Molecular marker linked with corn kernel dehydration rate main effect QTLqKDR3.06 and application

By developing a molecular marker linked to the major QTL_qKDR3.06 for maize kernel dehydration rate, and utilizing SNP site detection and KASP amplification technology, the problem of excessive moisture content in maize kernels was solved, enabling efficient screening and breeding, and improving the efficiency and cost-effectiveness of maize breeding.

CN122060896APending Publication Date: 2026-05-19NORTHWEST A & F UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-26
Publication Date
2026-05-19

AI Technical Summary

Technical Problem

In existing technologies, excessive moisture content in maize kernels leads to mechanical damage, mold growth during storage, and additional drying costs. Furthermore, there is a lack of effective molecular markers for screening and breeding maize varieties with low harvest kernel moisture content and high field dehydration rates.

Method used

We developed a molecular marker linked to the major QTL_qKDR3.06 of maize kernel dehydration rate, and used KASP amplification and fluorescence detection techniques to identify maize kernel moisture content and dehydration rate by detecting the genotype of the SNP site, thus providing a molecular-assisted selection method.

Benefits of technology

It enables efficient and reliable prediction of grain moisture content and dehydration rate in the early screening and breeding process, improves the selection efficiency and cost-effectiveness of maize breeding, and screens out maize germplasm resources with low grain moisture content and fast dehydration rate.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122060896A_ABST
    Figure CN122060896A_ABST
Patent Text Reader

Abstract

The invention discloses a molecular marker linked with corn kernel dehydration major QTLqKDR3.06 and application of the molecular marker, and belongs to the technical field of plant molecular genetic breeding. The molecular marker is located at the 25th nucleotide of SEQ ID NO.4 in a sequence table, and the nucleotide polymorphism of the molecular marker is shown as T or G. By detecting the polymorphism or genotype of the site, the corn variety with ideal water content and grain dehydration rate can be quickly and accurately screened out, the method can be applied to the fields of genetic improvement, molecular breeding, variety identification and the like of corn, the corn breeding efficiency is effectively improved, and the corn variety suitable for mechanical harvesting is cultivated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant molecular genetics and breeding technology, specifically relating to the major effect QTL on maize kernel dehydration rate. qKDR3.06 Linked molecular markers and their applications. Background Technology

[0002] Maize is one of the world's most important food and feed crops. Mechanized direct harvesting of kernels is a key step in improving maize production efficiency and reducing production costs. However, excessively high kernel moisture content at harvest leads to mechanical damage, mold growth during storage, and additional drying costs, severely hindering the promotion and application of mechanized harvesting. Therefore, breeding maize varieties with low harvest kernel moisture content and high field dehydration rates has become an important goal of modern maize breeding. Kernel moisture content and dehydration rate are complex quantitative traits controlled by multiple genes, and their expression is significantly influenced by genotype, environment, and their interactions. Early studies mainly used classical genetic methods to reveal the heritability of these traits and preliminarily explored their relationship with agronomic traits (such as pericarp structure and grain filling characteristics). With the development of molecular marker technology, quantitative trait locus mapping has become the main means of elucidating their genetic basis. Through decades of research, the academic community has gained an increasingly clear understanding of the genetic structure of maize kernel moisture content and dehydration rate, evolving from early QTL mapping to today's high-resolution gene mining and multi-omics mechanism analysis. However, the functional genes and markers discovered so far are very scarce. Therefore, the subsequent development of low-cost and high-efficiency molecular markers for breeding is of great significance for screening and breeding new maize germplasm with fast grain dehydration rate and realizing full mechanization of maize production. Summary of the Invention

[0003] In view of the shortcomings of the prior art, this invention proposes a QTL method with main effect on corn kernel dehydration rate. qKDR3.06 Linked molecular markers and their applications can provide an effective and reliable molecular-assisted selection method for the genetic improvement of maize kernel dehydration rate and its breeding.

