A dsrna that inhibits lpa gene expression and uses thereof

CN122095091APending Publication Date: 2026-05-26RUNJIA (SHANGHAI) PHARM TECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
RUNJIA (SHANGHAI) PHARM TECH CO LTD
Filing Date
2024-08-30
Publication Date
2026-05-26

AI Technical Summary

Technical Problem

The prior art is difficult to effectively inhibit the expression of apolipoprotein (a) (LPA) gene, resulting in a high incidence of cardiovascular events and a lack of long-term effective control methods.

Method used

A double-stranded ribonucleic acid (dsRNA) is developed as an RNA interference (RNAi) agent targeting the LPA gene, which triggers RNA-induced silencing complex-mediated cleavage of LPA RNA transcripts through a dsRNAi agent containing both sense strands and antisense strands, thereby inhibiting LPA gene expression.

Benefits of technology

Significant inhibition of the LPA gene is achieved, and the efficacy, specificity, stability, targeting and tolerability are improved, providing drugs for the prevention or treatment of diseases related to LPA expression.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000070_0000
    Figure 00000070_0000
  • Figure 00000070_0001
    Figure 00000070_0001
  • Figure 00000070_0002
    Figure 00000070_0002
Patent Text Reader

Abstract

Nucleic acid compositions that interfere with or inhibit the expression of the LPA gene, and methods for using such nucleic acid compositions to interfere with or inhibit the expression of the LPA gene.
Need to check novelty before this filing date? Find Prior Art

Description

A dsRNA for inhibiting LPA gene expression and its use

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] The present disclosure is based on Chinese patent application number 202311337910.4, filed on October 16, 2023, and entitled “A dsRNA for inhibiting LPA gene expression and its use”, and claims the priority of the Chinese patent application. The entire content of the Chinese patent application is hereby incorporated into the present disclosure by reference. Technical Field

[0003] The present disclosure belongs to the field of biomedicine, and specifically relates to a double-stranded RNA for inhibiting apolipoprotein (a) ("LPA") expression and its use, especially for preventing or treating diseases and / or conditions related to LPA expression. Background Art

[0004] Lipoprotein(a) (Lp(a)) is a heterogeneous low-density lipoprotein-like particle containing a lipid core and apolipoprotein B (ApoB-100) to which apolipoprotein a (Apo(a)) is attached via disulfide bonds.

[0005] RNA interference (RNAi) technology was first discovered by Fire et al. in 1998 and quickly gained widespread application. The double-stranded RNA that causes gene silencing in RNAi is small interfering RNA (siRNA), typically composed of a 19-23-nucleotide double-stranded RNA (dsRNA) sequence that includes both sense and antisense strands that pair with target mRNAs, thereby inducing host cells to degrade these mRNAs. While siRNA can specifically inhibit gene expression, it is easily degraded within cells, making stable gene silencing difficult.

[0006] Previous clinical studies have demonstrated that elevated Lp(a) levels are closely associated with an increased incidence of cardiovascular events. Unlike other lipoproteins, Lp(a) levels are primarily determined by genetics and are less influenced by lifestyle factors. Clinically, Lp(a) control methods are very limited, and to date, there is still no effective long-term approach to controlling Lp(a) levels. There is a need for agents that can inhibit Lp(a) expression and treat diseases associated with Lp(a) expression.

[0007] Therefore, there is still a need to develop other RNAi drugs with better efficacy, specificity, stability, targeting or tolerability.

[0008] Summary of the Invention

[0009] The present disclosure provides an inhibitor for inhibiting high expression of LPA, such as an RNAi agent or RNA, and a pharmaceutical composition thereof, and use thereof in preparing a medicament for preventing, treating, and / or inhibiting related diseases.

[0010] The RNAi agents and RNA disclosed herein are designed to target the LPA gene, including portions of the gene that are conserved in orthologs of other mammalian species. RNAi agents typically comprise a sense strand and an antisense strand that form a duplex, double-stranded RNA (referred to herein as "dsRNA"). RNAi agents comprising dsRNA are also referred to herein as "dsRNAi" agents.

[0011] Without intending to be limited by theory, the RNAi agents and RNAs disclosed herein, as well as specific target sites and / or modifications therein, impart improved efficacy, stability, potency, durability, and / or safety. For example, but not limited to, in some embodiments, the RNAi agents and / or RNAs disclosed herein exhibit: (1) improved efficacy and / or potency, for example, by stronger hybridization with target gene mRNA (e.g., as determined by an increase in the Tm of the antisense strand / target mRNA duplex, such as an increase in the theoretical Tm of the antisense strand); and / or, (2) improved safety, for example, by reducing off-target effects, for example, by reducing or attenuating hybridization with off-target RNAs (e.g., as determined by a decrease in the Tm of the duplex formed by the antisense strand and the off-target RNA).

[0012] The use of RNAi agents disclosed herein enables targeted degradation of mRNA of LPA target genes in mammals. The inventors have demonstrated that the RNAi agents disclosed herein can trigger RNA-induced silencing complex (RISC)-mediated cleavage of LPA RNA transcripts, thereby causing significant inhibition of LPA target gene expression. In certain embodiments, the RNAi agents disclosed herein are more effective (e.g., more potent) and / or more specific (e.g., safer, with fewer off-target effects) than previous RNAi agents targeting the same gene. In certain embodiments, the RNAi agents are selected to target specific sites in LPA mRNA and / or include RNA modifications (e.g., non-canonical base-pairing nucleotides, modified nucleotides, chemical modifications) to increase efficacy, potency, specificity, and / or safety. In some such embodiments, the RNAi agent comprises at least one modified nucleotide, such as a non-canonical base-pairing nucleotide. Methods and compositions comprising these RNAi agents can be used to treat subjects suffering from LPA-related diseases or conditions, such as metabolic conditions. Thus, the present disclosure provides methods for treating, preventing, or inhibiting metabolic disorders in a subject who would benefit from inhibiting or reducing LPA expression using the RNAi agents and compositions of the present disclosure.

[0013] The present disclosure provides a double-stranded ribonucleic acid interference (dsRNAi) agent for inhibiting high expression of LPA, wherein the dsRNAi agent comprises a sense strand and an antisense strand forming a double-stranded RNA (dsRNA) region, wherein the antisense strand comprises a complementary region to the LPA mRNA target sequence, wherein the complementary region comprises at least 15 consecutive nucleotides, and in some embodiments, the dsRNA agent comprises at least one non-canonical base-pairing nucleotide, as further described below.

[0014] In some embodiments, the dsRNAi agent comprises one, two, three, four, five or more non-canonical base pairing nucleotides. Non-canonical base pairing nucleotides and other modified nucleotides can be present in any other position in the complementary region, dsRNA region or dsRNAi agent. Non-canonical base pairing nucleotides and other modified nucleotides can be included in the antisense strand, sense strand or both. In some embodiments, in addition to non-canonical base pairing nucleotides, the dsRNAi agent also comprises at least one other modified nucleotide; Such other modified nucleotides may or may not be on the same oligonucleotide chain as the non-canonical base pairing nucleotides.

[0015] In some embodiments, the dsRNAi agent or RNA has increased efficacy, potency, specificity, and / or safety, and / or reduced off-target effects compared to a dsRNAi agent or RNA having the same nucleotide sequence but without non-canonical base pairing and / or modified nucleotides. In some such embodiments, the melting temperature (Tm) of the dsRNAi agent or RNA is altered by at least 2°C compared to a dsRNAi agent or RNA having the same nucleotide sequence but without non-canonical base pairing and / or modified nucleotides.

[0016] In some embodiments, the dsRNAi agents or RNAs of the present disclosure comprise non-canonical base-pairing nucleotides and / or modified nucleotides that alter the Tm by at least 2° C., e.g., 2° C., 3° ​​C., 4° C., 5° C., or more. In some such embodiments, the Tm is calculated using the formulas or algorithms described herein.

[0017] In some embodiments, the dsRNAi agents or RNAs of the present disclosure comprise at least one non-canonical base-pairing nucleotide and / or modified nucleotide in positions 1-11 of the oligonucleotide strand (eg, antisense strand) in the direction from the 5' end to the 3' end.

[0018] In some embodiments, the dsRNAi agent or RNA of the present invention comprises at least one non-canonical base pairing nucleotide and / or modified nucleotide in the 12th-21st position of the oligonucleotide chain (e.g., antisense chain) from the 5' end to the 3' end. In some embodiments, in the sequence fragment N1N2G0N3N4, N1, N2, N3 and N4 are each independently a nucleotide comprising adenine (A), cytosine (C), guanine (G) or uracil (U) as a base, G0 is a nucleotide comprising guanine as a base, and when at least three bases in N1, N2, N3 and N4 are adenine or uracil, the guanine of G0 in the sequence is replaced by hypoxanthine (I). In some such embodiments, at least one of N1, N2, N3, N4 and G0 also has a modified sugar group and / or a modified internucleotide linkage.

[0019] In some embodiments, the dsRNAi agent or RNA of the present disclosure comprises at least one non-canonical base pairing nucleotide and / or modified nucleotide in position 6, 7, or 8 in the direction from the 5' end to the 3' end of the oligonucleotide chain, and if at least four nucleotides in positions 2-8 are A or U and at least one nucleotide in positions 6-8 is G, then the G in positions 6, 7, and / or 8 is replaced by a non-canonical base pairing nucleotide.

[0020] In some such embodiments, the dsRNAi agent or RNA of the present disclosure comprises at least 15 consecutive nucleotides that differ by no more than 3 nucleotides from any of the sequences shown in Table 1 or Table 2. In some such embodiments, the antisense strand comprises at least 15 consecutive nucleotides that differ by no more than 3 nucleotides from any of the sequences shown in Table 1 or Table 2, and the sense strand comprises at least 15 nucleotides that are complementary to the antisense strand. In some such embodiments, the sense strand comprises at least 15 consecutive nucleotides that differ by no more than 3 nucleotides from any of the sequences shown in Table 1 or Table 2, and the antisense strand comprises at least 15 nucleotides that are complementary to the sense strand. In some such embodiments, the antisense strand and / or the sense strand differ by no more than 1, 2, or 3 nucleotides from any of the sequences shown in Table 1 or Table 2. In some embodiments, the dsRNAi agent comprises a dsRNA comprising any of the duplex sequences in Table 1 or Table 2. As used herein, "difference" is understood to include differences in nucleotide sequence length, differences in nucleotides, and a combination of both.

[0021] Exemplary bases in non-canonical base pairing nucleotides include, but are not limited to, bases selected from inosine (I), xanthosine (X), 7-methylguanosine (m7G), N6-methyladenosine (m6A), dihydrouridine, 5-methylcytosine (m5C), pseudouridine (Ψ) and N1-methylpseudouridine (m1Ψ).

[0022] In another aspect, the present disclosure provides a double-stranded ribonucleic acid (dsRNA) comprising a sense strand and an antisense strand, wherein the antisense strand comprises at least 15 consecutive nucleotides that differ from any of the sequences shown in Table 1 or Table 2 by 0, 1, 2, or 3 nucleotides, and the sense strand and the antisense strand have at least 15, 16, 17, 18, 19, 20, or 21 nucleotides complementary to each other. Optionally, at least one nucleotide in the sense strand and the antisense strand is a modified nucleotide.

[0023] In some embodiments, the antisense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ from any of the sequences shown in Table 1 or Table 2 by 0, 1, 2, or 3 nucleotides.

[0024] In some embodiments, the sense strand sequence is at least substantially complementary to the antisense strand sequence. In some preferred embodiments, the sense strand sequence is fully complementary to the antisense strand sequence (ie, 100% complementary).

[0025] In some embodiments, the length of the sense strand and the antisense strand are each independently 17-25 nucleotides; preferably, the length of the sense strand and the antisense strand are each independently 19-23 nucleotides; more preferably, the length of the sense strand and the antisense strand are each independently 19-21 nucleotides.

[0026] In some embodiments, the antisense strand described herein is 17 to 25 nucleotides in length.

[0027] In some embodiments, the antisense strand described herein is 19 to 23 nucleotides in length.

[0028] In some embodiments, the antisense strand described in the present disclosure is 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length.

[0029] In some embodiments, the antisense strand is 19, 20, or 21 nucleotides in length, and wherein the antisense strand and the sense strand form a duplex region that is at least 19 nucleotides in length.

[0030] In some embodiments, the double-stranded RNA described in the present disclosure has a duplex region with a length of 19 base pairs.

[0031] In some embodiments, at least one strand of the dsRNA comprises a 3' overhang of at least 1 or 2 nucleotides; preferably, the antisense strand of the dsRNA comprises a 3' overhang of 1 or 2 nucleotides; more preferably, the antisense strand of the dsRNA comprises a 3' overhang of 2 nucleotides.

[0032] In some embodiments, the modifications disclosed herein include 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy nucleotides, 2'-methoxyethyl modified nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, 2'-alkoxy modified nucleotides, 2'-F-arabino nucleotides, 5'-vinyl phosphite modified nucleotides, phosphorothioate modified nucleotides, abasic nucleotides, morpholino nucleotides, locked nucleotides, inverted (or reverse) nucleotide modifications, and non-canonical base pairing modifications.

[0033] In some embodiments, the modified nucleotides disclosed herein are selected from the group consisting of 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy nucleotides, and phosphorothioate modified nucleotides.

