Method for breeding japonica glutinous rice variety resistant to rice blast and herbicide by overcoming Pigm adverse effect

Abstract

The invention relates to a method for breeding a rice blast-resistant and herbicide-resistant japonica glutinous rice variety by overcoming Pigm adverse effects. A glutinous rice variety which is widely popularized in production and has excellent comprehensive characters is selected as a receptor parent, a broad-spectrum rice blast-resistant gene Pigm and a herbicide-resistant gene ALS are screened under the assistance of molecular markers, and the rice blast resistance gene Pigm and the herbicide-resistant gene ALS are obtained through backcross, selfing, multiple cross and phenotype screening based on thousand seed weight. The thousand seed weight of the japonica glutinous rice material is 26.5 g or above, and the japonica glutinous rice material is polymerized with broad-spectrum rice blast-resistant and herbicide-resistant genes. The glutinous rice new strain bred by the method successfully integrates two key genes of broad-spectrum high rice blast resistance Pigm and imidazolone herbicide resistance ALS, and main agronomic characters such as thousand seed weight, maturing rate, plant and leaf morphology and the like are equivalent to or better than those of an excellent receptor parent.

Description

Technical Field

[0001] This invention relates to the field of crop genetics and breeding technology, and particularly to a method for overcoming... Pigm Methods for breeding japonica glutinous rice varieties resistant to rice blast and herbicides to adverse effects. Background Technology

[0002] Japonica glutinous rice is a distinctive rice resource in my country. Due to its high milling yield, strong glutinousness, and excellent taste, it is in high demand in food processing, brewing, and traditional staple food fields, and its planting area continues to grow. However, the currently cultivated japonica glutinous rice varieties generally have two problems: first, their resistance to rice blast is generally weak; second, they lack herbicide resistance characteristics suitable for simplified cultivation.

[0003] Rice blast is one of the major diseases affecting rice production. However, japonica glutinous rice varieties generally lack broad-spectrum blast resistance genes, resulting in lower blast resistance compared to conventional rice varieties. Therefore, japonica glutinous rice faces a greater risk of blast damage. Aggregating broad-spectrum blast resistance genes is the most effective measure to address the weak blast resistance in glutinous rice. Among the cloned resistance genes… Pigm It has been recognized as one of the best genes with broad-spectrum and durable resistance. It exhibited high resistance and immunity against 29 out of 30 highly pathogenic bacterial strains collected from different countries and regions, with an resistance spectrum exceeding 91%. Pigm It possesses broad-spectrum and durable resistance characteristics and has been widely used in the improvement of rice blast resistance. However, a long-standing technical challenge for breeders is: when... Pigm When the gene is introduced into japonica rice, especially japonica glutinous rice, it consistently leads to a significant decrease in the thousand-grain weight of the recipient material. This adverse effect directly damages the appearance quality, processing quality, and marketability of the rice, resulting in many varieties containing [a specific genetic component]. Pigm The breeding materials of the gene lose their direct application value due to "smaller grains", which seriously limits the effective use of this excellent gene in disease resistance breeding of japonica glutinous rice.

[0004] On the other hand, with the transfer of rural labor, the increase in labor costs, and the development of large-scale operations, simplified rice cultivation has become a development trend. However, simplified rice paddies are prone to weed infestation and weedy rice, which seriously affects rice growth, yield, and quality. Manual weeding is extremely costly, and herbicide application is an effective means of controlling weed damage. Therefore, cultivating herbicide-resistant rice varieties is of great significance for promoting modern rice production. Herbicides targeting acetolactate synthase (ALS) include various types such as imidazolinones (IMs), sulfonylureas (SUs), triazolidinediamines (TPs), pyrimidine thiobenzoates (PTBs), and sulfonamide carbonyl triazolones (SCTs). Among them, imidazolinones (IMs) have the advantages of broad spectrum of weed control, low toxicity, high efficiency, and strong selectivity, and are currently the most mature class of herbicides used in production.

[0005] Molecular marker-assisted selection (MAS) technology is mature, reliable, does not damage gene structure, and poses no transgenic safety risks, and has been widely used in breeding new crop varieties and creating germplasm resources. However, the technical problems faced by those skilled in the art are as follows: If one attempts to apply broad-spectrum resistance to rice blast... Pigm Genes and herbicide resistance ALS While gene aggregation in japonica glutinous rice can be expected to yield the dual traits of "disease resistance + herbicide resistance," it will inevitably expose the rice to the risks posed by genetic factors. Pigm The significant decrease in thousand-grain weight resulting from gene introduction limits the value of cultivated materials in agricultural practice—even with excellent resistance, they cannot be widely applied due to insufficient grain weight. Therefore, how to successfully reduce thousand-grain weight without sacrificing it is a crucial issue. Pigm and ALS The integration of genes into japonica glutinous rice to cultivate practical varieties with synergistic improvements in resistance, yield, and quality is a pressing technical challenge in japonica glutinous rice breeding that has yet to be reported. Summary of the Invention

[0006] Purpose of the invention: To solve the above problems, the present invention provides a solution that overcomes... Pigm Methods for breeding japonica glutinous rice varieties resistant to rice blast and herbicides by selecting varieties with adverse effects; the newly bred lines have successfully combined broad-spectrum and high resistance to rice blast. Pigm and imidazolinone-resistant herbicides ALS Two key genes, and the main agronomic traits such as thousand-grain weight, seed setting rate, and plant and leaf morphology are comparable to or better than those of the superior recipient parent.