[0004] The technical solution of this invention mainly includes the following: This invention first provides the application of a substance for detecting polymorphisms or genotypes at maize SNP sites in any of the following (1) to (4): (1) To determine the moisture content and / or dehydration rate of corn kernels; (2) Breeding for maize kernel moisture content and / or dehydration rate; (3) Prepare products for identifying the moisture content and / or dehydration rate of corn kernels; (4) To prepare products for breeding maize kernel moisture content and / or dehydration rate; The SNP site is located at 187,104,106 bp on chromosome 3, which is the 25th nucleotide of SEQ ID NO.4 in the sequence listing, and its nucleotide type is T or G.

[0005] The present invention also provides a method for identifying the moisture content and / or dehydration rate of maize kernels, comprising the following steps: detecting the genotype of the SNP site in the maize genome to be tested, and identifying the moisture content and / or dehydration rate of maize kernels based on the genotype; The genotype of the SNP locus is TT, TG, or GG, where TT is homozygous for the SNP locus T, GG is homozygous for the SNP locus G, and TG is heterozygous for both the SNP locus T and G. The kernel moisture content of the test maize with the genotype TT at the SNP locus is lower than that of the test maize with the genotypes GG or TG at the SNP locus, and the kernel dehydration rate of the test maize with the genotype TT at the SNP locus is faster than that of the test maize with the genotypes GG or TG at the SNP locus.

[0006] Furthermore, the method includes the following steps: (1) KASP amplification was performed using the genomic DNA of the maize to be tested as a template; (2) Perform fluorescence detection on the amplification products to determine the genotype of the SNP in the maize to be tested; (3) Identify the kernel moisture content and dehydration rate of the maize to be tested based on the genotype results: The kernel moisture content of the maize to be tested with the genotype TT at the SNP site is lower than that of the maize to be tested with the genotype GG or TG at the SNP site, and the kernel dehydration rate of the maize to be tested with the genotype TT at the SNP site is faster than that of the maize to be tested with the genotype GG or TG at the SNP site.

[0007] The application of the above methods in maize breeding also falls within the scope of protection of this invention.

[0008] The present invention also provides a method for breeding maize with low grain moisture content and fast dehydration rate. The method includes detecting the genotype of the SNP locus in the maize genome and selecting maize with the TT genotype as the parent for breeding.

[0009] In the above method, the primer preparation method is as follows: First, dilute the three primers to 100 mM with ddH2O, and then prepare the primer working solution as follows: 12 μL of primer FA, 12 μL of primer FB, 30 μL of primer RC, and 46 μL of ddH2O. This solution is used as the KASP-labeled primer working solution and stored at 4℃ for later use.

[0010] In the above method, the PCR reaction system can be as follows: 2×KASP Master mix volume is 2 μL, primer work volume is 0.056 μL, genomic DNA concentration is about 50 ng / μL, volume is 1 μL, and ultrapure water is added to make up to 4 μL.

[0011] In the above methods, PCR amplification can be performed on a high-throughput PCR instrument.

[0012] In the above method, the PCR reaction procedure can be as follows: Step 1: Pre-denaturation at 95℃ for 10 minutes; Step 2: 10 cycles of denaturation at 95 ℃ for 15 s and annealing at 55 ℃ for 1 min (the first annealing temperature is 61 ℃, and the temperature is reduced by 0.6 ℃ for each cycle); 28 cycles of denaturation at 95 ℃ for 15 s and annealing at 55 ℃ for 1 min.

[0013] The method described above for determining the genotype of the SNP in the maize sample can be as follows: After the PCR reaction, a fluorescence signal reader and a fluorescence detection system are used to convert the fluorescence signal into analyzable values ​​to read the fluorescence data of the reaction products (data reading temperature is below 40℃). The fluorescence scanning results are then used to perform genotyping using KlusterCaller software. G-type samples exhibit FAM fluorescence, distributed near the Y-axis; T-type samples exhibit HEX fluorescence, distributed near the X-axis; samples with no detected signal are distributed near the origin.

[0014] The present invention also provides substances and products thereof for detecting polymorphisms or genotypes of SNP sites in the maize genome.

[0015] The substance includes at least one of the following: A1), A2), or A3): A1) The substance described is a primer for amplifying maize genomic DNA fragments containing the SNP sites described above; A2) The substance is a PCR reagent containing the primers described in A1); the PCR reagent includes buffer, dNTPs, Taq DNA polymerase, and other reagents required for the PCR reaction; A3) The substance is a kit containing the primers described in A1) or the PCR reagents described in A2).