[0034] In some embodiments, the modified nucleotides disclosed herein include one or more of the following:

[0035] (1) The antisense strand contains at least five 2'-fluoro modified nucleotides or five 2'-deoxy modified nucleotides, and the remaining sites are 2'-O-methyl modified nucleotides;

[0036] (2) In the antisense strand, positions 2, 5, 7, and 12 are 2'-deoxy modified nucleotides, position 14 is a 2'-fluoro modified nucleotide, positions 9 and 16 contain 0, 1, and 2 2'-fluoro modified nucleotides, respectively, and the remaining positions are all 2'-O-methyl modified nucleotides;

[0037] (3) the first position of the antisense strand is a 5′-vinylphosphite-modified nucleotide;

[0038] (4) the sense strand contains three or more 2′-fluoro-modified nucleotides at positions 7, 8, 9, and 10;

[0039] (5) In the direction from the 5' end to the 3' end, at least one or two of the three nucleotides from the 5' end of the sense strand are phosphorothioate modified nucleotides; and / or at least one or two of the three nucleotides from the 5' end and the 3' end of the antisense strand are phosphorothioate modified nucleotides respectively; and / or

[0040] (6) In the direction from the 5' end to the 3' end, at least one G in positions 2-8 of the antisense strand is replaced by I (inosine-3'-phosphate).

[0041] In some embodiments, the inverted (or reverse) nucleotide modifications disclosed herein include reversed nucleotides, reversed abasic moieties, or amino-terminally modified nucleotides, such as 3',3'-linked or 5',5'-linked deoxy abasic moieties.

[0042] In some embodiments, the antisense strand of the present disclosure comprises any one of the antisense strand nucleotide sequences shown in Table 2, and the sense strand comprises any one of the sense strand nucleotide sequences shown in Table 2.

[0043] In some embodiments, the sense strand of the present disclosure is derived from the mRNA sequence of human LPA (e.g., Gene ID: 4018). Alternatively, the sense strand of the present disclosure is a fragment of the mRNA sequence of human LPA. In some embodiments, the sense strand of the present disclosure is derived from the mRNA sequence of cynomolgus monkey LPA (e.g., Gene ID: 101865897). Alternatively, the sense strand of the present disclosure is a fragment of the mRNA sequence of cynomolgus monkey LPA.

[0044] In some embodiments, at least one nucleotide in the sense strand and / or the antisense strand is a modified nucleotide. In some such embodiments, the modified nucleotide is a non-canonical base pairing nucleotide.

[0045] In some embodiments, substantially all nucleotides in the sense strand and / or the antisense strand are modified nucleotides. In some such embodiments, at least one of the modified nucleotides is a non-canonical base pairing nucleotide.

[0046] In some embodiments, all nucleotides in the sense strand and / or the antisense strand are modified nucleotides. In some such embodiments, at least one of the modified nucleotides is a non-canonical base pairing nucleotide.

[0047] In some embodiments, the sense strand and antisense strand described herein comprise a sense strand and antisense strand selected from the group consisting of:

[0048] The sense strand comprises a nucleotide sequence selected from SEQ ID NO 330, 332, 334, 336, 338, 340, 342, 344, 346, 348, 350, 352 or 354, and the antisense strand comprises a nucleotide sequence selected from SEQ ID NO 329, 331, 333, 335, 337, 339, 341, 343, 345, 347, 349, 351 or 353; or

[0049] The sense strand comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 414, 416, 418, 420, 422, 424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452, 454, 456, 458, 460, 462, 464, 466, or 468, and the antisense strand comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 413, 415, 417, 419, 421, 423, 425, 427, 429, 431, 433, 435, 437, 439, 441, 443, 445, 447, 449, 451, 453, 457, 459, 461, 463, or 465; or

[0050] The sense strand comprises a nucleotide sequence selected from SEQ ID NO 1082, 1084, 1086, 1088, 1090, 1092, 1094, 1096, 1098, 1100, 1102, 1104, 1106, 1108, 1110 or 1112, and the antisense strand comprises a nucleotide sequence selected from SEQ ID NO 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109 or 1111; or

[0051] The sense strand comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1666, 1670, 1674, 1676, 1678, 1680, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1706, 1708, 1710, 1712, 1714, 1716, 1718, 1720, 1722, 1724, 1726, 1728, 1730, 1732, 1734, 1736, 1738, or 1740, and the antisense strand comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: The nucleotide sequence shown in 1665, 1669, 1673, 1675, 1677, 1679, 1681, 1683, 1685, 1687, 1689, 1691, 1693, 1695, 1697, 1699, 1701, 1703, 1705, 1707, 1709, 1711, 1713, 1715, 1717, 1719, 1721, 1723, 1725, 1727, 1729, 1731, 1733, 1735, 1737 or 1739.

[0052] In some embodiments, the antisense strand and the sense strand are SEQ ID NOs: 11 and 12, respectively, and modified sequences thereof; SEQ ID NOs: 75 and 76, respectively, and modified sequences thereof; SEQ ID NOs: 173 and 174, respectively, and modified sequences thereof; SEQ ID NOs: 281 and 282, respectively, and modified sequences thereof; SEQ ID NOs: 329 and 330, respectively, and modified sequences thereof; SEQ ID NOs: 353 and 354, respectively, and modified sequences thereof; SEQ ID NOs: 397 and 398, respectively, and modified sequences thereof; SEQ ID NOs: 401 and 402, respectively, and modified sequences thereof; SEQ ID NOs: 413 and 414, respectively, and modified sequences thereof; SEQ ID NOs: 415 and 416, respectively, and modified sequences thereof; SEQ ID NOs: 417 and 418, respectively, and modified sequences thereof; SEQ ID NOs: 419 and 420, respectively, and modified sequences thereof; SEQ ID NOs: 421 and 422, respectively, and modified sequences thereof; SEQ ID NOs: 423 and 424, respectively, and modified sequences thereof; SEQ ID NOs: 424 and 425, respectively, and modified sequences thereof; SEQ ID NOs: 425 and 426, and their modified sequences; SEQ ID NOs: 427 and 429, and their modified sequences; SEQ ID NOs: 429 and 430, and their modified sequences; SEQ ID NOs: 443 and 444, and their modified sequences; SEQ ID NOs: 451 and 452, and their modified sequences; SEQ ID NOs: 455 and 456, and their modified sequences; SEQ ID NOs: 461 and 462, and their modified sequences; SEQ ID NOs: 467 and 468, and their modified sequences.

[0053] More preferably, the sense strand and the antisense strand are selected from the sense strand and the antisense strand in SEQ ID NO: 1081 to SEQ ID NO: 1112.

[0054] In some embodiments, the sense strand and the antisense strand are selected from the sense strand and the antisense strand of SEQ ID NO: 1611 to SEQ ID NO: 1656; in particular, the sense strand comprises a nucleotide sequence selected from 1612, 1614, 1616, 1618, 1620, 1622, 1624, 1626, 1628, 1630, 1632, 1634, 1636, 1638, 1640, 1642, 1644, 1646, 1648, 1650, 1652, 1654 or 1656, and the antisense strand comprises a nucleotide sequence selected from SEQ ID NO: 1611 to SEQ ID NO: 1656. The nucleotide sequence shown in 1611, 1613, 1615, 1617, 1619, 1621, 1623, 1625, 1627, 1629, 1631, 1633, 1635, 1637, 1639, 1641, 1643, 1645, 1647, 1649, 1651, 1653 or 1655.

[0055] In some embodiments, the dsRNAi agent comprises the sense and antisense strands of any duplex selected from LPA-001 to LPA-880.

[0056] In some embodiments, the antisense oligonucleotides of the present disclosure are substantially complementary to the target mRNA (e.g., LPA mRNA) and comprise a contiguous nucleotide sequence that is at least about 85% complementary to any one of the sense strand oligonucleotides or portions of the sense strand oligonucleotides provided herein, based on the entire length, e.g., about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or about 99% complementary.

[0057] In some embodiments, the antisense oligonucleotides of the present disclosure are substantially complementary to any of the sense strand oligonucleotides provided herein and comprise a contiguous nucleotide sequence that is at least about 85% complementary, e.g., about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or about 99% complementary, to any of the sense strand oligonucleotides or portions of the sense strand oligonucleotides provided herein, based on the entire length.

[0058] In some embodiments, the dsRNAi agents of the present disclosure comprise a sense strand that is substantially complementary to an antisense oligonucleotide that is complementary to a target mRNA, e.g., LPA mRNA, wherein the sense strand is at least about 85% complementary, e.g., about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or about 99% complementary to any one of the antisense oligonucleotides or portions of the antisense oligonucleotides based on their entire length.

[0059] In some embodiments, the double-stranded region of the dsRNAi agent is equal to or at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotide pairs in length.

[0060] In some embodiments, the antisense strand of the dsRNAi agent is equal to or at least 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more nucleotides in length.

[0061] In some embodiments, the sense strand of the dsRNAi agent is equal to or at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more nucleotides in length.

[0062] In some embodiments, the sense and antisense strands of the dsRNAi agent are independently 15 to 30 nucleotides in length.

[0063] In some embodiments, the sense and antisense strands of the dsRNAi agent are independently 19 to 25 nucleotides in length.

[0064] In some embodiments, the sense and antisense strands of the dsRNAi agent are independently 21 to 23 nucleotides in length.

[0065] In some embodiments, the sense strand of the dsRNAi agent is 21 nucleotides in length and the antisense strand is 23 nucleotides in length, wherein the sense and antisense strands form a double-stranded region of 21 consecutive base pairs with a 2 nucleotide-long single-stranded overhang at the 3'-end.

[0066] Among them, C, G, U, and A represent cytidine-3'-phosphate, guanosine-3'-phosphate, uridine-3'-phosphate, and adenosine-3'-phosphate, respectively; m indicates that the nucleotide adjacent to the right of the letter m is a 2'-O-methyl-modified nucleotide; f indicates that the nucleotide adjacent to the left of the letter f is a 2'-fluorine-modified nucleotide; * indicates that the phosphodiester bond between the two bases to the left and right of * is a thiophosphate; d indicates that the nucleotide adjacent to the right of the letter d is a 2'-deoxyribonucleotide; I indicates that the base at this position is replaced by hypoxanthine (inosine or inosinic acid base); ir indicates an inverted (reverse) nucleotide modification; VP indicates that the nucleotide adjacent to the right of VP is 5'-vinyl phosphate modified.

[0067] In another aspect, the present disclosure provides a dsRNAi agent comprising any of the aforementioned dsRNAs and optionally comprising a targeting ligand. The targeting ligand is generally conjugated to the dsRNA and serves to target the dsRNAi agent to cells.

[0068] In yet another aspect, the present disclosure provides a dsRNA conjugate (dsRNAi agent), wherein the dsRNA conjugate is formed by conjugating the dsRNA of the present disclosure with a ligand group, wherein the ligand group is attached to the 3' end of the sense strand of the dsRNA. In some embodiments, the ligand group is formed by conjugating a divalent group formed by a bivalent compound, an isomer thereof, or a pharmaceutically acceptable salt thereof, and a group containing N-acetyl-galactosamine (GalNAc).

[0069] In some embodiments, the ligand groups of the present disclosure include targeting ligands that specifically target asialoglycoprotein receptors (ASGPR) on the surface of hepatocytes.

[0070] Preferably, the targeting ligand comprises N-acetyl-galactosamine (GalNAc), or, the targeting ligand is a GalNAc derivative.

[0071] In some embodiments, examples of the bivalent compound are as described in WO 2022 / 266753, which is hereby incorporated by reference in its entirety unless otherwise expressly stated. Bivalent compound 5 described in WO 2022 / 266753 is particularly suitable for use in the present disclosure.

[0072] In some preferred embodiments, the dsRNA conjugates include but are not limited to the compound structure examples in Table A, wherein R 2 is a dsRNA as defined herein.

[0073] Table A. Examples of conjugates

[0074] More preferably, the ligand group is

[0075] In some embodiments, R 2 It comprises any one of the antisense strand nucleotide sequences shown in Table 1 or 2, and any one of the sense strand nucleotide sequences shown in Table 1 or 2.

[0076] In some embodiments, R 2 The nucleotide sequences of the sense and antisense strands of any one of the dsRNAs shown in Table 2 are included.

[0077] In some embodiments, the P atom in the structural formula in Table A is linked to the 3' end of the sense strand of the dsRNA.

[0078] In another aspect, the present disclosure also provides a cell, a vector, a host cell, and a pharmaceutical composition comprising the dsRNAi agent of the present disclosure.

[0079] The present disclosure also provides a pharmaceutical composition comprising the dsRNA or dsRNA conjugate described herein and a pharmaceutically acceptable carrier thereof.

[0080] In yet another aspect, the present disclosure provides a pharmaceutical combination for inhibiting LPA expression, comprising the dsRNA, dsRNA conjugate, or pharmaceutical composition thereof described herein, and one or more additional therapeutic agents for inhibiting LPA expression.

[0081] In yet another aspect, the present disclosure provides use of a dsRNA, dsRNA conjugate, pharmaceutical composition, or pharmaceutical combination described herein for the preparation of a medicament for treating and / or preventing a disease or disorder in which LPA is expressed.

[0082] In yet another aspect, the present disclosure provides a method for treating and / or preventing a disease or disorder in which LPA is expressed, wherein the method comprises administering to a subject in need thereof a dsRNA, dsRNA conjugate, pharmaceutical composition or pharmaceutical combination as described herein.

[0083] In yet another aspect, the present disclosure provides a dsRNA, dsRNA conjugate, pharmaceutical composition, or pharmaceutical combination as described herein for use in treating and / or preventing a disease or disorder in which LPA is expressed.

[0084] In yet another aspect, the present disclosure provides a method of inhibiting LPA expression in a subject, the method comprising administering to a subject in need thereof a dsRNA, dsRNA conjugate, pharmaceutical composition, or pharmaceutical combination as described herein.

[0085] In some embodiments, the dsRNA, dsRNA conjugate, pharmaceutical composition, or pharmaceutical combination is formulated for subcutaneous or intravenous administration.

[0086] In some embodiments, the carrier of the pharmaceutical composition is a non-buffered solution or a buffered solution. Typical non-buffered solutions are saline or water, and buffered solutions include one or more of acetate, citrate, prolamin, carbonate, and phosphate. A preferred buffered solution is phosphate-buffered saline (PBS).

