A molecular marker for identifying green bean resistance to bean weevil, a specific primer set and application thereof
By designing specific primer sets and electrophoresis detection, the problem of identifying and cultivating mung bean varieties resistant to bean weevil in existing technologies has been solved, achieving efficient and accurate resistance identification and breeding, reducing storage losses, and improving seed quality.
Patent Information
- Application Number
- CN202610244980.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-02
- Publication Date
- 2026-05-22
AI Technical Summary
Existing technologies make it difficult to efficiently identify and cultivate mung bean varieties resistant to bean weevils, leading to storage losses and a decline in seed quality.
Specific primer sets (SEQ ID NO.2 and SEQ ID NO.3) were developed for PCR amplification, combined with electrophoresis detection, to identify the resistance of mung beans to bean weevils, and individuals with three amplification bands were selected for breeding.
This method enables efficient and accurate identification and breeding of mung bean resistance to bean weevil, reduces storage losses, and improves seed quality.
Smart Images

Figure CN122071748A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant molecular marker technology, and in particular to a molecular marker, a specific primer set, and its application for identifying resistance of mung beans to bean weevil. Background Technology
[0002] Bean weevils are the most damaging pests in the production of mung beans and other edible beans. Bean weevils are a general term for the family Fabaceae (coleoptera), which includes approximately 1000 species distributed worldwide. Among mung beans, the main pest is the bean weevil (…). Callosobruchus chinensis ) and four-striped bean weevil ( Callosobruchus maculatus There are two types of bean weevils, both of which cause approximately 30% of the annual loss of stored mung beans, and also lead to a decline in mung bean quality and seed germination ability. With the frequent increase in global trade, bean weevils have become the number one pest of edible beans worldwide. Discovering bean weevil-resistant resources, isolating resistance genes from them, designing functional molecular markers for bean weevil-resistant breeding, and cultivating new resistant varieties are currently the most effective and cost-efficient methods for bean weevil control. Summary of the Invention
[0003] The purpose of this invention is to provide a molecular marker, a specific primer set, and its application for identifying mung bean resistance to bean weevils, in order to solve the problems existing in the prior art.
[0004] To achieve the above objectives, the present invention provides the following solution: One of the technical solutions of the present invention is a molecular marker for identifying the resistance of mung beans to bean weevils, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0005] The second technical solution of the present invention is the application of the molecular marker in identifying the resistance of mung beans to bean weevils.
[0006] The third technical solution of the present invention is a specific primer set for the molecular marker, comprising an upstream primer as shown in SEQ ID NO.2 and a downstream primer as shown in SEQ ID NO.3.
[0007] The fourth technical solution of the present invention is the application of the specific primer set in identifying the resistance of mung beans to bean weevils.
[0008] The fifth technical solution of the present invention is a kit for identifying the resistance of mung beans to bean weevils, the kit comprising the specific primer set.
[0009] The sixth technical solution of the present invention is the application of the reagent kit in identifying the resistance of mung beans to bean weevils.
[0010] The seventh technical solution of this invention is a method for identifying the resistance of mung beans to bean weevils, comprising the following steps: (1) Using the DNA of the mung bean sample to be identified as a template, PCR amplification was performed using the specific primer set; (2) Electrophoresis is performed on the PCR amplification products, and the resistance of the mung bean sample to be identified to be bean weevil is determined by the electrophoresis results.
[0011] The eighth technical solution of the present invention is the application of the molecular marker, the specific primer set, or the kit in the cultivation of mung bean varieties with high resistance to bean weevils.
[0012] The ninth technical solution of this invention is a method for cultivating mung bean varieties with high resistance to bean weevils. The method involves using the DNA of individual mung beans as a template, performing PCR amplification using the specific primer set, detecting the PCR amplification products by electrophoresis, and selecting individuals that can obtain three amplification bands for breeding.
[0013] Based on the above technical solution, the present invention has the following technical effects: This invention is the first cloned and verified. VrRD22 Genes are the core source of resistance in mung bean resources resistant to bean weevils, and a functional molecular marker and detection system has been developed based on this. The marker development strategy of this invention (designing repetitive sequence primers based on functional gene structural variations) can provide a paradigm for the discovery and marker development of similar stress resistance genes, and has strong industrial practical value. Attached Figure Description
[0014] Figure 1 For the gene against bean weevil VrAD22 The process of precise positioning.