[0016] Furthermore, the primers include primer FA, primer FB, and primer RC; The nucleotide sequence of primer FA is shown in SEQ ID NO.1 or in positions 22-46 of SEQ ID NO.1; the nucleotide sequence of primer FB is shown in SEQ ID NO.1 or in positions 22-46 of SEQ ID NO.2; and the nucleotide sequence of primer RC is shown in SEQ ID NO.3.

[0017] The product contains the substance described above for detecting SNP polymorphisms or genotypes in the maize genome, and the product is any one of the following: B1) Products that detect single nucleotide polymorphisms or genotypes related to corn kernel moisture content and dehydration rate; B2) Products used to identify the moisture content and dehydration rate of corn kernels; B3) Products used for breeding maize kernel moisture content and / or dehydration rate.

[0018] In the above applications, methods, and products, the polymorphism and genotype of the SNP site can be determined by directly sequencing the nucleotide sequence.

[0019] The present invention also provides a DNA molecule having the nucleotide sequence shown in SEQ ID NO.4.

[0020] The application of the DNA molecule is also within the scope of protection of this invention. The applications include: (C1) Identify the moisture content and / or dehydration rate of corn kernels; (C2) Breeding for maize kernel moisture content and / or dehydration rate; (C3) Prepare products for identifying the moisture content and / or dehydration rate of corn kernels; (C4) Prepare maize breeding products.

[0021] In the above applications (C1) to (C4), the DNA molecule serves as a detection target.

[0022] Furthermore, substances that detect the SNP site polymorphisms and genotypes can be combined with other substances (such as substances that detect single nucleotide polymorphisms or genotypes of other molecular markers related to corn kernel moisture content and / or dehydration rate) to prepare products for identifying corn varieties with corn kernel moisture content and / or dehydration rate.

[0023] The beneficial effects of this invention are: This invention can be used to predict the moisture content and / or dehydration rate of maize kernels, to perform early screening of maize, and to be used in marker-assisted breeding of maize. It has important application value in the research of exploring maize germplasm resources with low kernel moisture content and fast dehydration rate and in the breeding of maize varieties with low kernel moisture content and fast dehydration rate. Attached Figure Description

[0024] Figure 1 Phenotypic results of ear morphology and grain moisture content at different growth stages for inbred lines PH4CV and KB020.

[0025] Figure 2 Normal distribution phenotypic distribution of grain moisture content and dehydration rate in a recombinant inbred line population. (A) Sanya, 2022; (B) Yangling, 2022; (C) Baoji, 2023; (D) Yangling, 2023. Where 35 DAP, 42 DAP, 49 DAP, and 56 DAP represent the moisture content at different days after pollination; A1-A6 represent the dehydration rates at different stages (A1: 35-42 DAP), (A2: 35-49 DAP), (A3: 35-56 DAP), (A4: 42-49 DAP), (A5: 42-56 DAP), and (A6: 49-56 DAP).

[0026] Figure 3 The following are the number and distribution maps of QTLs for grain moisture content and dehydration rate. (A) QTLs for grain moisture content and dehydration rate identified by four environments and the best linear unbiased estimate, respectively; (B) The total number of QTLs for grain moisture content and dehydration rate and the number of common QTLs; (C) The number of three types of stable QTLs and the number of common QTLs; (D) The location of 13 pleiotropic QTLs on chromosomes.

[0027] Figure 4 Main effect QTL_ qKDR3.06 QTL location map.

[0028] Figure 5 The phenotypic plot and phenotypic T-test results of KASP-labeled KASP_Chr3-187.104 in a recombinant inbred line population.

[0029] Figure 6 The phenotypic plot and phenotype T-test results of KASP-labeled KASP_Chr3-187.104 in a natural population. Detailed Implementation

[0030] To facilitate a clearer understanding of the technical content of this invention by those skilled in the art, the invention will be further described below in conjunction with specific embodiments and accompanying drawings.

[0031] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0032] Unless otherwise specified, all quantitative experiments in the following examples are performed in triplicate.