[0087] In another aspect of the present disclosure, methods for inhibiting LPA expression are also provided, comprising: contacting the cell with the dsRNA conjugate of the present disclosure to degrade LPA mRNA transcripts, thereby inhibiting LPA expression in the cell.

[0088] In some embodiments, the cell is in a subject. In some embodiments, the cell is a hepatocyte. In some embodiments, the subject is a human.

[0089] In some embodiments, LPA expression is inhibited by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%.

[0090] In another aspect, the present disclosure also provides a method for treating a subject having a disorder mediated by LPA expression. The method comprises administering to the subject a therapeutically effective amount of a dsRNA of the present disclosure, thereby inhibiting LPA expression.

[0091] In some embodiments, inhibiting the expression of LPA reduces the protein level of LPA expression in the serum of the subject by at least 50%, 60%, 70%, 80%, 90%, or 95%.

[0092] In some embodiments, the dsRNA conjugate is administered to a subject at a dose of about 0.10 mg / kg to about 50 mg / kg, for example, about 0.01 mg / kg to about 10 mg / kg, about 0.5 mg / kg to about 50 mg / kg, about 10 mg / kg to about 30 mg / kg, about 10 mg / kg to about 20 mg / kg, about 15 mg / kg to about 20 mg / kg, about 15 mg / kg to about 25 mg / kg, about 15 mg / kg to about 30 mg / kg, or about 20 mg / kg to about 30 mg / kg.

[0093] In some embodiments, the diseases or conditions described herein include cardiometabolic diseases, including but not limited to Berger's disease, peripheral artery disease, coronary artery disease, metabolic syndrome, acute coronary syndrome, aortic regurgitation, aortic dissection, retinal artery occlusion, cerebrovascular disease, mesenteric ischemia, superior mesenteric artery occlusion, renal artery stenosis, stable / unstable angina, acute coronary syndrome, heterozygous or homozygous familial hypercholesterolemia, hyperlipoproteinemia, cerebrovascular atherosclerosis, venous thrombosis, congestive heart failure, ischemic heart disease, carotid artery disease, myocardial infarction, stroke, aortic stenosis, atrial fibrillation, heart failure, hyperlipidemia; type 2 diabetes, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis (NASH).

[0094] In some embodiments, the dsRNAi agent of the present application can be administered simultaneously or sequentially with another therapeutic agent. In some embodiments, the dsRNAi agent is administered before or after administering another therapeutic agent, such as a standard therapeutic agent. BRIEF DESCRIPTION OF THE DRAWINGS

[0095] FIG1A to FIG1H show the inhibitory activity of dsRNA against LPA.

[0096] 2A to 2H show the inhibitory activity of dsRNA against LPA (full curves).

[0097] FIG3A shows the stability of fully modified dsRNA in serum.

[0098] FIG3B shows the stability of fully modified dsRNA in liver S9. DETAILED DESCRIPTION

[0099] definition

[0100] The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology, which are within the skill of the art.

[0101] To facilitate understanding of the present invention, certain technical terms are defined below. Unless otherwise expressly defined elsewhere herein, the technical terms used herein have the meanings commonly understood by those skilled in the art to which the present invention pertains. Any singular form used herein (including the claims) includes the corresponding plural form unless otherwise expressly provided herein. Furthermore, it should be noted that whenever a numerical value or range of values ​​for a parameter is listed, it is intended that values ​​intermediate to the listed numerical values ​​and ranges are also part of the present invention.

[0102] The term "about" when used in conjunction with a numerical value is meant to encompass the numerical value within a range having a lower limit of 5% less than the specified numerical value and an upper limit of 5% greater than the specified numerical value, including but not limited to ±5%, ±2%, ±1%, and ±0.1%, as such variations are appropriate for performing the disclosed methods.

[0103] The term "and / or" should be understood to mean any one of the alternatives or a combination of any two or more of the alternatives.

[0104] The term "or" should be understood to have the same meaning as "and / or" as defined above. For example, when separating items in a list, "or" or "and / or" should be interpreted as inclusive, i.e., including at least one of the numbers or elements in the list, but also including more than one, and optionally, additional unlisted items. Only when explicitly stated to the contrary, such as "only one" or "exactly one" or when used in a claim, "consisting of..." will refer to only one of the listed numbers or one of the elements in the list.

[0105] Unless expressly stated otherwise, as used herein, the words "a" and "an" should be understood to mean "at least one."

[0106] The terms "including" or "comprising" are intended to be used interchangeably with the phrase "including but not limited to".

[0107] The term "at least" preceding a number or a series of numbers is understood to include the number adjacent to the term "at least" and all subsequent numbers or integers that can be logically included, as clear from the context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, "at least 18 nucleotides of a 21-nucleotide nucleic acid molecule" means 18, 19, 20, or 21 nucleotides having the specified properties. When at least appears before a series of numbers or a range, it should be understood that at least can modify each number in the series or range.

[0108] The terms "LPA," "apolipoprotein(a)," and the abbreviation "apo(a)" refer to the apolipoprotein(a) polypeptide, a member of the apolipoprotein class of polypeptides that bind lipids to form lipoproteins. Apo(a) is a polymorphic glycoprotein encoded by the human LPA gene. LPA mRNA and apo(a) polypeptide are primarily expressed in the liver. The amino acid and nucleotide sequences of human LPA mRNA transcripts can be found, for example, in GenBank Accession No. NM_005577.4 (SEQ ID NO: 1741); the amino acid and nucleotide sequences of cynomolgus monkey LPA mRNA transcripts can be found in GenBank Accession Nos. XM_065543180.1 (SEQ ID NO: 1747), XM_065543182.1 (SEQ ID NO: 1746), XM_065543183.1 (SEQ ID NO: 1745), XM_065543184.1 (SEQ ID NO: 1744), XM_065543185.1 (SEQ ID NO: 1743), and XM_065543186.1 (SEQ ID NO: 1742). Additional examples of LPA mRNA sequences are readily available using publicly available databases such as GenBank, UniProt, and OMIM.

[0109] The term "target sequence" or "target nucleic acid" refers to a continuous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a target gene, including mRNA that is a product of RNA processing of a primary transcript. In one embodiment, the target portion of the sequence will be at least long enough to serve as a substrate for RNAi-directed cleavage at or near the nucleotide sequence portion of the mRNA molecule formed during the transcription of the target gene. In one embodiment, the target sequence is located within the protein coding region of the target gene. In another embodiment, the target sequence is located within the 3'UTR of the target gene. The target nucleic acid can be a cellular gene (or an mRNA transcribed from the gene) whose expression is associated with a specific condition or disease state. The target sequence can be about 19-36 nucleotides in length, for example, about 19-30 nucleotides in length. In certain embodiments, the target sequence is 19-23 nucleotides in length, optionally 21-23 nucleotides in length. Ranges and lengths intermediate to the above ranges and lengths are also considered part of this disclosure.

[0110] As used herein, the term "dsRNA" means double-stranded ribonucleic acid, comprising a sense strand (also referred to as a sense strand) and an antisense strand (also referred to as a guide strand). Each strand of a dsRNA molecule can have a length of 12-40 nucleotides. For example, each strand can have a length of 14-40 nucleotides, a length of 17-37 nucleotides, a length of 25-37 nucleotides, a length of 17-25 nucleotides, a length of 17-22 nucleotides, a length of 19-25 nucleotides, a length of 19-23 nucleotides, a length of 21-23 nucleotides, but is not limited thereto. And the sense strand and the antisense strand can be equal length or unequal length. For example, the length of the sense strand and the antisense strand can differ by 0 to 8 nucleotides, with a difference of X being 1-8, such as 2, 3, 4, 5, 6, 7, 8. The ranges and lengths intermediate to the ranges and lengths listed above are also considered to be part of the present disclosure.

[0111] The "dsRNA" disclosed herein can be used as small interfering RNA, i.e., siRNA, to mediate targeted cleavage of RNA transcripts through the RNA-induced silencing complex (RISC) pathway. Through a process known as RNA interference (RNAi), it directs sequence-specific degradation of mRNA, silencing the expression of the target sequence in vitro and / or in vivo. For example, siRNA modulates (e.g., inhibits) the expression of LPA in cells (e.g., cells in a subject, such as a mammalian subject).

[0112] In some embodiments, "dsRNA" of the present disclosure also refers to RNA interference or RNAi's post-transcriptional gene silencing mechanism that triggers the degradation of target RNA, such as mRNA. Generally speaking, most of the nucleotides in each chain of the dsRNA molecule are ribonucleotides, but as described in detail herein, each or both chains can also include one or more non-ribonucleotides, such as deoxyribonucleotides or modified nucleotides. Each chain of the dsRNA molecule can have a length within the range of 12-40 nucleotides. For example, each chain can be between 14-40 nucleotides in length, 17-37 nucleotides in length, 25-37 nucleotides in length, 17-25 nucleotides in length, 17-22 nucleotides in length, 19-25 nucleotides in length, 19-23 nucleotides in length, or 21-23 nucleotides in length, and the sense strand and antisense strand can be equal length or unequal length, without limitation.

[0113] The terms "siRNA," "RNAi agent," "siRNA agent," "dsRNA agent," "dsRNAi," "dsRNAi agent," and "RNA interference agent," used interchangeably herein, refer to agents that contain RNA, as that term is defined herein, and mediate targeted cleavage of RNA. Transcription occurs through the RNA-induced silencing complex (RISC) pathway. siRNA directs sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). siRNA modulates, for example, inhibits expression of the LPA gene in cells (e.g., hepatocytes and / or adipocytes) within a subject (e.g., a mammalian subject). In certain embodiments, the "siRNA" used in the compositions, uses, and methods of the present disclosure comprises a double-stranded RNA of the present disclosure and is referred to herein as a "double-stranded RNAi agent," "dsRNAi agent," or "dsRNA agent."

[0114] In certain embodiments, the dsRNAi agent of the present invention includes a double-stranded RNA agent, which, when introduced into a cell, is processed into short interfering RNA by a nuclease called Dicer. Short interfering RNA is integrated into RISC, and one or more helicases unwind the RNA duplex, allowing the complementary antisense strand to guide target recognition. After binding to the target mRNA, one or more nucleases in RISC will cut the target mRNA to induce silencing. Therefore, in other embodiments, the siRNA agent relates to single-stranded RNA produced in the cell and promotes the formation of the RISC complex to achieve silencing of the target gene. In some such embodiments, the RNAi agent is a single-stranded siRNA (ssRNAi), which can be introduced into a cell or organism to inhibit the target mRNA. The single-stranded RNAi agent binds to the RISC nuclease, Argonaute2, and then cuts the target mRNA. The ssRNAi agent is generally 15-30 nucleotides in length and can be chemically modified. Any antisense oligonucleotide described herein can be used as the ssRNAi agent described herein. In some embodiments, the ssRNAi agent comprises at least one non-canonical base pairing nucleotide. In some embodiments, the ssRNAi agent comprises at least one modified nucleotide.

[0115] In some embodiments, dsRNA is chemically synthesized. Most of the nucleotides in each chain of the dsRNA are ribonucleotides, but each or both of the two chains can also include one or more non-ribonucleotides, for example, deoxyribonucleotides and / or modified nucleotides. In some embodiments, the dsRNA comprises at least one modified nucleotide, for example, the dsRNA comprises one, two, three, four, five, six, seven, eight, nine, ten or more modified nucleotides (e.g., substantial modification) in the double-stranded region. In some embodiments, the nucleotides in the dsRNA of the present disclosure are all modified nucleotides.

[0116] As used herein, the term "modified nucleotide" refers to a nucleotide that independently has a modified sugar moiety, a modified internucleotide linkage, and / or a modified nucleobase. Thus, the term modified nucleotide encompasses substitutions, additions, or removals of, for example, a functional group or atom of an internucleoside linkage, a sugar moiety, or a nucleobase. Modifications suitable for use in the present disclosure include all types of modifications disclosed herein or known in the art.

[0117] The term "antisense strand" herein refers to a strand of a dsRNA that contains a region that is substantially complementary to a target sequence (e.g., an LPA mRNA). As used herein, the term "complementary region" refers to a region on the antisense strand that is substantially complementary to a sequence. Where the complementary region is not completely complementary to the target sequence, mismatches may occur within or at the terminal regions of the molecule. Typically, the most tolerated mismatches occur within the terminal regions, e.g., within 5, 4, 3, or 2 nucleotides of the 5' and / or 3' end of the dsRNA.

[0118] When a first sequence is referred to as "substantially complementary" to a second sequence, the two sequences can be fully complementary (i.e., complementary over the entire length of one or both nucleotide sequences), or they can form one or more, but generally no more than 5, 4, 3, or 2, mismatched base pairs upon hybridization over a distance of up to 30 base pairs, while retaining the ability to hybridize under appropriate conditions (conditions relevant to their application, such as inhibition of gene expression, such as physiological conditions). It should be noted that when two oligonucleotides are designed to form one or more single-stranded overhangs upon hybridization, such overhangs should not be considered mismatches for purposes of determining complementarity. For example, a dsRNA comprising one oligonucleotide of 21 nucleotides in length and another oligonucleotide of 23 nucleotides in length, where the longer oligonucleotide comprises a 21-nucleotide sequence that is fully complementary to the shorter oligonucleotide, can be referred to as "fully complementary" for the purposes described herein.

[0119] The term "sense strand" or "sense strand" as used herein refers to the strand of a dsRNA that comprises a region that is substantially complementary to a region of the antisense strand as defined herein.