[0015] Figure 2 for VrAD22 Application of identification primers (i.e., SEQ ID NO.2 and SEQ ID NO.3) in segregating populations.
[0016] Figure 3 for Figure 2 Phenotypic identification of all identified materials (two parents and 20 segregating progeny) against soybean weevil. Detailed Implementation
[0017] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or raw materials used are all purchased from commercial channels or are publicly available unless otherwise specified.
[0018] This invention provides a molecular marker for identifying resistance of mung beans to bean weevils, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0019] This invention also provides the application of the molecular marker in identifying the resistance of mung beans to bean weevils.
[0020] This invention also provides a specific primer set for the molecular marker, including an upstream primer as shown in SEQ ID NO.2 and a downstream primer as shown in SEQ ID NO.3.
[0021] This invention also provides the application of the specific primer set in identifying the resistance of mung beans to bean weevils.
[0022] This invention also provides a kit for identifying the resistance of mung beans to bean weevils, the kit comprising the specific primer set.
[0023] This invention also provides the application of the kit in identifying the resistance of mung beans to bean weevils.
[0024] This invention also provides a method for identifying the resistance of mung beans to bean weevils, comprising the following steps: (1) Using the DNA of the mung bean sample to be identified as a template, PCR amplification was performed using the specific primer set; (2) Electrophoresis is performed on the PCR amplification products, and the resistance of the mung bean sample to be identified to be bean weevil is determined by the electrophoresis results.
[0025] In some specific implementation schemes, the method for determining the resistance of the mung bean sample to the bean weevil through electrophoresis detection results is as follows: individuals that can obtain three amplification bands have higher resistance to the bean weevil than individuals without amplification bands.
[0026] This invention also provides the application of the molecular marker, the specific primer set, or the kit in cultivating mung bean varieties with high resistance to bean weevils.
[0027] This invention also provides a method for breeding mung bean strains with high resistance to bean weevils. The method involves using the DNA of individual mung bean as a template, performing PCR amplification using the specific primer set, detecting the PCR amplification products by electrophoresis, and selecting individuals that can obtain three amplification bands for breeding.
[0028] Example 1 This invention screened a highly resistant bean weevil material, v2206 (from India, provided by the Asian Vegetable Centre). V2206 was crossed with the bean weevil-sensitive variety, Sulv 1, to obtain the F2 population. The F2 population was harvested based on individual plants. 2:3 Seeds, each individual plant F 2:3 Take 150 seeds, divide them into three equal parts, and place them in a plastic box. Place 12 adult bean weevils (6 males and 6 females) in the box. After three days, observe the surface of the seeds to ensure that there are eggs attached to the surface of each seed. Remove the adult weevils and place the plastic box in a 25-degree Celsius incubator with a photoperiod of 12 / 12 h and a humidity of 30%. After 40 days, remove the plastic box and count the bean weevil hatching rate (number of weevil holes / number of eggs).
[0029] Using phenotypic data (bean weevil hatching rate) and polymorphic molecular markers, the previously identified bean weevil resistance sites were analyzed. Br Fine-tuning was performed to pinpoint the Br site to a range of approximately 500 kb. Analysis of public transcriptome data revealed that a class of RD22 genes exhibited extremely high expression levels within this range in mung bean seeds. However, the full-length expression of this gene could not be amplified in the insect-resistant parent V2206 or other bean weevil-resistant materials. Therefore, this invention hypothesizes that this gene has undergone significant structural variation in insect-resistant materials.
[0030] Therefore, this invention performed third-generation full-length transcriptome sequencing (ISO-seq) on developing seeds of the bean weevil-resistant material V2206. Using the sequencing results as a reference, highly expressed genes within the localized regions were compared. The results showed that a large number of highly expressed RD22 genes were detected in the seeds of these bean weevil-resistant materials. However, these genes showed approximately 90% similarity to the RD22 gene of Sulv 1, with extremely high similarity at the C-terminus but low similarity at the N-terminus, leading to amplification problems in the bean weevil-resistant materials. This invention amplified the full-length sequence obtained from the insect-resistant materials and performed Sanger sequencing to obtain the complete CDS sequence of this gene, named... VrRD22 (SEQ ID NO.1).