[0033] The maize inbred line KB020 in the following examples was developed by the Key Laboratory of Maize Biology and Genetic Breeding, College of Agriculture, Northwest A&F University, and has been documented in: Zhao ZX, He KH, Feng ZQ, Li YN, Chang L.G., Zhang XH, Xu ST, Liu JC, Xue JQ. Evaluation of Yield-Based LowNitrogen tolerance indices for screening maize ( Zea mays L.) inbred lines. Agronomy, 2019, 9(5): 240. DOI:10.3390 / agronomy9050240. The biological material is available to the public from the applicant and is intended solely for the purpose of replicating experiments of this invention and may not be used for any other purpose. PH4CV is a maize inbred line bred by Pioneer Laboratories and now publicly disclosed.

[0034] The PH4CV×KB020 recombinant inbred line population in the following examples was obtained by single-grain transfer.

[0035] The maize inbred lines in the natural populations described in the following examples are described in: Qu JZ, Xu ST, GouX.N., Zhang H., Cheng Q., Wang XY, Ma C., Xue JQ. Time-resolved multiomics analysis of the genetic regulation of maize kernel moisture. The Crop Journal, 2023, 11(1):247-257. DOI: 10.1016 / j.cj.2022.04.017. The biological material is available to the public from the applicant and is intended solely for the purpose of repeating the experiments of this invention and shall not be used for any other purpose.

[0036] The following examples use Excel software to process the data. The experimental results are expressed as mean ± standard deviation. The T-test is used to distinguish the differences between independent samples. (*) indicates a significant difference at the P < 0.05 level, (**) indicates a significant difference at the P < 0.01 level, and (***) indicates a significant difference at the P < 0.001 level.

[0037] Example 1. Dehydration rate (QTL) of corn kernels qKDR3.06 Localization and linkage molecular marker development 1. Determination of moisture content and dehydration rate of corn kernels PH4CV and KB020, along with their recombinant inbred lines (a total of 204 families), were sown at experimental bases in Yangling and Baoji, Shaanxi Province, and Sanya, Hainan Province. Each family was planted in one row, 4 meters long, with two replicates. All individual plants underwent self-pollination, and the pollination date was recorded. Grain moisture content was measured in ears at 35, 42, 49, and 56 days post-pollination using an electronic moisture meter. The grain dehydration rate was quantified using AUDDC. The formula for calculating the grain dehydration rate is as follows:

[0038] Where: n represents the number of evaluations, γ represents the average grain moisture content, i represents the i-th sample, and t represents the pollination date.

[0039] The results are as follows Figure 1 As shown, the grain moisture content of PH4CV was significantly lower than that of KB020 at four post-pollination periods of 35, 42, 49, and 56 days, and the variation range of individual parental phenotypic values ​​was relatively small, ranging from 0.60 to 3.49. Calculations of the best linear unbiased prediction (BLUP) results for multiple environments showed that the moisture content of PH4CV decreased from 38.40% at 35 days post-pollination to 30.85% at 56 days post-pollination, while that of KB020 decreased from 40.78% at 35 days post-pollination to 33.71% at 56 days post-pollination (Table 1).

[0040] The results are as follows Figure 2 As shown, the grain moisture content and dehydration rate of the 204 recombinant inbred lines of PH4CV×KB020 under four different environments exhibit a normal distribution, which is consistent with the quantitative trait distribution, indicating that this trait is controlled by multiple genes.

[0041] Table 1. Seed moisture content of parental lines at four post-pollination stages.

[0042] 2. QTL positioning of corn kernel moisture content and dehydration rate Genotyping of the maize population was performed using the 6H-60K microarray, and a genetic map was constructed using Icimapping software. A total of 2033 bin markers were selected, resulting in a genetic map with a total length of 2661.98 cM and an average density of 0.59 cM. QTL localization was performed using complete interval mapping, with 1000 simulations to obtain the Level of Detail (LOD) values. The scan step size was 1.0 cM, and the PIN value was set to 0.005.