[0120] As used herein, and unless otherwise indicated, the term "complementary" when used to describe a first nucleotide sequence relative to a second nucleotide sequence refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure with an oligonucleotide or polynucleotide comprising the second nucleotide sequence under certain conditions. Such conditions may, for example, be stringent conditions, wherein stringent conditions may include: 400 mM NaCl, 40 mM PIPES, pH 6.4, 1 mM EDTA, 50°C or 70°C for 12-16 hours. Other conditions, such as physiologically relevant conditions that may be encountered in an organism, may also be applicable. For example, complementary sequences are sufficient to enable the relevant function of the nucleic acid, such as RNAi. A skilled person can determine the set of conditions that is most suitable for testing the complementarity of two sequences based on the ultimate use of the hybridizing nucleotides.

[0121] The terms "complementary," "fully complementary," and "substantially complementary" herein may be used to refer to base matching between the sense and antisense strands of a dsRNA, or base matching between two oligonucleotides or polynucleotides, such as the antisense strand of a dsRNA and a target sequence, and their meanings will be understood from the context in which the terms are used.

[0122] The term "melting temperature" or "Tm" is used herein to refer to the temperature at which 50% of double-stranded RNA (dsRNA) molecules are opened or denatured (i.e., 50% of the double-stranded RNA molecules are separated into single strands and 50% of the complementary oligonucleotide chains do not hybridize to each other). For a given oligonucleotide, its corresponding Tm value can be calculated using any acceptable formula or software known in the art. For example, but not limited to, Tm can be calculated using the OligoAnalyzer™ tool from Integrated DNA Technologies (IDT) (Coralville, Iowa, USA); using the Tm calculation tool on the website http: / / insilico.ehu.es / tm.php?formula=basic, etc. The term "ΔTm" refers to the difference in Tm (e.g., calculated Tm) between two different oligonucleotides (e.g., an unmodified oligonucleotide and an oligonucleotide having the same sequence and comprising one or more modified nucleotides). In certain embodiments, ΔTm is used to refer to the difference in melting temperature between two dsRNA regions or duplexes of the present disclosure, wherein one of the dsRNA regions or duplexes comprises a nucleotide substitution with at least one modified nucleotide (e.g., a non-canonical base pairing nucleotide). In some embodiments, ΔTm is used to refer to the difference in melting temperature between two oligonucleotides (e.g., two antisense strands, two sense strands), wherein one of the oligonucleotides comprises at least one nucleotide substituted with a non-canonical base pairing nucleotide.

[0123] As used herein, the term "bivalent compound" refers to an organic compound or molecule capable of connecting (also known as coupling) two other compound groups or residues at two sites within the molecule that can be derivatized, thereby forming a new compound or conjugate. For example, 1,12-dodecanedioic acid is a typical bivalent compound. It can use its two carboxyl groups at the 1- and 12-positions, respectively, to connect or couple two other molecules via amide or ester, thereby forming a new compound, i.e., a conjugate. The two sites within a bivalent compound that can be derivatized can be different or the same.

[0124] The term "conjugate" (sometimes also referred to as conjugate, conjugate, conjugate, conjugate, and sometimes also referred to as conjugate in the literature) used in this disclosure corresponds to the English word "conjugate" or "conjugates". A conjugate refers to a new compound generated by covalently linking (coupling) two or more compound molecules through a bivalent or multivalent compound molecule with a linking function. A conjugate can also be generated by directly coupling or condensing two molecules. A common antibody-drug conjugate (ADC) is a conjugate, also known as an antibody drug conjugate. In this disclosure, the product produced by coupling a dsRNA molecule to a biological ligand group through a linking group and a bivalent compound is also a conjugate.

[0125] The term "coupling" as used in this disclosure refers to the chemical process by which two or more compound molecules undergo a reaction to form new chemical bonds and new molecules. In certain contexts, "coupling" can be used interchangeably with "connection" or "conjugation" or can replace each other.

[0126] "G", "C", "A", "T" and "U" generally represent nucleotides containing guanine, cytosine, adenine, thymine (also known as 5-methyluracil) and uracil as bases, respectively. However, it should be understood that the term "ribonucleotide" or "nucleotide" can also refer to modified nucleotides, as described in further detail below, and G, C, A, T and U are referred to as "canonical" nucleotides in this article, and the definition of canonical nucleotides is shown in Table B. Accordingly, guanine, cytosine, adenine, thymine and uracil are referred to as "canonical" bases in this article, which are the common bases for RNA or DNA construction. In this article, when only the base groups or base parts are stated or described and no ambiguity is caused, "G" can also be used to represent guanine, "C" can represent cytosine, "A" can represent adenine, "T" can represent thymine and "U" can represent uracil. For canonical bases or canonical nucleotides, in most cases, A pairs with U (T in DNA) and G pairs with C, following the Watson-Crick base pairing rules (referred to herein as "canonical base pairing").

[0127] Table B. Definitions of canonical nucleotides

[0128] "Non-canonical" base pairing that does not follow the Watson-Crick base pairing rules is also possible. For example, GU wobble base pairing occurs frequently and has a pairing strength (e.g., thermodynamic stability) comparable to Watson-Crick base pairs. Therefore, adenine and cytosine at any position in the nucleotide sequence of the dsRNAi agent of the present disclosure can be replaced by guanine and uracil, respectively, to form GU wobble base pairing with the target sequence.

[0129] Certain modified nucleotides also exhibit non-canonical base pairing. Such modified nucleotides have base pairing characteristics different from canonical nucleotides. For example, a modified nucleotide (e.g., inosinic acid) with hypoxanthine as a base can be base paired with a nucleotide containing adenine, cytosine, or uracil. Therefore, in the nucleotide sequence of the dsRNAi agent of the present disclosure, a nucleotide containing uracil, guanine, or adenine can be replaced by a modified nucleotide (e.g., inosinic acid) containing the base hypoxanthine. In certain embodiments, one or more canonical nucleotides in the dsRNAi agent of the present disclosure are replaced by modified nucleotides with different base pairing characteristics; such replacement portions are referred to herein as "non-canonical base pairing nucleotides." The non-canonical base pairing nucleotides of the present disclosure include nucleotides capable of non-Watson-Crick or wobble base pairing and / or modified nucleotides with different base pairing characteristics compared to the canonical nucleotides they replace. Sequences containing such non-canonical base pairing nucleotides are suitable for dsRNAi agents, compositions, and methods of the present disclosure.

[0130] It should be understood that non-canonical base-pairing nucleotides (e.g., modified nucleotides having different base-pairing characteristics than the canonical nucleotides they replace) can differ not only in the base pairs they form, but also in the strength or stability of the base pairing. Non-canonical base pairing can be stronger or weaker than canonical base pairing. For example, m1Ψ (modified from U) pairs more strongly with A than U pairs with A, and m1Ψ-G pairs even more strongly than m1Ψ-A pairs. Thus, by replacing canonical nucleotides with non-canonical base-pairing nucleotides, the strength of base pairing can be altered, thereby altering the Tm of the antisense duplex and / or the Tm of hybridization between the antisense strand and the target RNA (e.g., LPA mRNA). Thus, in some embodiments, canonical nucleotides are replaced with non-canonical base-pairing nucleotides, thereby altering the Tm of the oligonucleotide (e.g., altering the calculated Tm of the oligonucleotide, altering the Tm of the resulting double-stranded RNA molecule, such as the Tm of the duplex formed by the antisense strand hybridized with the target mRNA and / or the sense strand). Without wishing to be bound by theory, by changing the Tm of the oligonucleotide by replacing at least one canonical nucleotide with non-canonical base pairing nucleotides, the efficacy, effectiveness, specificity, safety and / or off-target effects of dsRNAi can be regulated and controlled. For example, but not limited to, the efficacy or effectiveness of the dsRNAi agent can be increased by increasing the pairing strength with the desired target mRNA and / or reducing the pairing strength with off-target mRNA. Similarly, the undesirable off-target effects can be reduced by increasing the pairing strength with the desired target mRNA and / or reducing the pairing strength with off-target mRNA. Therefore, in some embodiments, compared with similar RNAi agents that do not comprise at least one non-canonical base pairing nucleotides, the dsRNAi agent of the present disclosure has improved efficacy, effectiveness, specificity and / or safety.

[0131] In certain embodiments of the dsRNAi agents, antisense strands and sense strands of the present disclosure, at least one canonical nucleotide is replaced by a non-canonical base pairing nucleotide. In some such embodiments, one nucleotide is replaced by a non-canonical base pairing nucleotide, i.e., the dsRNAi agent, antisense strand or sense strand comprises a non-canonical base pairing nucleotide. In some embodiments, two, three, four, five or more nucleotides are replaced by non-canonical base pairing nucleotides, i.e., the dsRNAi agent, antisense strand or sense strand comprises two, three, four, five or more non-canonical base pairing nucleotides. In some embodiments, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more nucleotides in an oligonucleotide or dsRNAi agent are modified nucleotides, such as non-canonical base pairing nucleotides. In some embodiments, all nucleotides in a dsRNAi agent, e.g., in the sense strand and / or antisense strand, are modified nucleotides, e.g., non-canonical base-pairing nucleotides. In some embodiments, at least one nucleotide in a dsRNAi agent, e.g., in the sense strand and / or antisense strand, is a modified nucleotide, e.g., non-canonical base-pairing nucleotide.

[0132] Therefore, in certain embodiments, the dsRNAi agent of the present disclosure comprises at least one non-canonical base pairing nucleotide, that is, at least one nucleotide in the antisense strand and / or the sense strand is replaced by a non-canonical base pairing nucleotide. In some such embodiments, at least one non-canonical base pairing nucleotide is present on the antisense strand. In some such embodiments, at least one non-canonical base pairing nucleotide is present on the sense strand. In some such embodiments, at least one non-canonical base pairing nucleotide is present on the antisense strand and the sense strand simultaneously. In some embodiments, at least one non-canonical base pairing nucleotide is present in a complementary region, that is, a region substantially complementary to the target sequence in the oligonucleotide, for example, a region complementary to the target sequence (e.g., LPA mRNA) in the antisense strand of the present disclosure.

[0133] In certain embodiments, replacing at least one canonical nucleotide with a non-canonical base pairing nucleotide changes the melting temperature (Tm) of the oligonucleotide or dsRNA duplex. In some embodiments, the Tm changes by at least 2°C (i.e., the ΔTm is at least about 2°C). In some embodiments, the ΔTm is about 2°C. In some embodiments, the ΔTm exceeds 2°C. In some embodiments, the ΔTm is about 2.5°C, 3°C, 3.5°C, 4°C, 4.5°C, or 5°C.

[0134] In certain embodiments, at least one non-canonical base pairing nucleotide is present at positions 1-11, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, and / or 11, from the 5' to the 3' direction of the antisense strand.

[0135] In certain embodiments, at least one non-canonical base pairing nucleotide is present at positions 12-21, e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, and / or 21, of the antisense strand in the 5' to 3' direction.

[0136] In certain embodiments of the oligonucleotides and dsRNAi agents of the present disclosure, in the direction from the 5' end to the 3' end, if at least four nucleotides in positions 2-8 of the antisense strand are A or U and at least one of the nucleotides at positions 6-8 is G, then the G at positions 6, 7 and / or 8 is replaced by a non-canonical base pairing nucleotide.

[0137] In certain embodiments of the oligonucleotides and dsRNAi agents disclosed herein, in the sequence fragment N1N2G0N3N4, when at least three bases among N1, N2, N3 and N4 are adenine or uracil, the guanine in G0 is replaced by a non-canonical base pairing nucleotide, such as hypoxanthine, wherein N1, N2, N3 and N4 are each independently a nucleotide comprising adenine (A), cytosine (C), guanine (G) or uracil (U) as a base, and G0 is a nucleotide comprising guanine as a base.

[0138] It should be understood that all non-canonical base-pairing nucleotides or non-canonical bases disclosed herein or known in the art are suitable for use in the dsRNAi agents, compositions, and methods of the present disclosure. Non-limiting examples of non-canonical base-pairing nucleotides or non-canonical bases are defined as shown in Table C. In some embodiments, the non-canonical base-pairing nucleotide or non-canonical base is a modifying group shown in Table C. In some embodiments, the non-canonical base is hypoxanthine. In some embodiments, the non-canonical base-pairing nucleotide is a canonical nucleotide capable of wobble pairing. Combinations of the foregoing are also contemplated.

[0139] Table C. Examples of non-canonical base-pairing nucleotides and non-canonical bases according to certain embodiments

[0140] The term "modified nucleotide" refers to any nucleotide that independently has a modified sugar moiety, a modified internucleotide linkage, and / or a modified nucleobase. Thus, the term "modified nucleotide" encompasses substitution, addition, or removal of, for example, a functional group or atom of an internucleoside linkage, a sugar moiety, or a nucleobase. Modifications suitable for use in the present disclosure include all types of modifications disclosed herein or known in the art. In some embodiments, the modified nucleotide is a non-canonical base pairing nucleotide as defined herein, i.e., a nucleotide that has a pairing characteristic that is different from the canonical nucleotide that it replaces. In other embodiments, the modified nucleotide may not have different pairing characteristics, but may still possess desirable or advantageous characteristics of the dsRNAi agents, compositions, and methods of the present disclosure, such as stability, resistance to degradation (e.g., nuclease resistance), manufacturability, and the like. In certain embodiments, the dsRNAi agent of the present disclosure comprises at least one modified nucleotide in addition to at least one non-canonical base pairing nucleotide, i.e., in addition to comprising at least one non-canonical base pairing nucleotide, at least one additional nucleotide in the antisense strand and / or the sense strand is replaced by an additional modified nucleotide (which may or may not be a non-canonical base pairing nucleotide). In some such embodiments, the at least one additional modified nucleotide is present on the antisense strand. In some such embodiments, the at least one additional modified nucleotide is present on the sense strand. In some such embodiments, the at least one additional modified nucleotide is present on both the antisense strand and the sense strand. In some such embodiments, the at least one additional modified nucleotide is present on the same strand as the at least one non-canonical base pairing nucleotide. In other embodiments, the at least one additional modified nucleotide is not present on the same strand as the at least one non-canonical base pairing nucleotide, i.e., is present on another strand. In some embodiments, the at least one additional modified nucleotide is present in a complementary region, i.e., a region of an oligonucleotide that is substantially complementary to a target sequence, e.g., a region of an antisense strand of the present disclosure that is complementary to a target sequence mRNA (e.g., LPA mRNA).