[0031] SEQ ID NO.1: ATGGAGTTTCAGTGCCTTGCATTGTTTTTTTCTCTCATTGTGATACTGATGGCTGCTCAGGCTTCCTTACCTTCAGAAGTTTACTGGGAAAGGAAGCTTCCAAACACACCATCCCCAAAGTAATCAGACAATTTTC CAAGCAAGATGGTGGCAAAGACATTGCATCAAAAGATGAGTTCCTTCTTTTTGGGTCTGGTGATAAGAAAAATAAAGACAAGCTCCTTCGTTTGGGTGTGGTGATAAGGAAAATAAATTGCAAGATGACGTTCAAGACATTT CACC CGAAGACGAGAATC TTCTTTTAATTTATGATAGATATGCCAAAAATAAATTGCAAGATGATCTCCAAGACATTTCACCCGAAGACGAGAATTTTCTTTATTTTATGATAGATATGCCAAAAATAAATTGCAAGATGATGTCCAAGACATTT CACCCGAAGACGAGAATCTTCTTTTATTTTATGATAGATATGCCAAAAATAAATTGCAAGATAATGTCCAAGACATTT CACCCGAAGACGAGAATC TTCTTGATTATGAGAAAAGTAAATTGCAAGATGATGTCCAAGACATTTCACCAGAAGACGAGAATCTTAGTGGTTATAAGAAAAATGGTGTTGTTCTTCGAGGGATAGGCCCAATTGCTAATCATCATCATCATGATCACTTAAAACCAAGTAGTTATTTTTCAGAAGAAGGATTGAGGCGCGGTGCAAAATTGGTTATGCTGTTCCATAAAAGAAAATTTTCAACCCCGTTGTTGACCCGTGAAATTGCAGAACACTTACCATTCTCATCAGAAAAGATAAATGAAATCTTAGAGATTTTGGCTGTGAAGCCAGATTCTAAGAATGCTAAGAATGTGGAGAAAACTCTGAATAACTGTGAAGAGCCTGCATTGAAGGGTGAAGAAAAACACTGTGCAACTTCAGTAGAATCCATGGTAGACTTTGTCACTTCTAAACTTGGCAATAACGCCCGTGTTACTTCTACAGAGCTAGAAATTGAAAGCAAGTTCCAAAAGTTCATAGTTAAAGATGGAGTGAAGATTTTAGCAGAAGAAGAGATAATTGCATGTCACCCAATGAGTTACCCATATGTTGTGTTTTACTGCCATAAGATGTCAAATAGCACTGCACATGTTGTACCATTGGAGGGAGAAGATGGAACTAGGGTTAAAGCTATAGTAATCTGCCACAAAGACACATCACAATGGGATCCAGACCATGTTGCATTCCAAGTTCTCAAAGTGAAGCCTGGGACCAGTCCTGTGTGTCATTTCTTCCCTAACGGTCATCTTCTTTGGTATGCTAAATAG。
[0032] Note: The underlined part indicates the position of the forward primer of the detection primer (SEQ ID NO.2).
[0033] BLAST alignment of the protein sequence encoded by this gene revealed that it belongs to a novel type of cyclic peptide protein in plants. This protein can form the cyclic peptide alkaloid Vginatic Acid A through self-cleavage and cyclization. This substance is toxic to bean weevil eggs, therefore it is inferred that these... VrRD22 This is the source of resistance in mung bean resources resistant to bean weevils.
[0034] according to VrRD22 Due to the sequence specificity of the gene, this invention designs specific amplification primers (SEQ ID NO.2 and SEQ ID NO.3).
[0035] F (SEQ ID NO.2): CACCCGAAGACGAGAATC; R (SEQ ID NO. 3):TTTCACGGGTCAACAACG.