[0007] Technical solution: A way to overcome Pigm The method for breeding japonica glutinous rice varieties resistant to rice blast and herbicides by addressing adverse effects can be achieved through the following technical approach: selecting glutinous rice varieties with excellent comprehensive traits as recurrent parents, and aggregating broad-spectrum rice blast resistance genes through molecular marker-assisted selection.Pigm and herbicide resistance genes ALS In conjunction with phenotypic screening based on thousand-grain weight, varieties with a thousand-grain weight of over 26.5g and exhibiting polymerization were selected. Pigm Genes and ALS A new japonica glutinous rice line with advanced genes, thus overcoming the challenges posed by... Pigm Adverse effects of decreased thousand-grain weight caused by genetic factors.

[0008] Furthermore, the breeding methods include the following specific steps: (1) Breeding of intermediate materials of glutinous rice resistant to rice blast: Using the currently widely promoted glutinous rice variety A as the recipient parent, and incorporating the rice blast resistance gene Pigm The donor parent B was crossed to obtain the F1 generation. In the F1 generation and subsequent generations, multiple rounds of crosses were conducted. Pigm Gene molecular markers were used for detection, and agronomic traits similar to those of the recipient parent A and those carrying [the gene markers] were selected. Pigm A single plant with the gene is crossed multiple times with the recipient parent A until a plant with a genetic background highly similar to parent A and carrying the gene is obtained. Pigm Backcross progeny material of the gene; from said backcross progeny material, select those carrying the gene Pigm Individual plants with the gene were used for subsequent crosses with herbicide-resistant intermediates; (2) Cultivation of herbicide-resistant intermediate materials: Using the currently widely promoted glutinous rice variety A as the recipient parent, and combining it with a herbicide-resistant gene... ALS Furthermore, the F1 generation was obtained by crossing donor parent C with a thousand-grain weight >28.0g, and the process was carried out simultaneously in the F1 generation and subsequent generations. ALS Gene molecular marker detection-assisted selection and thousand-grain weight phenotype screening: Firstly, using ALS Gene molecular markers were used to detect the target genotype, and the thousand-grain weight of the detected target plants was measured. Based on existing research, Pigm There is a 5-10% "weight reduction" effect on the thousand-grain weight of the japonica rice recipient parent. Therefore, only single plants with a thousand-grain weight of not less than 27.5 g are retained for backcrossing or propagation. Through multiple rounds of molecular markers and backcrossing, plants with a genetic background highly similar to parent A and carrying [the desired genetic characteristics] are obtained. ALS Backcross progeny materials with significantly increased gene content and thousand-grain weight; from said backcross progeny materials, select those carrying the gene content... ALS The single plants with the gene were used for subsequent crosses with intermediate materials resistant to rice blast; (3) Overcome Pigm Adverse effects, breeding japonica glutinous rice varieties resistant to rice blast and herbicide: The intermediate materials obtained in steps (1) and (2) are recrossed to obtain recross F1 generation seeds; the recross progeny population is planted, and molecular markers are used to select for the recross progeny population. Pigm Genes and ALS Simultaneous gene-assisted screening was performed to identify individuals carrying homozygous genes. PigmGenes and homozygotes ALS Single plants with the selected dual-gene homozygous single plants were selected, and their thousand-grain weight was determined. Given that current production generally requires a thousand-grain weight of 26.0 g or higher for japonica glutinous rice to have significant commercial potential, single plants with a thousand-grain weight below 26.5 g were eliminated. Single plants or lines meeting the thousand-grain weight standard and exhibiting excellent agronomic traits were then subjected to multiple generations of breeding and trait identification to ultimately obtain aggregated [products / seeds]. Pigm Genes and ALS Genes, Overcoming Pigm A new japonica glutinous rice variety with adverse reactions, resistance to rice blast, resistance to herbicides, and a thousand-grain weight of not less than 26.5 g.

[0009] Furthermore, the aforementioned Pigm The gene is derived from W1063, an intermediate material selected from the hybrid offspring of Gumei 4 and Wuyunjing 27; the ALS gene is derived from the japonica rice varieties Jinjing 818 or Jinjing 616; the currently widely promoted glutinous rice variety A is Zhennuo 19 or Wankennuo 1.

[0010] To cultivate blast-resistant and herbicide-resistant japonica glutinous rice varieties with practical application value, it is advisable to select glutinous rice varieties with large current planting areas as the source of glutinousness, such as Zhennuo 19 and Wanken Nuo 1. The genes selected as donors for blast disease and herbicide resistance genes must be broad-spectrum and durable resistance genes for blast disease and herbicide resistance that have been proven to have practical application value in rice production. Given that my country and various provinces adopt a "one-vote veto system" in rice regional trials where failure to meet blast disease standards results in disqualification, this invention primarily considers using broad-spectrum resistance genes. Pigm To improve the rice blast resistance of japonica glutinous rice. In order to overcome Pigm To mitigate the adverse effect of reduced thousand-grain weight, it is advisable to select donors with stable herbicide resistance and a thousand-grain weight >28.0 g. The imidazolinone-resistant japonica rice varieties Jinjing 818 and Jinjing 616 carry the dominant phenotype. ALS The gene, with a thousand-grain weight >28.0 g, and already widely promoted in japonica rice areas, meets the requirements of this invention. All of the above varieties are commercially available.

[0011] Furthermore, the rice blast resistance described in step (1) Pigm Gene detection employed molecular marker-assisted selection using specific primers, the sequences of which are shown in SEQ ID NO. 1 and SEQ ID NO. 2; specifically, the resistance to rice blast... Pigm The gene detection method is based on the Chinese patent CN106148335B, which describes the blast resistance gene in GuMei No. 4 rice. Pigm Molecular markers and their application: Specific molecular marker Pigm-4 implementation: Forward primer sequence: 5'-ATGCTCGATTCGTTACATTT-3' (SEQ ID NO. 1), reverse primer sequence: 5'-CGTCCCACACTTTCTTTTT-3' (SEQ ID NO. 2).