[0141] In the present disclosure, non-limiting examples of common modified nucleotides and related moieties are defined as shown in Table D. In some embodiments, the modified nucleotide is a modified nucleotide shown in Table D. In some embodiments, at least one additional modified nucleotide of the dsRNAi agent of the present disclosure is a modified nucleotide shown in Table D. It should be understood that combinations of corresponding abbreviations represent combinations of corresponding modifications, such as irmN represents an inverted 2′-O-methyl-modified nucleotide.

[0142] Table D. Definition of modified nucleotides in some embodiments

[0143] Among them, the modification pattern of inverted nucleotides is also called inverted bases in some literature, which refers to those bases with linkages reversed from the normal 5' to 3' linkages (ie, 5' to 5' linkages or 3' to 3' linkages).

[0144] In some embodiments, the inclusion of deoxynucleotides may be considered to constitute modified nucleotides.

[0145] It will be understood that all types of modifications disclosed herein or known in the art are applicable to the dsRNAi agents, compositions and methods of the present disclosure.

[0146] The term "amino acid" generally refers to an organic compound that contains both a carboxylic acid group and an amine group. The term "amino acid" includes both "natural" and "unnatural" amino acids. Additionally, the term amino acid includes O-alkylated or N-alkylated amino acids, as well as amino acids with nitrogen-, sulfur-, or oxygen-containing side chains (e.g., Lys, Cys, or Ser), wherein the nitrogen, sulfur, or oxygen atom may or may not be acylated or alkylated. Amino acids can be L-amino acids, D-amino acids, or mixed L- and D-amino acids, including but not limited to racemic mixtures.

[0147] As used herein, the phrase "inhibiting LPA expression" encompasses inhibiting the expression of any LPA (such as mouse LPA gene, rat LPA gene, monkey LPA gene or human LPA gene) and variants or mutants of LPA genes encoding LPA proteins.

[0148] The LPA-mediated diseases include metabolic diseases, which can be any metabolic diseases known to those skilled in the art. In certain embodiments, the metabolic disease is dyslipidemia. Dyslipidemia can be any dyslipidemia known to those skilled in the art. In certain embodiments, the LPA-mediated diseases are selected from the group consisting of hyperlipidemia, hypercholesterolemia, hypertriglyceridemia, hyperlipoproteinemia, HDL deficiency, ApoA-I deficiency, and cardiovascular diseases such as coronary artery disease (e.g., including angina pectoris, myocardial infarction, and sudden cardiac death), atherosclerosis, and arterial restenosis (e.g., including atherosclerotic plaques formed due to medical procedures such as balloon angioplasty). In certain embodiments, the present disclosure provides methods for treating and / or preventing diabetes.

[0149] The LPA-mediated diseases include cardiovascular diseases, which can be any cardiovascular diseases known to those skilled in the art. In certain embodiments, the present disclosure provides methods for treating and / or preventing atherosclerosis. In certain embodiments, the present disclosure provides methods for treating and / or preventing atherosclerosis derived from abnormal macrophage processing. In certain embodiments, the present disclosure provides methods for treating and / or preventing atherosclerosis formed from oxidized low-density lipoprotein (oxLDL), wherein macrophages are unable to process oxidized low-density lipoprotein (oxLDL). In certain embodiments, the present disclosure provides methods for treating and / or preventing ischemic heart disease. In certain embodiments, the present disclosure provides methods for treating and / or preventing stroke. In certain embodiments, the present disclosure provides methods for treating and / or preventing hypertensive heart disease. In certain embodiments, the present disclosure provides methods for treating and / or preventing aortic aneurysm. In certain embodiments, the present disclosure provides methods for treating and / or preventing endocarditis. In certain embodiments, the present disclosure provides methods for treating and / or preventing peripheral arterial disease. In certain embodiments, the present disclosure provides methods for treating and / or preventing any combination of diseases provided in this paragraph. In some embodiments, the LPA-mediated disease includes but is not limited to Berger's disease, peripheral artery disease, coronary artery disease, metabolic syndrome, acute coronary syndrome, aortic stenosis, aortic regurgitation, aortic dissection, retinal artery occlusion, cerebrovascular disease, mesenteric ischemia, superior mesenteric artery occlusion, renal artery stenosis, stable / unstable angina, heterozygous or homozygous familial hypercholesterolemia, hyperlipoproteinemia, cerebrovascular atherosclerosis, cerebrovascular disease and venous thrombosis.

[0150] As used herein, "reduce" and similar expressions refer to reducing or effectively stopping. As a non-limiting example, one or more of the present inventions can reduce or effectively stop the onset or progression of cardiovascular disease or metabolic disease in a subject. This can be supported by, for example, the following conditions in the subject, including a reduction in one or more aspects of the LPA-mediated disease (e.g., symptoms, tissue characteristics, cell activity, inflammatory activity, or immune activity, etc.), or no detectable worsening of the condition, and the effectiveness of the present disclosure is expected.

[0151] As used herein, "reduced expression" of a gene (e.g., LPA) refers to a decrease in the amount or level of an RNA transcript (e.g., LPA mRNA) or protein encoded by the gene and / or a decrease in the amount or level of activity of the gene in a cell, cell population, sample, or subject, compared to an appropriate reference (e.g., a reference cell, cell population, sample, or subject). For example, contacting a cell with an oligonucleotide herein (e.g., an oligonucleotide comprising an antisense strand having a nucleotide sequence complementary to a nucleotide sequence comprising LPA mRNA) can result in a decrease in the amount or level of LPA mRNA, apo(a) protein, and / or apo(a) activity (e.g., by inactivating and / or degrading LPA mRNA using an RNAi pathway) compared to a cell not treated with the double-stranded oligonucleotide. Similarly, and as used herein, "reducing expression" refers to the act of reducing the expression of a gene (e.g., LPA). As used herein, "reduced LPA expression" refers to a decrease in the amount or level of LPA mRNA, apo(a) protein, and / or apo(a) activity in a cell, cell population, sample, or subject compared to an appropriate reference (e.g., a reference cell, cell population, sample, or subject).

[0152] As used herein, the phrase "contacting cells with an RNAi agent" (e.g., dsRNAi agent) includes contacting cells by any possible means. Contacting cells with an RNAi agent includes contacting cells with an RNAi agent in vitro or contacting cells with an RNAi agent in vivo. The contact can be carried out directly or indirectly. Therefore, for example, the RNAi agent can be brought into physical contact with the cell, or alternatively, the RNAi agent can be placed in a situation where it will allow or cause it to subsequently contact the cell. Contacting cells in vitro can be carried out by, for example, incubating the cell with the RNAi agent. Contacting cells in vivo can be carried out, for example, by injecting the RNAi agent into or near the tissue where the cell is located, or by injecting the RNAi agent into another region (e.g., bloodstream or subcutaneous space) so that the RNAi agent subsequently reaches the tissue where the cell is located. For example, the RNAi agent can contain or be coupled to a targeting ligand, such as GalNAc, which guides the RNAi agent to a site of interest, such as the liver. In other embodiments, the RNAi agent can contain or be coupled to one or more C22 hydrocarbon chains and one or more GalNAc derivatives. In other embodiments, the RNAi agent contains or is coupled to one or more C22 hydrocarbon chains and does not contain or is not coupled to one or more GalNAc derivatives. A combination of in vitro and in vivo contact methods is also possible. For example, cells can also be contacted with the RNAi agent of the present disclosure in vitro and subsequently transplanted into a subject. In certain embodiments, contacting cells with the RNAi agent includes promoting or influencing the uptake or absorption of cells. The absorption or uptake of the RNAi agent can occur by unassisted diffusion or active cell processes, or by adjuvants or devices. Introducing the RNAi agent into cells can be carried out in vitro or in vivo. For example, for in vivo introduction, the RNAi agent can be injected into a tissue site or administered systemically. In vitro introduction of cells includes methods known in the art, such as electroporation and lipofection.

[0153] "Subject" includes any human or non-human animal. The term "non-human animal" includes all vertebrates, e.g., mammals and non-mammals, such as non-human primates, sheep, dogs, cats, horses, cows, chickens, amphibians, reptiles, etc.

[0154] "Therapeutically effective amount," "therapeutically effective dose," and "effective amount" refer to an amount of the dsRNA of the present disclosure that, when administered alone or in combination with other therapeutic agents to a cell, tissue, or subject, is effective to prevent or ameliorate the symptoms of one or more diseases or conditions or the progression of the disease or condition. A therapeutically effective dose also refers to an amount of an antibody or antigen-binding fragment thereof sufficient to result in an improvement in symptoms, e.g., an amount to treat, cure, prevent, or ameliorate a related medical condition or to increase the rate of treatment, cure, prevention, or amelioration of such a condition. When a single active ingredient is administered to an individual, a therapeutically effective dose refers only to that ingredient. When administered in combination, a therapeutically effective dose refers to the combined amount of the active ingredients that results in a therapeutic effect, whether administered in combination, sequentially, or simultaneously. An effective amount of a therapeutic agent will result in an improvement in a diagnostic criterion or parameter by at least 10%, typically by at least 20%, preferably by at least about 30%, more preferably by at least 40%, and most preferably by at least 50%.

[0155] The terms "prevent" or "preventing," when used in reference to a disease, disorder, or condition that would benefit from a decrease in LPA expression, means reducing the likelihood that a subject will develop symptoms associated with such a disease, disorder, or condition. Not developing a disease, disorder, or condition, or reducing the development of symptoms associated with the disease, disorder, or condition (e.g., at least about 10% reduction for the disease or condition on a clinically accepted scale), or exhibiting a delay in symptoms (e.g., a delay of days, weeks, months, or years) is considered effective prevention.

[0156] As used herein, the phrase "pharmaceutically acceptable" refers to those compounds, materials, compositions or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human and animal subjects without excessive toxicity, irritation, allergic response, or other problems or complications, commensurate with a reasonable benefit / risk ratio.

[0157] As used herein, the phrase "pharmaceutically acceptable carrier" refers to a pharmaceutically acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., a lubricant, magnesium talc, calcium or zinc stearate, or stearic acid), or solvent encapsulating material (involved in carrying or transporting the subject compound from one organ or part of the body to another organ or part of the body).

[0158] dsRNA and modified nucleotides

[0159] Provided herein are dsRNAs for inhibiting LPA gene expression. Each dsRNA comprises a sense strand and an antisense strand. The sense strand and antisense strand may each be 17-25 nucleotides in length. The sense strand and antisense strand may be the same length, or they may be different lengths. In some embodiments, the sense strand and antisense strand are each independently 17-25 nucleotides in length. In some embodiments, the sense strand and antisense strand are each independently 19-23 nucleotides in length. In some embodiments, the sense strand is 19-21 nucleotides in length, and the antisense strand is 19-23 nucleotides in length. In some embodiments, the sense strand is approximately 19 nucleotides in length, and the antisense strand is approximately 20 nucleotides in length. In some embodiments, the sense strand is approximately 19 nucleotides in length, and the antisense strand is approximately 21 nucleotides in length. In some embodiments, the sense strand is approximately 20 nucleotides in length, and the antisense strand is approximately 21 nucleotides in length. In some embodiments, the sense strand is approximately 20 nucleotides in length, and the antisense strand is approximately 22 nucleotides in length. In some embodiments, the length of the sense strand is 21 nucleotides, and the length of the antisense strand is 22 nucleotides. In some embodiments, the length of the sense strand is 21 nucleotides, and the length of the antisense strand is 23 nucleotides. In some embodiments, the length of the sense strand is 19 nucleotides, and the length of the antisense strand is also 19 nucleotides. In some embodiments, the length of the dsRNA sense strand and the antisense strand is each independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 or 27 nucleotides. In some embodiments, the duplex of the dsRNA has about 15, 16, 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides. In some embodiments, the sense strand and the antisense strand have a length of at least 15, 16, 17, 18, 19, 20 or 21 nucleotides complementary.

[0160] Examples of nucleotide sequences used to form dsRNA are provided in Tables 1 and 2, respectively.

[0161] In some embodiments, the antisense strand of a dsRNA disclosed herein differs from any of the antisense strand sequences shown in Tables 1 or 2 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of an LPA dsRNA disclosed herein differs from any of the sense strand sequences shown in Tables 1 or 2 by 0, 1, 2, or 3 nucleotides.

[0162] In some embodiments, the dsRNA antisense strand comprises or consists of any one of the antisense strand nucleotide sequences shown in Tables 1 or 2. In some embodiments, the dsRNA antisense strand comprises (from 5' end → 3' end) positions 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24 of any one of the antisense strand nucleotide sequences in Tables 1 or 2. In certain embodiments, the dsRNA antisense strand comprises or consists of a modified sequence of any one of the sequences in Tables 1 or 2.

[0163] In some embodiments, the sense strand of the dsRNA comprises or consists of any one of the sense strand nucleotide sequences shown in Tables 1 or 2. In some embodiments, the sense strand of the dsRNA comprises (from 5' end → 3' end) positions 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24 of any one of the sense strand nucleotide sequences in Tables 1 or 2. In certain embodiments, the sense strand of the dsRNA comprises or consists of a modified sequence of any one of the sequences in Tables 1 and 2.

[0164] In some embodiments, the dsRNA is prepared or provided in the form of a salt, mixed salt, or free acid. In some embodiments, the dsRNA is prepared as a sodium salt. Such forms, which are well known in the art, are within the scope of the invention disclosed herein.