[0043] The results are as follows Figure 3 As shown: 25 QTLs related to grain moisture content and 30 QTLs related to grain dehydration rate were identified, with 17 sites identified in common between the two categories. Figure 3 B). Most identified QTLs exhibited significant environment-specific and trait-specific effects. For grain moisture content, 12 QTLs were detected in the Yangling environment in 2023, while 4, 6, 7, and 9 QTLs were identified in Baoji (2023), Sanya (2022), the best linear unbiased estimate dataset, and the Yangling environment in 2022, respectively. For grain dehydration rate, the Yangling environment in 2023 had the most QTLs (n=13), while the Sanya and Baoji environments in 2022 each had 7 QTLs, and 6 were identified in Yangling in 2022, along with 8 QTLs identified using the best linear unbiased estimate dataset. However, only a few QTLs were stable across multiple environments: 5 grain moisture content-related QTLs were repeatedly detected in 2 environments, and only 2 were stably expressed in all 3 environments; 6 grain dehydration rate-related QTLs were repeatedly detected in 2 environments, and only 2 were stably expressed in all 3 environments. Figure 3 A). The phenotypic variance explained by a single QTL ranged from 1.16% to 20.88%. These QTLs were further classified into environment-stable QTLs, trait-stable QTLs, and method-stable QTLs. Pairwise intersection analysis identified 13 pleiotropic QTLs. Figure 3 C), located on chromosomes 1, 2, 3, 4, 6, 9, and 10 respectively. Figure 3 D).

[0044] The results are as follows Figure 4 As shown: Based on the initial QTL mapping results, a multi-trait co-localization site exists on the long arm of chromosome 3, with a physical range of 186.3–188.1 Mb and a phenotypic variance explained (PVE) ranging from 4.8% to 20.8%. The additive effect of this site is contributed by the PH4CV allele and has been named qKDR3.06.

[0045] 3. The main QTL for corn kernel dehydration rate - qKDR3.06 Development of tightly linked KASP tags Primer design: Based on the SNP site location of QTL, 200 bp flanking sequences were extracted from the B73 reference genome (RefGen_v3), and a set of KASP polymorphism stable primers were designed using SnapGene and Primer software.

[0046] FA: GAAGGTGACCAAGTTCATGCT CGATCTTTGTGTTGGCTCTTCCTG (SEQ ID NO.1) FB: GAAGGTCGGAGTCAACGGATT CGATCTTTGTGTTGGCTCTTCCTT (SEQ ID NO.2) RC:AGATCACCATTCCTGAGCCCTCA (SEQ ID NO.3) PCR product: 5'——CGATCTTTGTGTTGGCTCTTTCCT [T / G] TGCTGCTGAGGGCTCAGGAATGGTGATCT——3' (SEQ ID NO.4, K represents T or G in the sequence listing) Primer FA is a primer with the FAM fluorescent tag sequence (underlined bases) at the 5' end, and primer RC amplifies the fragment where SNP site 3-187.104.106 is G. The fluorescent signal of the FAM group can be read using a fluorescence signal reader. Primer FB is a primer with a HEX fluorescent tag sequence (underlined bases) at the 5' end, and primer RC amplifies the fragment with SNP site 3-187.104.106 as T. The fluorescent signal of the HEX group can be read using a fluorescence signal reader.

[0047] Example 2. Establishment of a genotyping method using the KASP marker Chr3-187.104 The KASP marker Chr3-187.104 was used to detect different allelic types of maize kernel moisture content and dehydration rate at physical locations 187, 104, and 106 on maize chromosome 3.

[0048] 1. PCR amplification system and procedure Genomic DNA was extracted from leaves of maize parents and 204 recombinant inbred lines using the AB solution method at high throughput, and dissolved in 50 μL ddH2O. The DNA was then subjected to quality testing by 1% agarose gel electrophoresis, requiring the extracted DNA to be free of obvious impurities, have clear bands, and show no degradation. After DNA concentration determination, it was uniformly diluted to 50 ng / μL, and PCR amplification was performed using the diluted maize genomic DNA as a template.

[0049] Prepare primer working solution: 12 μL each of primer FA and primer FB (see Example 1 for specific sequences), 30 μL of primer RC (see Example 1 for specific sequences), and 46 μL of ddH2O, for a total of 100 μL.