[0012] Furthermore, the herbicide resistance described in steps (2) and (3) ALS Gene detection employed competitive allele-specific PCR primers for marker-assisted selection. The primer pairs comprised three primers with sequences as shown in SEQ ID NO. 3, SEQ ID NO. 4, and SEQ ID NO. 5. Specifically, the herbicide-resistant... ALS The gene detection method was based on the sequencing results of the existing literature "Development and Application of Functional Markers for Rice Imidazolinone Resistance Gene ALS" (Wang Fangquan et al., 2018), specifically in Jinjing 818. ALS Based on the variation from G(C) to A(T) at the 1880 bp site of the start codon, this invention designs a competitive allele-specific PCR (KASP) primer pair for ALS-627, specifically including three primers: Mutant (Jinjing 818 type) preprimer ALS-627-F1: GAAGGTGACCAAGTTCATGCT ATCATGTCCTTGAATGCGCCCCCA T (SEQ ID NO. 3), italics indicate the added carboxyfluorescein (FAM) fluorescent signal tag; Wild-type preprimer ALS-627-F2: GAAGGTCGGAGTCAACGGATTA TCATGTCCTTGAATGCGCCCCCA C (SEQ ID NO. 4), italics indicate the added 5-hexachlorofluorescein aminophosphate (HEX) fluorescent signal tag; Universal back primer ALS-627-R: CAGTCCTGTAACAAAGAAGAGTGAAGT (SEQ ID NO. 5); This primer pair can be amplified using a fluorescence PCR instrument, and the appearance of different fluorescence can distinguish between the three allele types: dominant, heterozygous, and recessive.

[0013] Furthermore, in step (1), the specific method for cultivating intermediate materials of glutinous rice resistant to rice blast includes the following steps: ① Select glutinous rice variety A, which is currently widely promoted, as the recipient, and fertilize it with a gene containing resistance to rice blast.Pigm Material B was crossed to obtain F1, which is the F1-AB population; ② Plant the F1-AB population, with a planting scale of 24 plants, and utilize the seedling stage. Pigm Gene molecular markers were detected, and 1-2 target plants with the growth period and leaf morphology most similar to the recipient parent A were selected from the F1-AB population and backcrossed with the recipient parent to obtain the first generation BC1F1 population.

[0014] ③ Repeat step ② above. Based on the breeding objectives, use molecular marker-assisted selection to select the parent that is closest to the recurrent parent A and carries a heterozygous chromosome. Pigm The target single plant is backcrossed for n generations to obtain the BCnF1-AB population; ④ Plant the BCnF1-AB population, with a planting scale of 24 plants, and utilize the seedling stage. Pigm Gene molecular markers are used for detection to identify heterozygous individuals. Pigm The target plant was further crossbred with the herbicide-resistant intermediate material obtained in step (2), and the target plant was harvested to obtain the BCnF2-AB population. ⑤ Plant the BCnF2-AB population, expanding the planting scale to 48 plants, and utilize the seedling stage. Pigm Gene molecular markers are used for detection to select carriers of homozygous genes. Pigm The target individual plants of the gene are further self-pollinated and used for identification of disease resistance and agronomic traits.

[0015] Furthermore, in step (2), the specific method for cultivating the herbicide-resistant intermediate material is as follows: ① Select glutinous rice variety A, which is currently widely promoted, as the recipient, and then synthesize it with a herbicide-resistant gene. ALS Furthermore, materials with a thousand-grain weight > 28.0 g were crossbred with material C to obtain F1, which is the F1-AC population; ② Plant F1-AC population, with a scale of 24 plants, and utilize during the seedling stage. ALS Genetic molecular markers were used for detection. Target plants were not hybridized for the time being. The thousand-seed weight of each plant was examined. Individuals with a thousand-seed weight ≥27.5 g were selected for planting the next generation, and the rest were discarded. ③ The F2-AC population / line obtained through planting and screening has a size of 24 plants. Marker pairings were continued during the seedling stage. ALS Genes were molecularly analyzed, and single plants with main agronomic traits similar to the recurrent parents were selected for backcrossing to obtain the BC1F1 population, denoted as BC1F1-AC. ④ Repeat steps ② and ③ above to obtain and cultivate the BCnF1 population, denoted as BCnF1-AC. During the seedling stage, molecular markers are used to... ALS Genetic testing was conducted in preparation for further crossbreeding, and target individual plants were harvested to obtain the BCnF2-AC population; ⑤ Plant the BCnF2-AC population, expanding the planting scale to 48 plants, and use molecular markers during the seedling stage. ALS Genetic testing to select carriers of homozygous genetics ALS The target individual plants of the gene were further self-pollinated and harvested for herbicide resistance and agronomic trait identification.