[0165] In some embodiments, dsRNA contains one or more modified nucleotides. In some embodiments, the modified nucleotides include, but are not limited to, 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy nucleotides, 2'-methoxyethyl modified nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, 2'-alkoxy modified nucleotides, 2'-F-arabinonucleotides, abasic nucleotides, morpholino nucleotides, and locked nucleotides. It is not necessary to uniformly modify all positions in a given compound. On the contrary, more than one modification can be added to a single dsRNA or even to a single nucleotide thereof. The modification of one nucleotide is independent of the modification of another nucleotide.

[0166] In some embodiments, all or substantially all nucleotides of the dsRNA are modified nucleotides. In some embodiments, 4 or less (i.e., 0, 1, 2, 3, or 4) nucleotides are unmodified nucleotides in both the sense and antisense strands of the dsRNA. In some embodiments, the sense strand of the dsRNA comprises two or less (i.e., 0, 1, or 2) nucleotides that are unmodified nucleotides. In some embodiments, the antisense strand of the dsRNA comprises two or less (i.e., 0, 1, or 2) nucleotides that are unmodified nucleotides. In some embodiments, one or more nucleotides of the dsRNA are unmodified ribonucleotides.

[0167] In certain embodiments, the dsRNAi agent comprises at least one non-canonical base-pairing nucleotide. Without limitation, such nucleotides can be present anywhere in the dsRNAi agent of the present disclosure. In some embodiments, at least one modified nucleotide and / or non-canonical base-pairing nucleotide changes the melting temperature of the oligonucleotide, for example, with a ΔTm of at least 2°C, for example, about 2°C, more than 2°C, about 2-5°C, about 3°C, about 4°C, or about 5°C.

[0168] In some embodiments, the dsRNA agents of the present disclosure comprise one or more targeting ligands, such as one or more GalNAc derivatives, and contain no additional chemical modifications known in the art and described herein in the remainder of the sense and antisense strands.

[0169] In some embodiments, the dsRNA agent of the present disclosure comprises one or more targeting ligands, such as one or more GalNAc derivatives, and comprises at least one additional nucleic acid modification described herein. For example, at least one modification is selected from the group consisting of modified internucleoside linkages, modified core bases, modified sugars, and any combination thereof. Unrestrictedly, such modifications may be present anywhere in the dsRNA agent of the present disclosure. For example, the modification may be present in one of the RNA molecules. Modifications include, for example, terminal modifications, such as 5' end modifications (phosphorylation, conjugation, reverse connection) or 3' end modifications (conjugation, DNA nucleotides, reverse connection, etc.); base modifications, for example, replacement with stable bases, destabilizing bases, or bases paired with extended bases, removal of bases (absorptive nucleotides) or conjugation of bases; sugar modifications (for example, at 2'-position or 4'-position) or sugar replacement; or main chain modifications, including modification or replacement of phosphodiester bonds. Specific examples of dsRNAi agents that can be used in the embodiments described herein include, but are not limited to, RNA containing modified backbones or free of natural internucleoside linkages. RNAs with modified backbones include RNAs that do not have a phosphorus atom in the backbone, etc. In some embodiments, the backbone of the modified dsRNAi agent has a phosphorus atom between nucleosides.

[0170] In some embodiments, one or more Nucleotide of dsRNA are connected by non-standard connection or backbone (i.e., backbone between the nucleosides of modification or modification).Bound between the nucleosides of modification or backbone include but are not limited to phosphorothioate group, chiral phosphorothioate, phosphorothioate, phosphorodithioate, phosphotriester, aminoalkyl-phosphotriester, chiral phosphonate, phosphinate, phosphoramidate, thioalkylphosphonate, thioalkylphosphotriester, morpholino connection, wherein adjacent nucleoside units are to connection 3'-5' to 5'-3' or 2'-5' to 5'-2' or 3'-3' to 5'-5'.

[0171] In some embodiments, the sense strand of the dsRNA can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages (phosphorothioate modified nucleotides), and the antisense strand of the dsRNA can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages (phosphorothioate modified nucleotides). In some embodiments, the sense strand of the dsRNA can contain 1 or 2 phosphorothioate linkages, and the antisense strand of the dsRNA can contain 1, 2, 3, or 4 phosphorothioate linkages.

[0172] In some embodiments, the dsRNA sense strand contains two phosphorothioate internucleoside linkages. In some embodiments, the phosphorothioate internucleoside linkage is located between the nucleotides at positions 1-3 from the 5' end of the sense strand. In some embodiments, the phosphorothioate internucleoside linkage is located between the nucleotides at positions 1-3 from the 3' end of the sense strand. In some embodiments, one phosphorothioate internucleoside linkage is located at the 5' end of the sense strand, and another phosphorothioate linkage is located at the 3' end of the sense strand. In some embodiments, the dsRNA sense strand contains one phosphorothioate internucleoside linkage. In some embodiments, the phosphorothioate internucleoside linkage is located between the nucleotides at positions 1-2 from the 5' end of the sense strand. In some embodiments, the phosphorothioate internucleoside linkage is located between the nucleotides at positions 2-3 from the 5' end of the sense strand. In some embodiments, the targeting ligand is linked to the sense strand via a phosphorothioate linkage.

[0173] In some embodiments, the dsRNA antisense strand contains 4 phosphorothioate nucleoside linkages. In some embodiments, the 4 phosphorothioate nucleoside linkages are located between the nucleotides at positions 1-3 from the 5' end of the antisense strand and between the nucleotides at positions 1-3 from the 3' end. In some embodiments, the dsRNA antisense strand contains 3 phosphorothioate nucleoside linkages. In some embodiments, the 3 phosphorothioate nucleoside linkages are located between the nucleotides at positions 1-2 from the 5' end of the antisense strand and between the nucleotides at positions 1-3 from the 3' end. In some embodiments, the 3 phosphorothioate nucleoside linkages are located between the nucleotides at positions 1-3 from the 5' end of the antisense strand and between the nucleotides at positions 1-2 from the 3' end. In some embodiments, the dsRNA antisense strand contains 2 phosphorothioate nucleoside linkages. In some embodiments, two phosphorothioate internucleoside linkages are optionally located between the nucleotides 1-3 from the 5' end and between the nucleotides 1-3 from the 3' end of the antisense strand.

[0174] In some embodiments, the dsRNA antisense strand comprises a nucleotide sequence (from 5' end → 3' end) of any antisense strand sequence in Table 1 or 2. In some embodiments, the dsRNA sense strand comprises a nucleotide sequence (from 5' end → 3' end) of any sense strand in Table 1 or 2. In some embodiments, the antisense strand of the dsRNA comprises a nucleotide sequence (from 5' end → 3' end) of any antisense strand in Table 1 or 2, and the sense strand comprises a nucleotide sequence (from 5' end → 3' end) of any sense strand in Table 1 or 2.

[0175] In some embodiments, the modified nucleotides disclosed herein are selected from the group consisting of 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy nucleotides, 2'-methoxyethyl modified nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, 2'-alkoxy modified nucleotides, 2'-F-arabino nucleotides, phosphorothioate modified nucleotides, abasic nucleotides, morpholino nucleotides, locked nucleotides, inverted nucleotides, and inosine base substituted nucleotides.

[0176] In some embodiments, the modified nucleotides disclosed herein are selected from the group consisting of 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy nucleotides, phosphorothioate modified nucleotides, and inverted base modified nucleotides. In some preferred embodiments, the inverted nucleotides are selected from the group consisting of inverted dA nucleotides, inverted T nucleotides, inverted mA nucleotides, inverted mT nucleotides, inverted fA nucleotides, inverted fT nucleotides, inverted dT nucleotides, inverted C nucleotides, and inverted U nucleotides.

[0177] Exemplary modified nucleotides or nucleobases include, but are not limited to, synthetic and natural nucleosides or nucleobases such as inosine, xanthine, hypoxanthine, nebularine, isoguanosine, tuberculin, 2-(halo)adenine, 2-(alkyl)adenine, 2-(propyl)adenine, 2-(amino)adenine, 2-(aminoalkyl)adenine, 2-(aminopropyl)adenine, 2-(methylthio)-N6-(isopentenyl)adenine, 6-(alkyl)adenine, 6-(methyl)adenine, 7-(deaza)adenine, 8-(alkenyl)adenine, 8-(alkyl)adenine, 8-(alkyne)adenine, adenine, 8-(amino)adenine, 8-(halo)adenine, 8-(hydroxy)adenine, 8-(thioalkyl)adenine, 8-(thiol)adenine, N6-(isopentyl)adenine, N6-(methyl)adenine, N6,N6-(dimethyl)adenine, 2-(alkyl)guanine, 2-(propyl)guanine, 6-(alkyl)guanine, 6-(methyl)guanine, 7-(alkyl)guanine, 7-(methyl)guanine, 7-(deaza)guanine, 8-(alkyl)guanine, 8-(alkenyl)guanine, 8-(alkynyl)guanine, 8-(amino)guanine, 8-(halo)guanine guanine, 8-(hydroxy)guanine, 8-(sulfanyl)guanine, 8-(thiol)guanine, N-(methyl)guanine, 2-(thio)cytosine, 3-(deaza)-5-(aza)cytosine, 3-(alkyl)cytosine, 3-(methyl)cytosine, 5-(alkyl)cytosine, 5-(alkynyl)cytosine, 5-(halo)cytosine, 5-(methyl)cytosine, 5-(propenyl)cytosine, 5-(propynyl)cytosine, 5-(trifluoromethyl)cytosine, 6-(azo)cytosine, N4-(acetyl)cytosine, 3-(3-amino-3-carboxypropyl)uracil, 2-(thio)uracil, 5-(Methyl)-2-(thio)uracil, 5-(methylaminomethyl)-2-(thio)uracil, 4-(thio)uracil, 5-(methyl)-4-(thio)uracil, 5-(methylaminomethyl)-4-(thio)uracil, 5-(methyl)-2,4-(dithio)uracil, 5-(methylaminomethyl)-2,4-(dithio)uracil, 5-(2-aminopropyl)uracil, 5-(alkyl)uracil, 5-(alkynyl)uracil, 5-(allylamino)uracil, 5-(aminoallyl)uracil, 5-(aminoalkyl)uracil, 5-(guanidinyl)uracil, 5-(1,uracil, 5-(3-oxadiazole-1-alkyl)uracil, 5-(cyanoalkyl)uracil, 5-(dialkylaminoalkyl)uracil, 5-(dimethylaminoalkyl)uracil, 5-(halogenated)uracil, 5-(methoxy)uracil, uracil-5-oxyacetic acid, 5-(methoxycarbonylmethyl)-2-(thio)uracil, 5-(methoxycarbonylmethyl)uracil, 5-(propenyl)uracil, 5-(propynyl)uracil, 5-(trifluoromethyl)uracil, 6-(azo)uracil, dihydrouracil, N3-(methyl)uracil, 5-uracil (i.e., pseudouracil), 2-(thio)pseudouracil, 4-(thio)pseudouracil, 2,4-(dithio)pseudouracil, 5- (Alkyl) pseudouracil, 5-(methyl) pseudouracil, 5-(alkyl)-2-(thio) pseudouracil, 5-(methyl)-2-(thio) pseudouracil, 5-(alkyl)-4-(thio) pseudouracil, 5-(methyl)-4-(thio) pseudouracil, 5-(alkyl)-2,4-(dithio) pseudouracil, 5-(methyl)-2,4-(dithio) pseudouracil, 1-substituted pseudouracil, 1-substituted 2(thio)-pseudouracil, 1-substituted 4-(thio) pseudouracil, 1-substituted 2,4-(dithio) pseudouracil, 1-(aminocarbonylvinyl)-pseudouracil, 1-(aminocarbonylvinyl)-2(thio) pseudouracil, 1-( 1-(aminoalkylaminocarbonylvinyl)-pseudouracil, 1-(aminoalkylaminocarbonylvinyl)-2(thio)-pseudouracil, 1-(aminoalkylaminocarbonylvinyl)-4-(thio)pseudouracil, 1-(aminoalkylaminocarbonylvinyl)-2,4-(dithio)pseudouracil, 1,3-(diaza)-2-(oxo)-phenoxazin-1-yl, 1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl, 1,3-(diaza)-2-(oxo)-phenothiazin-1-yl, 1-(aza)- 2-(thio)-3-(aza)-phenothiazin-1-yl, 7-substituted 1,3-(diaza)-2-(oxo)-phenoxazin-1-yl, 7-substituted 1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl, 7-substituted 1,3-(diaza)-2-(oxo)-phenothiazin-1-yl, 7-substituted 1(aza)-2-(thio)-3-(aza)-phenothiazin-1-yl, 7-(aminoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl, 7-(aminoalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl, 7-(aminoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenothiazin-1-yl, 7-(aminoalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenothiazin-1-yl, 7-(guanidinylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl, 7-(guanidinylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl, 7-(guanidinylhydroxy)-1,3-(diaza)-2-(oxo)phenothiazin-1-yl, 7-(guanidinylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenothiazin-1-yl, 1,3,5-(triaza)-2,6 -(dioxa)-naphthalene, inosinyl, 2-azainosinyl, 7-deazainosinyl, nitroimidazolyl, nitropyrazolyl, nitrobenzimidazolyl, nitroindazolyl, aminoindolyl, pyrrolopyrimidinyl, 3-(methyl)isoquinolonyl, 5-(methyl)isoquinolonyl, 3-(methyl)-7-(propynyl)isoquinolonyl, 7-(aza)indolyl, 6-(methyl)-7-(aza)indolyl, imidazopyridinyl, 9-(methyl)-imidazopyridinyl, pyrrolopyrazinyl, isoquinolonyl, 7-(propynyl)isoquinolyl, propynyl-7-(aza)indolyl, 2,4,5-(trimethyl)phenyl, 4-(methyl)indolyl, 4, 6-(dimethyl)indolyl, phenyl, naphthyl, anthracenyl, phenanthrenyl, pyrenyl, stilbene, tetracene, pentacene, difluorotolyl, 4-(fluoro)-6-(methyl)benzimidazole, 4-(methyl)benzimidazole, 6-(azo)thymine, 2-pyridone, 5-nitroindole, 3-nitropyrrole, 6-(aza)pyrimidine, 2-(amino)purine, 2,6-(diamino)purine, 5-substituted pyrimidine, N2-substituted purine, N6-substituted purine, O6-substituted purine, substituted 1,2,4-triazole, pyrrolopyrimidin-2-one-3-yl, 6-phenyl-pyrrolo-pyrimidin-2-one-3-yl, para-substituted-6-phenyl- Pyrrolo-pyrimidin-2-one-3-yl, ortho-substituted-6-phenyl-pyrrolo-pyrimidin-2-one-3-yl, di-ortho-substituted-6-phenyl-pyrrolo-pyrimidin-2-one-3-yl, p-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-one-3-yl, ortho-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-one-3-yl, di-ortho-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-one-3-yl, pyridopyrimidin-3-yl, 2-oxo-7-amino-pyridopyrimidin-3-yl, 2-oxo-pyridopyrimidin-3-yl, or any O-alkylated or N-alkylated derivative thereof. Alternatively, substituted or modified analogs of any of the above nucleotides or nucleobases can be used in the dsRNAi agents, compositions and methods of the present disclosure.