[0036] because VrRD22 The gene's unique repetitive sequence characteristics, in which the preprime (SEQ ID NO.2) is present. VrRD22 The gene (SEQ ID NO.1) has three corresponding locations; therefore, amplification using the primers of this invention in insect-resistant materials can produce three bands of different sizes. Furthermore, these primers can be used with mung bean genomic DNA or cDNA as templates for conventional PCR amplification, both of which can distinguish whether the tested material is resistant to the bean weevil. Figure 2 ).
[0037] The primers are compatible with commonly available DNA amplification enzymes, and can be used to detect anti-bean weevil materials by following the corresponding reaction systems and procedures for each amplification enzyme.
[0038] Example 2 A segregating F2 population was obtained by crossing the bean weevil-resistant parent V2802 with the susceptible parent "Benyangzi". DNA was extracted from individual plants within this population and amplified using the detection primers of this invention (SEQ ID NO.2 and SEQ ID NO.3). Initially, three amplified bands were observed in the DNA of V2802, while no bands were produced in the susceptible parent. In the progeny, 19 individuals with amplified bands and 1 individual without amplified band were selected. Seeds (20 seeds) from these 20 individual plants were then subjected to an insect resistance test in a constant temperature incubator. After weighing, the seeds from each individual plant were placed in a plastic box (7×5×5 cm). 3Five pairs of bean weevils (5 males + 5 females) were placed in each box. Ten days after infestation, the seeds were inspected to ensure that each seed contained at least one egg. At this point, the plastic boxes were placed in a dark environment with a constant temperature of 25 degrees Celsius and humidity of 30%, while maintaining ventilation. Forty days later, the damage rate of the seeds in the plastic boxes was investigated, including the number of insect holes, the number of bean weevils in the box, and the seed weight loss ratio.
[0039] The results showed that the offspring seeds of the 19 individual plants that produced PCR bands all had fewer than 10 insect holes and fewer than 10 adult bean weevils in the test chamber, with a seed damage rate of less than 20%, indicating they were highly resistant to bean weevils. In contrast, the individual plants that did not produce PCR bands had 38 insect holes and a 100% seed damage rate, demonstrating non-resistance to bean weevils. Therefore, this invention can accurately identify highly resistant bean weevils (resources, segregated offspring, etc.) through gene detection, providing a highly efficient and accurate molecular auxiliary tool for breeding mung beans resistant to bean weevils.
[0040] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.
Claims
1. A molecular marker for identifying resistance of mung beans to bean weevils, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.
1.
2. The application of the molecular marker as described in claim 1 in identifying the resistance of mung beans to bean weevil.
3. A specific primer set for the molecular marker according to claim 1, characterized in that, This includes the upstream primer shown in SEQ ID NO.2 and the downstream primer shown in SEQ ID NO.
3.
4. The application of the specific primer set as described in claim 3 in identifying the resistance of mung beans to bean weevil.
5. A kit for identifying resistance of mung beans to bean weevils, characterized in that, The kit includes the specific primer set as described in claim 3.
6. The application of the kit as described in claim 5 in identifying the resistance of mung beans to bean weevil.
7. A method for identifying the resistance of mung beans to bean weevils, characterized in that, Includes the following steps: (1) Using the DNA of the mung bean sample to be identified as a template, PCR amplification was performed using the specific primer set described in claim 3; (2) Electrophoresis is performed on the PCR amplification products, and the resistance of the mung bean sample to be identified to be bean weevil is determined by the electrophoresis results.
8. The method according to claim 7, characterized in that, The method for determining the resistance of the mung bean sample to the bean weevil through electrophoresis detection results is as follows: individuals that can obtain three amplification bands are more resistant to the bean weevil than individuals that do not have amplification bands.
9. The application of the molecular marker as described in claim 1, the specific primer set as described in claim 3, or the kit as described in claim 5 in the cultivation of mung bean varieties with high resistance to bean weevils.
10. A method for cultivating mung bean varieties with high resistance to bean weevils, characterized in that, Using the DNA of individual mung beans as a template, PCR amplification was performed using the specific primer set described in claim 3. The PCR amplification products were detected by electrophoresis, and individuals that could obtain three amplification bands were selected for breeding.