[0016] Furthermore, in step (3), overcoming Pigm Adverse effects; specific methods for breeding japonica glutinous rice varieties resistant to rice blast and herbicides are as follows: ① Using the intermediate materials obtained in steps (1) and (2) respectively, i.e. carrying hybrid materials Pigm Target individual plants containing herbicide resistance genes ALS Single plants were repeatedly crossed to obtain F1 seeds of the cross, denoted as CF1-A / B / C; ② Plant 24 CF1-A / B / C plants and test them. Pigm , ALS Genes were selected, and mature plants carrying double heterozygotes were mixed and harvested to obtain the CF2 population, denoted as CF2-A / B / C. ③ Planting CF2-A / B / C populations, with a scale of over 1000 plants to achieve effective recombination of beneficial genes for low-yield thousand-grain weight, involves using the aforementioned markers to sample individual plants within the population during the seedling stage. Pigm , ALS Genetic testing was conducted, and single plants that were homozygous for both genes and had agronomic traits similar to or superior to the recurrent parents were selected for seed collection. After seed collection, the thousand-seed weight of a single plant was examined, and single plants with a thousand-seed weight of less than 26.5 g were eliminated to obtain CF3 seeds, which are represented as CF3-A / B / C. ④ Plant CF3-A / B / C lines, with 48 plants per line, and obtain CF4 seeds using the method described in step ③ above, denoted as CF4-A / B / C; ⑤ Plant CF4-A / B / C lines, and conduct blast resistance identification on each line during the heading stage; harvest lines with homozygous dual genes and excellent agronomic traits at maturity to obtain aggregates. Pigm Genes and ALS Genes, Overcoming Pigm A new japonica glutinous rice variety with adverse reactions, resistance to rice blast, resistance to herbicides, and a thousand-grain weight of not less than 26.5 g.

[0017] This invention also discloses a new japonica glutinous rice line bred using the above method, wherein the new line aggregates a homozygous rice blast resistance gene. Pigm and herbicide resistance genes ALS ,overcome Pigm Adverse reactions, resistance to rice blast, resistance to herbicides, and a thousand-grain weight of not less than 26.5g.

[0018] Furthermore, the new strain is Zhennuo 1279 or Zhennuo 1293.

[0019] Beneficial effects: Compared with the prior art, the present invention has the following advantages: (1) The present invention relates to Pigm , ALS Gene screening using molecular markers enables rapid, accurate, and high-throughput identification of individuals within a population. Pigm , ALS By combining molecular marker screening with early selection of key phenotypic traits (thousand-grain weight), large-grained individual plants are identified during the stage of creating herbicide-resistant intermediate materials, and a thousand-grain weight threshold (>26.5 g) is enforced during the final aggregation stage. This dual-track selection strategy of "genotype-phenotype" greatly reduces blind selection, improves the overall compliance rate of selected individuals, and effectively shortens the breeding cycle of complex traits.

[0020] (2) This invention employs a "parallel" breeding method to create varieties containing Pigm Intermediate materials for resistance to rice blast, and those carrying genes. ALS It is also a type of glutinous rice intermediate material with a high thousand-grain weight. Pigm Genes widely recognized as providing broad-spectrum resistance to rice blast. ALS The gene is a gene that has been successfully and widely used in production to resist imidazolinone herbicides. Related materials can be directly used for different breeding purposes to achieve free combination.

[0021] (3) This invention creates a polymeric rice blast resistance gene. Pigm With herbicide resistance genes ALS and overcome Pigm New glutinous rice varieties with adverse effects have effectively overcome the challenges of introducing broad-spectrum rice blast resistance genes. Pigm The introduction of japonica glutinous rice resulted in a significant decrease in thousand-grain weight. However, the polymeric lines obtained using the method of this invention (such as Zhennuo 1279) maintain the same high resistance to rice blast while exhibiting a significantly higher thousand-grain weight than single-grain varieties. Pigm The genetic line has been restored to and even surpassed the level of the original superior parents, solving a long-standing problem in this field.

[0022] (4) The new japonica glutinous rice lines bred by the method of the present invention (such as Zhennuo 1279 and Zhennuo 1293) have successfully combined broad-spectrum resistance to rice blast. (Pigm) and imidazolinone-resistant herbicides (ALS) With two key traits, and major agronomic traits such as thousand-grain weight, seed setting rate, and plant and leaf morphology being comparable to or better than the superior recipient parent, this variety combines the characteristics of "disease resistance, herbicide resistance, high and stable yield, and excellent glutinous rice marketability," providing a highly competitive new variety for the sustainable development of the japonica glutinous rice industry. Attached Figure Description

[0023] Figure 1 This is a schematic diagram of the breeding process in Embodiment 1 of the present invention.

[0024] Figure 2 The Zhennuo 19 (CK) and its near-isogenic line (Zhennuo 19-) in Example 1 of this invention. ​ Artificial inoculation (A, B, C) and blast resistance under disease nursery induction conditions (D, E, F).

[0025] ​ The Zhennuo No. 19 variety in Embodiment 1 of this invention ​ Differences in average thousand-grain weight (A), grain length (B, D), and grain width (C, E) among individuals with different genotypes.

[0026] ​ The Zhennuo No. 19 variety in Embodiment 1 of this invention ​ A schematic diagram comparing the herbicide resistance identification results of the introduced lines in the field (A) and in the laboratory (B). Detailed Implementation

[0027] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. After reading the present invention, any modifications of the present invention in various equivalent forms by those skilled in the art will fall within the scope defined by the appended claims.

[0028] Example 1: I. Selection of breeding materials: Recipient parent: Zhennuo 19, with a thousand-grain weight of 26.0 g per year. It is a high-yield and high-quality japonica glutinous rice bred by Zhenjiang Agricultural Science Research Institute in the hilly area of ​​Jiangsu Province. Variety right number: CNA20110042.3.

[0029] Rice blast resistance gene ​ Original donor: intermediate material W1063, derived from the hybrid offspring of Gumei 4 and Wuyunjing 27. Gumei 4 is a conventional indica rice variety bred by the Institute of Plant Protection, Sichuan Academy of Agricultural Sciences, while Wuyunjing 27 is a high-yield conventional japonica rice bred by Wujin Agricultural Science Institute, Jiangsu Province.