[0178] In some embodiments, the modified nucleotides disclosed herein include any one or a combination of the following:

[0179] (1) From the 5' end to the 3' end, the nucleotides at positions 2, 4, 12, and 14 of the antisense strand are 2'-fluorinated nucleotides, and the nucleotides at the remaining positions are 2'-O-methyl modified nucleotides;

[0180] (2) in the direction from 5' to 3', the nucleotides at positions 7, 8, and 9 of the sense strand are 2'-fluorinated nucleotides;

[0181] (3) From the 5' end to the 3' end, at least one G in positions 2 to 8 of the antisense strand is replaced by I.

[0182] In some embodiments, the dsRNAi agent further comprises a phosphate or a phosphate mimetic at the 5'-end of the antisense strand. In one embodiment, the phosphate mimetic is 5'-vinyl phosphate (VP).

[0183] In some embodiments, the 5'-end of the antisense strand of the dsRNAi agent does not comprise 5'-vinyl phosphate (VP).

[0184] The end of the dsRNAi reagent of the present disclosure can be modified, and this modification can be at one end or both ends.For example, the 3' and / or 5' ends of dsRNAi can be conjugated to other functional molecular entities, such as labeling moieties, such as fluorophores (such as pyrene, TAMRA, fluorescein, Cy3 or Cy5 dyes) or protecting groups (based on, for example, sulfur, silicon, boron or ester). Functional molecular entities can be connected to sugar by phosphate groups and / or linkers. The terminal atom of the joint can connect or replace the phosphate group of sugar or the connecting atom of C-3', C-5', O, N, S or C groups. Alternatively, the joint can connect or replace the terminal atom of nucleotide substitutes (for example, PNA). When linker / phosphate functional molecular entity-linker / phosphate array is inserted between two chains of double-stranded oligomeric compounds, the array can replace the hairpin loop in hairpin type oligomeric compounds. In some embodiments, end modification can also be used for monitoring distribution, and in this case, the preferred group to be added includes fluorophores, such as fluorescein or Alexa dyes, such as Alexa 488. In some embodiments, terminal modifications may also be used to enhance uptake, and useful modifications for this include targeting ligands.

[0185] The present disclosure also encompasses various salts, mixed salts, and free acid forms of the dsRNAi. In some embodiments, the dsRNAi agent is in free acid form. In some embodiments, the dsRNAi agent is in salt form. In one embodiment, the dsRNAi agent is in sodium salt form. According to common knowledge in the art, when the dsRNAi agent of the present disclosure is in sodium salt form, sodium ions are present in the agent as counterions to the phosphodiester and / or phosphorothioate groups.

[0186] In certain embodiments, the dsRNAi agent of the present disclosure is further modified by covalently linking one or more conjugate groups. Generally speaking, the conjugate group changes one or more properties of the dsRNAi agent of the present disclosure connected, including but not limited to pharmacodynamics, pharmacokinetics, binding, absorption, cell distribution, cellular uptake, charge and removal. Conjugate groups are commonly used in the field of chemistry, and are directly or by optional linking moieties or linking groups connected to the parent compound. Conjugate groups preferably include but not limited to polyamines, polyamides, polyethylene glycols, thioethers, polyethers, cholesterol, thiocholesterol, bile acid moieties, folic acid, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluorescein, rhodamine, coumarin and dye.

[0187] In some embodiments, the targeting ligand of the present disclosure comprises N-acetyl-galactosamine (GalNAc), or a GalNAc derivative, such as L96 (see siRNA drug Inclisiran). More preferably, the targeting ligand is any targeting moiety disclosed in WO2022266753A1. Unless otherwise clearly contradictory, WO2022266753A1 is incorporated herein by reference in its entirety.

[0188] In some embodiments, the structure of the dsRNAi agent is selected from Table A, wherein R 2 is the dsRNA mentioned herein. According to common knowledge in the art, R 2 The dsRNAi agent is formed by conjugating the 3' end or 5' end of the sense strand of the dsRNA to a targeting ligand.

[0189] Table 1: Nucleotide sequences of dsRNA sense and antisense strands

[0190] The antisense strand of the negative control (NC) is ACGUGACACGUUCGGAGAAUU; the positive strand is ACGUGACACGUUCGGAGAAUU.

[0191] The sense and antisense strands of a dsRNA comprising or consisting of a sequence in Table 1 can be modified nucleotides or unmodified nucleotides. In some embodiments, the sense and antisense strands of a dsRNA comprising or consisting of a sequence in Table 1 are all or substantially all modified nucleotides.

[0192] In some embodiments, the antisense strand of a dsRNA disclosed herein differs from any antisense strand sequence in Table 1 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of a dsRNA disclosed herein differs from any sense strand sequence in Table 1 by 0, 1, 2, or 3 nucleotides.

[0193] In some embodiments, the dsRNA sense strand comprises or consists of a modified sequence of any one of the sequences in Table 1. In some embodiments, the dsRNA antisense strand comprises or consists of a modified sequence of any one of the sequences in Table 1.

[0194] The antisense and sense strand nucleotide sequences of certain modified dsRNAs are provided in Table 2. In forming the dsRNA, each of the nucleotides listed in Table 2 above as well as Table 1 can be a modified nucleotide.

[0195] Table 2 provides examples of sense and antisense strands containing modified nucleotides.

[0196] Table 2. dsRNA modified sense and antisense strand nucleotide sequences

[0197] In some embodiments, the antisense strand of a dsRNA disclosed herein differs from any one of the antisense strand sequences in Table 2 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of a dsRNA disclosed herein differs from any one of the sense strand sequences in Table 2 by 0, 1, 2, or 3 nucleotides.

[0198] In some embodiments, the dsRNA antisense strand comprises any one of the antisense strand nucleotide sequences in Table 2. In some embodiments, the dsRNA antisense strand comprises nucleotides (from 5' end → 3' end) 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24 of any sequence in Table 2. In certain embodiments, the dsRNA antisense strand comprises or consists of a modified sequence of any one of the antisense strand sequences in Table 2.

[0199] In some embodiments, the sense strand of the dsRNA comprises any one of the sense strand nucleotide sequences in Table 2. In some embodiments, the sense strand of the dsRNA comprises nucleotides (from 5' end → 3' end) 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24 of any sequence in Table 2. In certain embodiments, the sense strand of the dsRNA comprises or consists of a modified sequence of any one of the sense strand sequences in Table 2.

[0200] In some embodiments, the dsRNA antisense strand comprises any one of the antisense strand nucleotide sequences in Table 2, and the dsRNA sense strand comprises any one of the sense strand nucleotide sequences in Table 2.

[0201] In some embodiments, dsRNA comprises the duplex represented by any one dsRNA ID number presented herein, or is composed of the duplex, or is substantially composed of the duplex. In some embodiments, dsRNA comprises the sense strand and antisense strand nucleotide sequence of any duplex represented by any dsRNA ID number presented herein. In some embodiments, dsRNA comprises the sense strand and antisense strand nucleotide sequence of any duplex represented by any dsRNA ID number presented herein and a targeting group and / or a linking group, wherein the targeting group and / or the linking group are covalently attached (i.e., conjugated) to the sense strand or antisense strand. In some embodiments, dsRNA comprises the sense strand and antisense strand modified nucleotide sequence of any SEQ ID NO presented herein. In some embodiments, dsRNA comprises the sense strand and antisense strand modified nucleotide sequence of any SEQ ID NO presented herein and a targeting group and / or a linking group, wherein the targeting group and / or the linking group are covalently attached to the sense strand or antisense strand.

[0202] In some embodiments, the dsRNA comprises an antisense strand and a sense strand having a nucleotide sequence of any antisense strand / sense strand duplex of Table 1 or Table 2, and further comprises a targeting group. In some embodiments, the dsRNA comprises an antisense strand and a sense strand having a nucleotide sequence of any antisense strand / sense strand duplex of Table 1 or Table 2, and further comprises a biological ligand group for targeted recognition.

[0203] Pharmaceutical compositions and preparations

[0204] The present disclosure also provides a pharmaceutical composition comprising a dsRNA or dsRNA conjugate as described herein, and a pharmaceutically acceptable carrier thereof. In some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents, and / or delivery polymers) are added to the pharmaceutical composition comprising the dsRNA to form a pharmaceutical formulation or pharmaceutical composition suitable for in vivo delivery to a subject (including a human).

[0205] In one embodiment, the dsRNAi agent is administered subcutaneously. In one embodiment, the dsRNAi agent is administered intramuscularly. In one embodiment, the dsRNAi agent is administered intravenously. In one embodiment, the dsRNAi agent is administered by pulmonary system administration, such as intranasal administration or oral inhalation administration.

[0206] As used herein, pharmaceutical compositions comprise a pharmacologically effective amount of at least one of the therapeutic compounds and one or more pharmaceutically acceptable excipients. A pharmaceutically acceptable excipient (excipient) is a substance intentionally included in a drug delivery system in addition to an active pharmaceutical ingredient (API, therapeutic product, e.g., LPA dsRNA). An excipient does not, or is not intended to, exert a therapeutic effect at the intended dose. Excipients may serve the following functions: a) aid in the handling of the drug delivery system during preparation; b) protect, support, or enhance the stability, bioavailability, or patient acceptability of the API; c) aid in product identification; and / or d) enhance any other properties of the overall safety, efficacy, or delivery of the API during storage or use.

[0207] Excipients include, but are not limited to, absorption enhancers, anti-adherents, anti-foaming agents, antioxidants, binders, buffers, carriers, coatings, colorants, delivery enhancers, delivery polymers, detergents, dextran, dextrose, diluents, disintegrants, emulsifiers, bulking agents, fillers, flavorings, glidants, wetting agents, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, surfactants, suspending agents, sustained-release matrices, sweeteners, thickeners, tonicity agents, vehicles, waterproofing agents, and wetting agents.

[0208] In yet another aspect, the present disclosure provides a pharmaceutical combination for inhibiting LPA gene expression, comprising a dsRNA, dsRNA conjugate, or pharmaceutical composition thereof as described herein, and one or more additional therapeutic agents for inhibiting LPA gene expression. In some embodiments, the additional therapeutic agent may be a small molecule drug, an antibody, an antibody fragment, or another dsRNA.

[0209] Delivery and Use of dsRNAi Agents

[0210] The dsRNAi agents of the present invention can be delivered to cells, such as cells in a subject (e.g., a subject with a metabolic disorder) in a variety of ways. For example, delivery can be carried out by contacting cells with the dsRNAi agents of the present invention in vitro or in vivo. In vivo delivery can also be carried out directly by administering a composition (e.g., a pharmaceutical composition) comprising a dsRNAi agent (e.g., dsRNA) to the subject. Alternatively, in vivo delivery can be carried out indirectly by administering one or more vectors that encode and direct the expression of the dsRNAi agent.

[0211] In one embodiment, the cells are liver cells, such as hepatocytes. In one embodiment, the cells are adipocytes. In certain embodiments, the dsRNAi agent is taken up by one or more tissue or cell types present in an organ (e.g., liver, adipose tissue).

[0212] Another aspect of the present disclosure relates to a method for reducing the expression and / or activity of an LPA gene in a subject, comprising administering a dsRNAi agent of the present disclosure to the subject. In some embodiments, the method comprises administering a therapeutically effective amount of a dsRNAi agent of the present disclosure to the subject, thereby inhibiting or reducing the expression of the LPA gene in the subject (e.g., a cell in the subject). In some embodiments, the method comprises contacting a cell with a double-stranded RNAi agent of the present disclosure, such that the expression of the LPA gene is inhibited or reduced in the cell. In some such embodiments, the mRNA transcript of the target gene, such as the LPA gene, is degraded in the subject or cell, thereby inhibiting or reducing the expression of the LPA gene in the subject or cell.

[0213] In another aspect, the present disclosure relates to a method for treating or preventing an LPA-related disease or condition in a subject in need thereof, comprising administering a therapeutically effective amount of a dsRNAi agent to the subject such that the LPA-related disease or condition is treated or prevented. The term "LPA-related disease or condition" includes any disease or condition caused, mediated, or associated with LPA gene expression or protein production, and includes any disease or condition that would benefit from or be ameliorated by a reduction in LPA gene expression or protein activity. Examples of LPA-related diseases or conditions include, but are not limited to, Buerger's disease, peripheral artery disease, coronary artery disease, metabolic syndrome, aortic stenosis, aortic regurgitation, aortic dissection, retinal artery occlusion, cerebrovascular disease, mesenteric ischemia, superior mesenteric artery occlusion, renal artery stenosis, stable / unstable angina, acute coronary syndrome, heterozygous or homozygous familial hypercholesterolemia, hyperlipoprotein betalipoproteinemia, cerebral vascular atherosclerosis, and venous thrombosis. In certain embodiments, the subject is a mammal, including but not limited to a human.