[0050] PCR amplification reaction system (4 μL): PCR reagent composition: 2×KASP Master mix volume is 2 μL, primer working solution volume is 0.056 μL, genomic DNA concentration is about 50 ng / μL, volume is 1 μL, and ultrapure water is added to 4 μL.

[0051] The PCR reaction program was the Touchdown program: 95℃ pre-denaturation for 10 min, 95℃ denaturation for 15 s; 61℃ annealing for 60 s, decreasing by 0.6℃ per cycle, for 10 cycles; 95℃ denaturation for 15 s, 55℃ annealing for 60 s, for 28 cycles.

[0052] 2. Genotyping After the PCR reaction is complete, the terminal fluorescence reading is read in a FLUOstar Omega microplate reader. Then, the data is imported into KlusterCaller software for genotyping. If the genotyping is not obvious, it is generally necessary to add 3 more cycles before genotyping.

[0053] The FAM excitation wavelength is 485 nm, and the emission wavelength is 520 nm. The HEX excitation wavelength is 535 nm, and the emission wavelength is 556 nm. The system reference fluorescence ROX excitation wavelength is 575 nm, and the emission wavelength is 610 nm.

[0054] The results are as follows Figure 5 As shown, if only the FAM group shows a fluorescent signal (blue fluorescence), then the genotype of the maize being tested is GG (i.e., homozygous for G at SNP site 3-187.104 in the maize genome); if only the HEX group shows a fluorescent signal (red fluorescence), then the genotype of the maize being tested at SNP site 3-187.104 is TT (i.e., homozygous for T at SNP site 3-187.104 in the maize genome); if a green fluorescent signal is shown, then the genotype of the maize being tested at SNP site 3-187.104 is TG (i.e., heterozygous for both T and G at SNP site 3-187.104 in the maize genome). Example 3. Application of KASP_Chr3-187.104 in assisting the identification of maize kernel moisture content and dehydration rate, and in maize breeding. In 2018 and 2019, our research group conducted phenotypic identification of grain moisture content in 164 natural population inbred lines. The grain moisture content of ears was measured at 7, 14, 21, 28, 35, 42, 49, 56, 63 and 70 days after pollination using the oven drying method, and the grain dehydration rate was determined using the AUDDC method (Qu et al. 2023).

[0055] All inbred lines were tagged and sampled at the 6-leaf stage, and genomic DNA was extracted from the leaves. The KASP_Chr3-187.104 marker genotype detection method was as described in Example 2. Here, GG indicates that the genotype of the maize material at the 3-187.104 SNP locus is GG, TT indicates that the genotype of the maize material at the SNP locus is TT, and TG indicates that the genotype of the maize material at the SNP locus is TG.

[0056] The molecular marker KASP_Chr3-187.104 was used to perform [the study]. qKDR3.06 Genotyping was performed to obtain the genotypes of each individual plant, and the results showed that ( Figure 6 KASP marker analysis revealed that in the natural population, 70 inbred lines had the TT allele type, with average grain moisture content of 42.82±4.11, 39.06±4.12, 33.81±4.72, and 26.72±5.61 mg / L at 35-56 days post-pollination, and a grain dehydration rate of 724.88±109.51 mg / L (35-56 days post-pollination). The remaining 65 inbred lines had the GG allele type, with an average grain moisture content of 44.45±4.0 mg / L at 35-56 days post-pollination. 7. The allele types of the inbred lines were TG, with average grain moisture content of 42.20±3.19, 38.74±4.16, 32.61±4.41, and 26.31±5.17 ppm, respectively, and a grain dehydration rate of 755.23±87.66 ppm (35-56 days after pollination). A T-test was conducted on the grain moisture content and dehydration rate phenotypes of the inbred lines. The results showed that the grain moisture content of the inbred lines carrying the TT genotype was significantly lower than that of the inbred lines carrying the GG genotype (p < 0.05), and the grain dehydration rate was significantly faster than that of the inbred lines carrying the GG genotype (p < 0.05). Figure 6 There was no significant difference in grain moisture content and grain dehydration rate between inbred lines carrying the TG genotype and those carrying the TT genotype (p > 0.05). Figure 6 There was no significant difference in grain moisture content and grain dehydration rate between inbred lines carrying the TG genotype and those carrying the GG genotype (p > 0.05). These results indicate that this molecular marker can be used to eliminate inbred lines with slow dehydration in the field, saving production costs and significantly improving selection efficiency. This allows for the rapid screening of inbred lines with fast grain dehydration for subsequent breeding.