[0030] Herbicide-resistant genes ​ Donor: Jinjing 818, with a thousand-grain weight of about 28.3 g, is a conventional japonica rice variety bred by Tianjin Rice Research Institute.

[0031] II. Zhennuo No. 19 - ​ Construction of near-isogenic lines: In 2016, during the peak growing season in Jiangsu, Zhennuo 19 was used as the female parent, and homozygous F4 samples from Wuyunjing 27 × Gumei 4 were used. ​The intermediate genetic material W1063 was used for paternal hybridization. From the F1 generation onwards, [the process was carried out using...]. ​ Gene-specific primers (SEQ ID NO. 1 and 2) were used for marker-assisted selection. Ten consecutive backcrosses were performed in Jiangsu and Hainan provinces. In each generation, the variety with the most agronomical traits closest to Zhennuo 19 and carrying heterozygosity was selected. ​ A single genotype was used as the male parent for backcrossing. After 10 generations of backcrossing, BC strains with a highly restored genetic background were obtained in Hainan in 2021. 10 F1 population. Rice blast resistance was assessed in the offspring of this population, showing a significantly improved resistance level. However, the thousand-grain weight of all lines was significantly lower than that of Zhennuo 19 by 1.13-2.31 g (see Table 1), verifying the... ​ The adverse effects.

[0032] III. Development of intermediate materials for herbicide-resistant Dalizhennuo 19: In 2019, during the peak growing season in Jiangsu, Zhennuo 19 was used as the female parent and Jinjing 818 as the male parent for hybridization. From the F1 generation onwards, [the following was observed / utilized / etc.]. ​ Gene-specific KASP primers (SEQ ID NO. 3, 4, and 5) were used for marker-assisted selection to target the detected carriers. ​ Individual plants of the gene were individually tested at maturity, and only those with a thousand-seed weight ≥27.5 g were selected for seed propagation for backcrossing or planting in the next generation. Through two rounds of backcrossing and simultaneous screening, the BC2F1 population was obtained in Hainan in 2021. Resistance identification showed that this material exhibited complete resistance to imidazolinone herbicides (such as methoxyfenozide) (reference). ​ As shown in the figure), and the thousand-grain weight is consistently above 27.5 g.

[0033] IV. Overcoming ​ Adverse effects: resistance to rice blast, resistance to herbicides. Zhennuo 19: In 2021, Hainan, using the aforementioned Zhennuo No. 19... ​ BC 10 The target F1 plant is the female parent, with Zhennuo 19 as the main variety. ​ The target single plant of BC2F1 was used as the male parent for recrossing.

[0034] Starting with the CF1 generation, two sets of molecular markers are used to assist in the selection of carriers of heterozygotes. ​ + ​ The target is to harvest individual plants. To achieve the desired effect of effectively recombining genes with low thousand-grain weight, a CF2 generation population of over 1000 plants will be planted next year. Molecular marker-assisted selection will continue during the seedling stage. ​ + ​Single plants homozygous for both genes and exhibiting excellent agronomic traits were harvested for seed. The thousand-grain weight and yield of each plant were assessed, and plants with a thousand-grain weight greater than 26.5 g were retained. The CF3 line was planted, and stable and qualified single plants were further screened up to the CF5 generation. The CF5 generation lines were then subjected to blast disease resistance identification and comprehensive trait evaluation.

[0035] V. Evaluation Results: Several stable new lines were ultimately obtained, such as Zhennuo 1279 (#1) and Zhennuo 1293 (#3). Their main characteristics are as follows: 1) Investigation of agronomic traits of the introduced lines: The rice blast resistance and agronomic traits of near-isogenic lines and recipient parents were investigated. The results showed: (1) Zhennuo No. 19 - ​ Traits of near-isogenic lines: The results of two consecutive years of artificial inoculation and induction identification of the recurrent parent variety Zhennuo 19 and its near-isogenic lines for rice blast showed that: (referring to...) ​ As shown, Zhennuo 19 (CK) and its near-isogenic line (Zhennuo 19-) ​ Artificial inoculation (A, B, C) and disease nursery induction identification conditions showed resistance to panicle blast (D, E, F). The recipient parent, Zhennuo 19 (CK), had an average panicle blast grade of 7.4 and 7.0 after artificial inoculation, indicating moderate susceptibility. The inoculation disease grade of each near-isogenic line (Line 1-Line 3) ranged from 1.0 to 1.8, reaching the level of resistance to rice blast. Disease nursery induction identification results showed that the resistance frequency of the recipient parent was 38.0% and 40.33% in two years, respectively, and the resistance frequency of each near-isogenic line ranged from 88.67% to 91.33% (e.g., ...). ​ (As shown). Artificial inoculation and nursery induction identification showed that Zhennuo 19 was susceptible to panicle blast, while ​ It can significantly enhance its resistance to rice blast.

[0036] For two consecutive years, Jiangsu Zhengji has conducted research on the glutinous rice variety No. 19 from the town of Lunhuiqin and its related varieties. ​ The growth period, main agronomic traits, and yield of near-isogenic lines were investigated, and the results are shown in Table 1. There were no significant differences in heading date, number of effective panicles per plant, total number of grains per panicle, seed setting rate, and yield per plant between the near-isogenic lines and the control Zhennuo 19. However, the thousand-grain weight of all lines was significantly lower than that of the recipient parents. The thousand-grain weight of the control Zhennuo 19 was 25.34-26.10 g, while the thousand-grain weight of each introduced line was between 23.79-24.34 g, a decrease of 1.13-2.31 g, or 4.5%-8.9%. This decrease in thousand-grain weight severely degraded the marketability of the glutinous rice, directly affecting its production and utilization value. ​ The negative effects it brings.

