer sequences for identification are as follows: SEQ ID NO.5: Bar-F: 5'>CCATCGTCAACCACTACATCGAGACA<3'; SEQ ID NO.6: Bar-R: 5'>CTTCAGCAGGTGGGTGTAGAGCGT<3'.

[0019] 2.3 Obtaining ZmESKIMO1 gene knockout materials Two sgRNA target sites were designed in the CDS region of the ZmESKIMO1 gene. Using the KN5585 maize inbred line as a background, Weimi Biotechnology Co., Ltd. constructed the sgRNA-WMV vector using CRISPR / Cas9 technology and transformed maize to obtain the ZmESKIMO1 knockout material eskimo1-ko.

[0020] The target sequence is as follows: SEQ ID NO.7: Target1:GCCGTTCGCGATGAAGCAGGCGG; SEQ ID NO.8: Target2:GCGGGACGTGACGCTCCCGACGG; The primer sequences for identification are as follows: SEQ ID NO.9: 5'>GGACGGTGACCGGTAAGTTT<3'; SEQ ID NO. 10: 5'>CGCCGTACTACTCACAGGAC<3'.

[0021] 2.4 Identification of ZmESKIMO1 gene function T0 generation seeds returned by Weimi Biotechnology Co., Ltd. were sown and propagated in Hefei during the spring. Seeds were harvested after single-plant pollination. The paper germination method was used, with standard germination filter paper as the substrate, and maize seeds were germinated under controlled environmental conditions. After germination, knockout and overexpression materials were transplanted into hydroponic working solution, with wild-type KN5585 as a control in both cases. The culture was carried out until the three-leaf stage (see...). Figure 2 ).

[0022] During cultivation, the growth status of the plant's root system was observed, and the length of the primary roots and the number of lateral roots were counted. The results showed (see...). Figure 3-6 Compared with the control, eskimo1-ko showed significantly shorter primary roots, fewer lateral roots, and decreased aboveground biomass; while ESKIMO1-OE showed longer primary roots, more lateral roots, and increased aboveground biomass.

[0023] The root tips of the control group, eskimo1-ko, and ESKIMO1-OE were rapidly excised and preserved in electron microscopy fixative (mainly 2.5% glutaraldehyde) purchased from Servicebio. After dehydration and drying, they were observed under a scanning electron microscope. The results are as follows: Figure 7 As shown, the root tip structure development of ESKIMO1-OE was significantly better than that of the control group, while the root tip structure development of eskimo1-ko was weaker than that of the control group.

[0024] The above results indicate that the gene ZmESKIMO1 positively regulates root development and aboveground biomass accumulation in maize plants.

[0025] Based on maize ESKIMO1 gene mutant materials, methods for obtaining strong root lines by overexpressing the ESKIMO1 homologous gene in maize using transgenic technology are all within the scope of protection of this invention.

[0026] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. A gene ZmESKIMO1 that affects root development, characterized by: The nucleotide sequence of the gene ZmESKIMO1 is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

2.

2. Application of ZmESKIMO1, a gene that affects root development, in regulating plant growth and development.

3. The application according to claim 2, characterized in that: The gene ZmESKIMO1 regulates root development in plants.

4. The application according to claim 3, characterized in that: Overexpression of the gene ZmESKIMO1 elongates the primary roots, increases the number of lateral roots, and raises the aboveground biomass of plants.

5. The application according to claim 3, characterized in that: Loss of function of the gene ZmESKIMO1 results in shorter primary roots, fewer lateral roots, and reduced aboveground biomass in plants.

6. The application according to claim 2, characterized in that: In the process of plant breeding, genetic engineering technology is used to create or screen haplotypes with high expression levels of the gene ZmESKIMO1 from natural ecotypes to obtain plant varieties with well-developed root systems and high aboveground biomass.

7. The application according to claim 2, characterized in that: The plant in question is corn.

Images