[0057] The above description is only a part of the embodiments of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention shall fall within the protection scope of the present invention.

Claims

1. Substances for detecting polymorphisms or genotypes at maize SNP sites may be used in any of the following applications (1) to (4): (1) To determine the moisture content and / or dehydration rate of corn kernels; (2) Breeding for maize kernel moisture content and / or dehydration rate; (3) Prepare products for identifying the moisture content and / or dehydration rate of corn kernels; (4) To prepare products for breeding maize kernel moisture content and / or dehydration rate; The SNP site is the 25th nucleotide of SEQ ID NO.4 in the sequence listing, and its nucleotide type is T or G.

2. The application according to claim 1, characterized in that, The kernel moisture content of the test maize with the genotype TT at the SNP locus is lower than that of the test maize with the genotype GG or TG at the SNP locus, and the kernel dehydration rate of the test maize with the genotype TT at the SNP locus is faster than that of the test maize with the genotype GG or TG at the SNP locus.

3. The application according to claim 1, characterized in that, The substance includes at least one of the following: A1), A2), or A3): A1) The substance described is a primer for amplifying maize genomic DNA fragments containing the SNP sites described above; A2) The substance described is a PCR reagent containing the primers described in A1); A3) The substance is a kit containing the primers described in A1) or the PCR reagents described in A2).

4. The application according to claim 3, characterized in that, The primers include primer FA, primer FB, and primer RC; The nucleotide sequence of primer FA is shown in positions 22-46 of SEQ ID NO.1; The nucleotide sequence of the primer FB is shown as positions 22-46 of SEQ ID NO.2; The nucleotide sequence of the primer RC is shown in SEQ ID NO.

3.

5. The application according to claim 3, characterized in that, The primers include primer FA, primer FB, and primer RC; The nucleotide sequence of the primer FA is shown in SEQ ID NO.1; The nucleotide sequence of the primer FB is shown in SEQ ID NO.2; The nucleotide sequence of the primer RC is shown in SEQ ID NO.

3.

6. A method for determining the moisture content and / or dehydration rate of corn kernels, characterized in that, Includes the following steps: The genotypes of SNP sites in the maize genome to be tested are detected, and the moisture content and / or dehydration rate of maize kernels are identified based on the genotypes. The SNP site is the 25th nucleotide of SEQ ID NO.4 in the sequence listing, and its nucleotide type is T or G; The kernel moisture content of the test maize with the genotype TT at the SNP locus is lower than that of the test maize with the genotype GG or TG at the SNP locus, and the kernel dehydration rate of the test maize with the genotype TT at the SNP locus is faster than that of the test maize with the genotype GG or TG at the SNP locus.

7. The method according to claim 6, characterized in that, The method includes the following steps: (1) Using the genomic DNA of the maize to be tested as a template, KASP amplification was performed using the primers described in claim 4 or claim 5; (2) Perform fluorescence detection on the amplification products to determine the genotype of the SNP in the maize to be tested; (3) Identify the kernel moisture content and dehydration rate of the maize to be tested based on the genotype results: The kernel moisture content of the maize to be tested with the genotype TT at the SNP site is lower than that of the maize to be tested with the genotype GG or TG at the SNP site, and the kernel dehydration rate of the maize to be tested with the genotype TT at the SNP site is faster than that of the maize to be tested with the genotype GG or TG at the SNP site.

8. The application of the method of claim 6 in breeding maize kernel moisture content and / or dehydration rate.

9. A method for selecting maize with low grain moisture content, characterized in that, The method includes detecting the genotype of the SNP site described in claim 1 in the maize genome, and selecting maize with the genotype TT as the parent for breeding.

10. A method for breeding maize with a fast grain dehydration rate, characterized in that, The method includes detecting the genotype of the SNP site described in claim 1 in the maize genome, and selecting maize with the genotype TT as the parent for breeding.