[0037] Table 1 Zhennuo No. 19 and its ​Comparison of major agronomic traits and yield in near-isogenic lines

[0038] In order to analyze ​ The reasons for the decrease in thousand-grain weight were further investigated by constructing the Zhennuo 19 variety. ​ BC 11 In the F2 population, markers were used to detect the presence of recessive homozygous individuals consistent with the receptor in 48 individual plants. ​ / ​ (AA), heterozygous ​ / ​ (AB) homozygous ​ / ​ The number of plants with the (BB) genotype was 11, 25, and 13, respectively, conforming to a ratio of 1:2:1. The mean thousand-grain weight of the population was 24.85 g, the mean grain length was 7.30 mm, and the mean grain width was 3.70 mm. The mean thousand-grain weight of plants carrying the BB genotype was 23.79 g, significantly lower than that of plants carrying the AA genotype (25.93 g). There was no significant difference in grain length among plants carrying different genotypes. The mean grain width of plants carrying the BB genotype was 3.63 mm, significantly lower than that of plants carrying the AA genotype (3.78 mm). This indicates that the decrease in grain width is the main reason for the decrease in thousand-grain weight. (See reference for details.) ​ For Zhennuo No. 19 - ​ Differences in mean thousand-grain weight (A), grain length (B, D), and grain width (C, E) among individuals with different genotypes AA, AB, and BB.

[0039] (2) Zhennuo No. 19 - ​ Herbicide resistance of the introduced strain: The herbicide used for resistance identification was methoxyfenozide, an imidazolinone herbicide (Jiangsu Zhongqi Crop Protection Co., Ltd., with an active ingredient content of 4% by mass). At the 2-leaf, 1-heart stage, the methoxyfenozide (aqueous) solution was diluted 1000 times and sprayed at 300 L / hm². Resistance was assessed 15 days later. Normally growing seedlings were classified as imidazolinone-resistant individuals, while dead seedlings were classified as imidazolinone-sensitive individuals.

[0040] Outdoor field and laboratory hydroponic experiments revealed that the recipient parent variety, Zhennuo 19, began to yellow 7 days after being sprayed with methoxyfenozide herbicide, and completely withered and died after about 15 days. However, the herbicide introduced into Jinjing 818... ​ Gene Zhennuo No. 19 - ​ The seedlings of this strain have a 100% survival rate, such as ​ As shown, they are Zhennuo No. 19 - ​Herbicide resistance identification results of the introduced lines in the field (A) and laboratory (B). The thousand-grain weight was investigated at maturity, with the three lines yielding 27.54 g, 28.01 g, and 27.65 g, respectively.

[0041] (3) Zhennuo No. 19 - ​ / ​ Properties of polymer systems: Five agronomically stable CF5 double-gene introduced lines (#1~#5) were obtained through screening. The results of blast resistance and herbicide resistance identification of the recipient parent Zhennuo 19 and its double-gene introduced lines showed that the blast resistance level of the double-gene introduced lines was between 1.5 and 2.0, reaching the level of blast resistance, similar to Zhennuo 19. ​ The near-isogenic lines are comparable. The resistance of the double-gene-introduced lines to methomyl is similar to that of Zhennuo 19- ​ Single-gene lines show consistent expression.

[0042] The recipient parent, Zhennuo 19, and Zhennuo 19- ​ / ​ The growth period, main agronomic traits, and yield of the double-gene introduced lines were investigated, and the results are shown in Table 2. There were no significant differences in heading date, number of effective panicles per plant, and seed setting rate between the double-gene introduced lines and the control Zhennuo 19. The total number of grains per panicle increased in lines #1, #3, and #5. The thousand-grain weights of lines #1 and #3 were 26.64 g and 26.59 g, respectively, significantly higher than the control. The yield per plant of lines #1 and #3 increased, but not significantly. Based on field performance, lines #1 and #3 were named Zhennuo 1279 and Zhennuo 1293, respectively. After propagation and comparison, one line will be selected to participate in the Jiangsu provincial rice intermediate trial.

[0043] Table 2 Zhennuo No. 19 and Zhennuo No. 19- ​ / ​ Comparison of the main agronomic traits of the imported lines

[0044] Comparative Example 1: This comparative example does not include conventional molecular marker-assisted breeding methods that incorporate the core steps of this invention.

[0045] Materials: Recipient parent, gene donor ( ​ Donor W1063 ​ The donor, Jinjing 818, and the molecular markers were the same as in Example 1.

[0046] The difference lies in the breeding methods: the hybridization and backcrossing steps follow a conventional convergent breeding pathway (multiple backcrosses followed by three crosses). In all backcross generations, only molecular markers are used for detection. ​ and ​Genes were selected, and individual plants with agronomical traits similar to the recurrent parents were chosen. Thousand-grain weight was not measured or screened for individual plants during the process. In the self-pollination and selection steps, progeny with background recovery (BC) were obtained. n After F2), only MAS filtering is performed. ​ and ​ Single plants homozygous for both genes. No exclusion criterion of "thousand-grain weight > 26.5 g" was imposed on these selected single plants. In the phenotypic identification step, the finally obtained stable homozygous lines were subjected to the same disease resistance, herbicide resistance, and thousand-grain weight assessment as in Example 1.

[0047] Results: 35 samples were obtained using the conventional method described above. ​ and ​ Stable lines homozygous for both genes. All lines exhibited high resistance to rice blast and herbicides, proving successful gene aggregation. Thousand-grain weight (core comparative data): The thousand-grain weight of the 35 lines ranged from 23.5 g to 26.0 g, with an average of 24.8 g, significantly lower than the recipient parent Zhennuo 19 (approximately 26.0 g). No line reached the 26.5 g standard set in this invention, and only two lines (5.7%) reached 26.0 g. Compared to the line obtained in Example 1 of this invention (Zhennuo 1279: 26.64 g), the average thousand-grain weight is about 2.0 g lower. The data comparison in Example 1 shows that while gene aggregation using only the conventional MAS method can obtain the target resistance, it cannot avoid... ​ The genetic factors caused a significant decrease in the thousand-grain weight.

[0048] This invention provides only one embodiment as a specific example of patent implementation. Obviously, all genetic modifications and breeding applications utilizing this gene resource or its corresponding screening markers fall within the protection scope of this invention.

Claims

1. A way to overcome Pigm A method for breeding japonica glutinous rice varieties resistant to rice blast and herbicides by selecting varieties with adverse effects, characterized in that: Glutinous rice varieties with excellent comprehensive traits were selected as recurrent parents, and broad-spectrum resistance genes to rice blast were aggregated through molecular marker-assisted selection. Pigm and herbicide resistance genes ALS In conjunction with phenotypic screening based on thousand-grain weight, varieties with a thousand-grain weight of over 26.5g and exhibiting polymerization were selected. Pigm Genes and ALS A new japonica glutinous rice line with advanced genes, thus overcoming the challenges posed by... Pigm Adverse effects of decreased thousand-grain weight caused by genetic factors.

2. A way to overcome Pigm Methods for breeding japonica glutinous rice varieties resistant to rice blast and herbicides to adverse effects. Its features include the following specific steps: (1) Breeding of intermediate materials of glutinous rice resistant to rice blast: Using the currently widely promoted glutinous rice variety A as the recipient parent, and incorporating the rice blast resistance gene Pigm The donor parent B was crossed to obtain the F1 generation. In the F1 generation and subsequent generations, multiple rounds of crosses were conducted. Pigm Gene molecular markers were used for detection, and agronomic traits similar to those of the recipient parent A and those carrying [the gene markers] were selected. Pigm A single plant with the gene is crossed multiple times with the recipient parent A until a plant with a genetic background highly similar to parent A and carrying the gene is obtained. Pigm Backcross progeny material; From the backcross progeny material, select those carrying Pigm Individual plants with the gene were used for subsequent crosses with herbicide-resistant intermediates; (2) Cultivation of herbicide-resistant intermediate materials: Using the currently widely promoted glutinous rice variety A as the recipient parent, and combining it with a herbicide-resistant gene... ALS Furthermore, the F1 generation was obtained by crossing donor parent C with a thousand-grain weight >28.0g, and the process was carried out simultaneously in the F1 generation and subsequent generations. ALS Gene molecular marker detection-assisted selection and thousand-grain weight phenotype screening: Firstly, using ALS Target genotypes were detected using molecular markers, and the thousand-seed weight of the identified target plants was measured. Only plants with a thousand-seed weight of at least 27.5 g were retained for backcrossing or propagation. Through multiple rounds of molecular marker and backcrossing, plants with a genetic background highly similar to parent A and carrying [the target genotype] were obtained. ALS Backcross progeny materials with significantly increased gene content and thousand-grain weight; from said backcross progeny materials, select those carrying the gene content... ALS The single plants with the gene were used for subsequent crosses with intermediate materials resistant to rice blast; (3) Overcome Pigm Adverse effects, breeding japonica glutinous rice varieties resistant to rice blast and herbicide: The intermediate materials obtained in steps (1) and (2) are recrossed to obtain recross F1 generation seeds; the recross progeny population is planted, and molecular markers are used to select for the recross progeny population. Pigm Genes and ALS Simultaneous gene-assisted screening was performed to identify individuals carrying homozygous genes. Pigm Genes and homozygotes ALS A single plant with a specific gene; The thousand-grain weight of the selected homozygous plants with two genes was measured, and plants with a thousand-grain weight of less than 26.5 g were eliminated. Multiple generations of breeding and trait identification were carried out on individual plants or lines that met the thousand-grain weight standard and had excellent agronomic traits, ultimately obtaining aggregates. Pigm Genes and ALS Genes, Overcoming Pigm A new japonica glutinous rice variety with adverse reactions, resistance to rice blast, resistance to herbicides, and a thousand-grain weight of not less than 26.5 g.

3. The overcoming according to claim 2 Pigm A method for breeding japonica glutinous rice varieties resistant to rice blast and herbicides by selecting varieties with adverse effects, characterized in that: The Pigm The gene originated from W1063, an intermediate material selected from the hybrid offspring of Gumei 4 and Wuyunjing 27; ALS The gene originates from the japonica rice varieties Jinjing 818 or Jinjing 616; the currently widely promoted glutinous rice variety A is Zhennuo 19 or Wankennuo 1.

4. The overcoming according to claim 2 Pigm A method for breeding japonica glutinous rice varieties resistant to rice blast and herbicides by selecting varieties with adverse effects, characterized in that: The rice blast resistance described in step (1) Pigm Gene detection employs molecular marker-assisted selection using specific primers, the sequences of which are shown in SEQ ID NO. 1 and SEQ ID NO.

2.

5. The overcoming according to claim 2 Pigm A method for breeding japonica glutinous rice varieties resistant to rice blast and herbicides by selecting varieties with adverse effects, characterized in that: The herbicide resistance described in steps (2) and (3) ALS Gene detection was performed using competitive allele-specific PCR primers for molecular marker-assisted selection. The primer pairs included three primers with primer sequences as shown in SEQ ID NO. 3, SEQ ID NO. 4, and SEQ ID NO.

5.

6. The overcoming according to claim 2 Pigm A method for breeding japonica glutinous rice varieties resistant to rice blast and herbicides by selecting varieties with adverse effects, characterized in that: In step (1), the specific method for cultivating intermediate materials of glutinous rice resistant to rice blast includes the following steps: ① Select glutinous rice variety A, which is currently widely promoted, as the recipient, and fertilize it with a gene containing resistance to rice blast. Pigm Material B was crossed to obtain F1, which is the F1-AB population; ② Plant the F1-AB population, with a planting scale of 24 plants, and utilize the seedling stage. Pigm Gene molecular markers were detected, and 1-2 target plants with the growth period and leaf morphology most similar to the recipient parent A were selected from the F1-AB population and backcrossed with the recipient parent to obtain the first generation backcross BC1F1 population. ③ Repeat step ② above. Based on the breeding objectives, use molecular marker-assisted selection to select the parent that is closest to the recurrent parent A and carries a heterozygous chromosome. Pigm The target single plant is backcrossed for n generations to obtain the BCnF1-AB population; ④ Plant the BCnF1-AB population, with a planting scale of 24 plants, and utilize the seedling stage. Pigm Gene molecular markers are used for detection to identify heterozygous individuals. Pigm The target plant was further crossbred with the herbicide-resistant intermediate material obtained in step (2), and the target plant was harvested to obtain the BCnF2-AB population. ⑤ Plant the BCnF2-AB population, expanding the planting scale to 48 plants, and utilize the seedling stage. Pigm Gene molecular markers are used for detection to select carriers of homozygous genes. Pigm The target individual plants of the gene are further self-pollinated and used for identification of disease resistance and agronomic traits.

7. The overcoming according to claim 2 Pigm A method for breeding japonica glutinous rice varieties resistant to rice blast and herbicides by selecting varieties with adverse effects, characterized in that: In step (2), the specific method for cultivating the herbicide-resistant intermediate material is as follows: ① Select glutinous rice variety A, which is currently widely promoted, as the recipient, and then synthesize it with a herbicide-resistant gene. ALS Furthermore, materials with a thousand-grain weight > 28.0 g were crossbred with material C to obtain F1, which is the F1-AC population; ② Plant F1-AC population, with a scale of 24 plants, and utilize during the seedling stage. ALS Genetic molecular markers were used for detection. Target plants were not hybridized for the time being. The thousand-seed weight of each plant was examined. Individuals with a thousand-seed weight ≥27.5 g were selected for planting the next generation, and the rest were discarded. ③ The F2-AC population / line obtained through planting and screening has a size of 24 plants. Marker pairings were continued during the seedling stage. ALS Genes were molecularly analyzed, and single plants with main agronomic traits similar to the recurrent parents were selected for backcrossing to obtain the BC1F1 population, denoted as BC1F1-AC. ④ Repeat steps ② and ③ above to obtain and cultivate the BCnF1 population, denoted as BCnF1-AC. During the seedling stage, molecular markers are used to... ALS Genetic testing was conducted in preparation for further crossbreeding, and target individual plants were harvested to obtain the BCnF2-AC population; ⑤ Plant the BCnF2-AC population, expanding the planting scale to 48 plants, and use molecular markers during the seedling stage. ALS Genetic testing to select carriers of homozygous genetics ALS The target individual plants of the gene were further self-pollinated and harvested for herbicide resistance and agronomic trait identification.

8. The overcoming according to claim 2 Pigm A method for breeding japonica glutinous rice varieties resistant to rice blast and herbicides by selecting varieties with adverse effects, characterized in that: In step (3), overcome Pigm Adverse effects; specific methods for breeding japonica glutinous rice varieties resistant to rice blast and herbicides are as follows: ① Using the intermediate materials obtained in steps (1) and (2) respectively, i.e. carrying hybrid materials Pigm Target individual plants containing herbicide resistance genes ALS Single plants were repeatedly crossed to obtain F1 seeds of the cross, denoted as CF1-A / B / C; ② Plant 24 CF1-A / B / C plants and test them. Pigm , ALS Genes were selected, and mature plants carrying double heterozygotes were mixed and harvested to obtain the CF2 population, denoted as CF2-A / B / C. ③ Plant CF2-A / B / C populations with a scale of over 1000 plants. During the seedling stage, use the above-mentioned markers to distinguish individual plants within the population. Pigm , ALS Genetic testing was conducted, and single plants that were homozygous for both genes and had agronomic traits similar to or superior to the recurrent parents were selected for seed collection. After seed collection, the thousand-seed weight of a single plant was examined, and single plants with a thousand-seed weight of less than 26.5 g were eliminated to obtain CF3 seeds, which are represented as CF3-A / B / C. ④ Plant CF3-A / B / C lines, with 48 plants per line, and obtain CF4 seeds using the method described in step ③ above, denoted as CF4-A / B / C; ⑤ Plant CF4-A / B / C lines and conduct blast resistance identification on each line during the heading stage; Harvest homozygous strains with excellent agronomic traits at maturity to ultimately obtain aggregates. Pigm Genes and ALS Genes, Overcoming Pigm A new japonica glutinous rice variety with adverse reactions, resistance to rice blast, resistance to herbicides, and a thousand-grain weight of not less than 26.5 g.

9. A new japonica glutinous rice line bred by the method described in any one of claims 1-8, characterized in that: The new strain contains homozygous rice blast resistance genes. Pigm and herbicide resistance genes ALS ,overcome Pigm Adverse reactions, resistance to rice blast, resistance to herbicides, and a thousand-grain weight of not less than 26.5g.

10. The new japonica glutinous rice variety according to claim 9, characterized in that: The new strain is Zhennuo 1279 or Zhennuo 1293.

Images