[0214] In some embodiments, the disease or condition comprises a liver-related disease.

[0215] In some embodiments, the disease or condition comprises an inflammatory, cardiovascular, or metabolic disease or condition.

[0216] In this application, the term "metabolic disease or condition" generally refers to a condition characterized by a change or disturbance in metabolic function. "Metabolic" and "metabolism" are terms well known in the art and generally include a full range of biochemical processes occurring within a living organism. Metabolic conditions include, but are not limited to, dyslipidemia caused by hyperglycemia, prediabetes, diabetes (type 1 and type 2), obesity, insulin resistance, metabolic syndrome, and type 2 diabetes.

[0217] As used herein, the term "inflammatory disease or condition" refers to a disease, disease state, syndrome, or other condition that results in inflammation. For example, rheumatoid arthritis and liver fibrosis are inflammatory conditions. Other examples of inflammatory conditions include sepsis, myocardial ischemia / reperfusion injury, adult respiratory distress syndrome, nephritis, transplant rejection, inflammatory bowel disease, multiple sclerosis, arteriosclerosis, atherosclerosis, and vasculitis.

[0218] In the present application, the term "symptoms of cardiovascular and cerebrovascular diseases or conditions" generally refers to phenomena caused by and accompanying cardiovascular and cerebrovascular diseases or conditions, and serves as an indicator of cardiovascular and cerebrovascular diseases or conditions.

[0219] In some embodiments, the subject is a human.

[0220] In some embodiments, the subject has a metabolic disorder.

[0221] In some embodiments of the present disclosure, expression of the LPA gene in a subject or cell reduces LPA protein levels in the serum of the subject by at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95%.

[0222] In some embodiments, inhibiting the expression of the LPA gene in a cell reduces the protein level of the LPA gene expression in the serum of the subject by at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95%.

[0223] In some embodiments of the present disclosure, the dsRNAi agent is administered to a subject at a dose of about 0.01 mg / kg to about 50 mg / kg, or at a dose of about 0.10 mg / kg to about 50 mg / kg, for example, but not limited to, a dose of about 0.01 mg / kg to about 10 mg / kg, about 0.5 mg / kg to about 50 mg / kg, about 10 mg / kg to about 30 mg / kg, about 10 mg / kg to about 20 mg / kg, about 15 mg / kg to about 20 mg / kg, about 15 mg / kg to about 25 mg / kg, about 15 mg / kg to about 30 mg / kg, or about 20 mg / kg to about 30 mg / kg.

[0224] In some embodiments, the dsRNAi agent of the present disclosure is administered by injection or by infusion. In one embodiment, the double-stranded RNAi agent is administered subcutaneously. In one embodiment, the double-stranded RNAi agent is administered intramuscularly. In one embodiment, the double-stranded RNAi agent is administered intravenously. In one embodiment, the double-stranded RNAi agent is administered by systemic administration to the lungs, such as intranasal administration or oral inhalation administration.

[0225] In some embodiments, the pharmaceutical composition comprises a dsRNAi agent of the present invention or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier. The pharmaceutical composition of the present invention can be used in practice for the prevention and / or treatment of various corresponding diseases or conditions. An acceptable carrier (or excipient) is a substance that is intentionally included in a drug delivery system in addition to an active pharmaceutical ingredient (API, therapeutic product, such as a dsRNA agent of the present invention). The carrier or excipient does not or is not intended to exert a therapeutic effect at the intended dose. The carrier or excipient may play the following roles: a) aids in the handling of the drug delivery system during preparation, b) protects, supports or enhances the stability, bioavailability or patient acceptability of the API; c) aids in product identification; and / or d) enhances any other properties of the overall safety, efficacy or delivery of the API during storage or use.

[0226] Carriers or excipients include, but are not limited to, the following components: absorption enhancers, anti-adherents, anti-foaming agents, antioxidants, binders, buffers, carriers, coatings, colorants, delivery enhancers, delivery polymers, detergents, dextran, dextrose, diluents, disintegrants, emulsifiers, expanders, fillers, flavorings, glidants, wetting agents, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, surfactants, suspending agents, sustained-release matrices, sweeteners, thickeners, tonicity agents, vehicles, waterproofing agents, and wetting agents.

[0227] In some embodiments, the carrier of the pharmaceutical composition is a non-buffered solution or a buffered solution. Typical non-buffered solutions are saline or water, and buffered solutions include one or more of acetate, citrate, prolamin, carbonate, and phosphate. In some embodiments, the buffered solution is phosphate buffered saline (PBS).

[0228] The present disclosure includes all combinations of the specific embodiments described. Further embodiments of the present disclosure and the full scope of applicability will become apparent from the detailed description provided below. However, it should be understood that although the detailed description and specific examples indicate preferred embodiments of the present disclosure, these descriptions and examples are provided by way of illustration only, as various changes and modifications within the spirit and scope of the present disclosure will become apparent to those skilled in the art from this detailed description. All publications, patents, and patent applications cited herein, including citations, are incorporated herein by reference in their entirety for all purposes.

[0229] The compounds disclosed herein can be prepared by a variety of synthetic methods well known to those skilled in the art, including the specific embodiments listed below, embodiments formed by combining the specific embodiments with other methods, and equivalent replacement methods well known to those skilled in the art. Preferred embodiments include but are not limited to the examples disclosed herein.

[0230] Example

[0231] The present invention is illustrated by the following examples, but is not intended to be limiting thereof. The present invention has been described in detail herein, and specific embodiments thereof are disclosed. It will be apparent to those skilled in the art that various changes and modifications can be made to the specific embodiments of the present invention without departing from the spirit and scope of the invention.

[0232] Example 1: dsRNA synthesis

[0233] 1.1 Target sequence screening

[0234] dsRNA was designed based on the full LPA mRNA sequence, all sequences of which were obtained from the NCBI gene database (https: / / www.ncbi.nlm.nih.gov / gene / ). All dsRNA designs were guaranteed to be identical to human (Gene ID: 4018) and cynomolgus macaque (Gene ID: 101865897) sequences.

[0235] The entire sequence was scanned to obtain all potential 19-nucleotide dsRNA sequences, which were then compared to the cynomolgus macaque sequence to ensure a match. All human / cynomolgus macaque sequences were then BLAST-aligned against the human full transcriptome mRNA sequence, and any dsRNAs with potential off-target effects were removed. The activity of all dsRNAs was evaluated using rational dsRNA design principles, and molecules with low theoretical activity were removed.

[0236] 1.2 dsRNA synthesis

[0237] dsRNAs were designed for different regions of LPA and synthesized and annealed by Suzhou Beixin Biotechnology Co., Ltd. The sequences in Table 1 and LPA-570 to LPA-880 were synthesized with two additional nucleotides complementary to the mRNA or two dTs (i.e., dTdT) added to the 3' end of the antisense strand for in vitro activity assays.

[0238] 1.3 dsRNAi synthesis

[0239] Using the GalNAc-coupled immobilization (CPG or PS) in Formulas 1-33 in Table A, fully modified siRNAs were designed according to the original sequence and synthesized and annealed by Suzhou Beixin Biotechnology Co., Ltd. The sequence in this application used the GalNAc-coupled immobilization of Formula 5.

[0240] The synthesis of the targeting ligands in Formula 1 to Formula 33 refers to WO2022266753A1.

[0241] Example 2: In vitro activity detection

[0242] 2.1 Fluorescence quantitative PCR

[0243] 2.1.1 Cell culture and transfection

[0244] Huh7 cells (ATCC) were cultured in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum (FBS, Gibco) and a double-stranded antibody (Gibco) in an atmosphere of 5% CO₂ at 37°C. Once cells had grown to nearly complete coverage of the culture flask, they were trypsinized and resuspended. The resuspended cells were seeded at a density of 3×4 cells / well in a 96-well plate and then dsRNA transfection complexes were added to the suspension. The dsRNA transfection complexes consisted of a 1:1 mixture of Opti-MEM (Gibco) containing 0.3 μl / well of Lipofectamine 3000 (Thermo) and the dsRNA mixture. After 48 hours of cell culture, total mRNA was extracted using the Dynabeads™ mRNA Isolation Kit (Thermo) according to the manufacturer's instructions. Heating was performed on a BIO-RAD T100 Thermal Cycler.

[0245] 2.1.2 cDNA reverse transcription

[0246] cDNA synthesis was performed using the Vazyme Reverse Transcription Kit. mRNA obtained in Example 2.1.1 was added and the volume was adjusted to 20 μl using RNase-free HO. The PCR reaction was then completed using a BIO-RAD T100 Thermal Cycler. After completion, the reaction was stored at 4°C.

[0247] The sequences of NC, Ref1-Ref2, NCm, and Ref1m-Ref3m are shown in Table 3. Ref1mg or Ref2mg used in subsequent experiments represent the structures of the control compounds Ref1m and Ref2m, respectively, linked to their ligands. The specific structure of Ref1mg is described in WO2019092283A1; the specific structure of Ref2mg is described in WO2017059223A2.

[0248] Table 3: Sequences of NC, Ref1-Ref2, NCm and Ref1m-Ref3m

[0249] 2.1.3 Fluorescence quantitative PCR

[0250] The relative mRNA levels of LPA and GAPDH (glyceraldehyde-3-phosphate dehydrogenase) were detected using the SYBR green method (TIANGEN) using the ΔΔCt method. The instrument used was the LightCycler 480II (Roche) fluorescence quantitative system. The reaction conditions were: (1) 50°C, 15 minutes; (2) pre-denaturation at 95°C, 15 minutes; (3) denaturation at 95°C, 10 seconds, annealing and extension at 60°C, 30 seconds. Step (3) was repeated for 40 cycles. The results were normalized with the negative control to obtain the relative mRNA levels and knockdown efficiency. If IC50 was required, it was obtained by four-parameter fitting using Graphpad Prism.

[0251] 2.2 Reporter gene method

[0252] 2.2.1 Transient cell line reporter gene method

[0253] HEK293 cells (ATCC) were cultured in DMEM (Gibco) supplemented with 10% fetal bovine serum (FBS, Gibco) and a double-antibody (Gibco) in a 5% CO2, 37°C atmosphere. Once the cells had grown to nearly completely cover the culture flask, they were trypsinized and resuspended. The resuspended cells were adjusted in density and seeded at 3e4 / well in a 96-well plate. The dsRNA and psiCheck-LPA plasmid transfection complex was then added to the suspension. The dsRNA and psiCheck-2-LPA plasmid transfection complex was prepared by mixing the dsRNA and psiCheck-LPA plasmid mixture in a 1:1 ratio with Opti-MEM (Gibco) containing 0.3 μl / well of Lipofectamine 3000 (Thermo). After a certain period of cell culture, add a volume of Duo-Lite Luciferase Detection Reagent (Vazyme) equal to the volume of the test cell culture to detect firefly luciferase luminescence. Then, add a volume of Duo-Lite Stop&Lite Detection Reagent equal to the volume of the original test cell culture to detect Renilla luciferase luminescence. NC represents a negative control, and Vehicle represents a blank control.

[0254] The above dsRNA was tested in two batches. The test results are shown in Tables 4 and 5.

[0255] Table 4. Inhibition rate of the first batch

[0256] Table 5. Inhibition rate of the second batch

[0257] 2.2.2 Stable cell line reporter gene method

[0258] HEK293-psiCheck-LPA cells contain a tandem expression system for the LPA gene sequence and the luciferase gene. Cells were cultured in DMEM (Gibco) supplemented with 10% FBS (Gibco), 1 μg / ml puromycin, and a double-antibody (Gibco) at 5% CO2 and 37°C. When the cells grew to nearly completely cover the culture flask, they were trypsinized and resuspended. The resuspended cells were adjusted in density and seeded into 96-well plates at 3e4 / well, followed by the addition of a dsRNA transfection complex. The dsRNA transfection complex consisted of a 1:1 mixture of Opti-MEM (Gibco) containing 0.3 μl / well liposomal RNAiMAX (Thermo) and dsRNA. After 48 hours of cell culture, the cells were lysed and Luciferase Substrate (Vazyme) was added, followed by the addition of Renilla substrate working solution. After rapid mixing, fluorescence activity was detected. The results are shown in Figures 1A-2H and Tables 6-9.

[0259] Table 6. Describes the IC50 and Imax% of 12 dsRNAs from two independent experiments, where Ref2m was used as a control in each independent experiment.

[0260] Table 7. Describes the IC50 and Imax% for 6 dsRNAs, where Ref2m was selected as a control group.

[0261] Table 8. Describes the IC50 and Imax% for 22 dsRNAs, where Ref2m was selected as a control group.

[0262] Table 9 describes the IC50 and Imax% for three dsRNAs, in which Ref2m and Ref2mg were selected as control groups.

[0263] Table 10. Activities of selected dsRNA-g, wherein the nucleotides of the present application are coupled in the manner of conjugate 5 in Table A;

[0264] Table 11. Activities of selected dsRNA-g, wherein the nucleotides of the present application are coupled in the manner of conjugate 5 in Table A;

[0265] Example 3: Stem-loop PCR

[0266] 3.1 Stem-loop PCR

[0267] The stem-loop method has been widely used to detect the absolute concentration of dsRNA and miRNA (Curr Protoc Mol Biol. 2011 Jul; Chapter 15: Unit 15.10.). Corresponding stem-loop primers are designed for different dsRNAs. After reverse transcription using these primers instead of oligo dT, the dsRNA concentration is calculated using a standard curve using a fluorescent quantitative PCR method. Reverse transcription (TIANGEN): (1) Sample pretreatment: 1) 85°C, 5 minutes; 2) 60°C, 5 minutes; (2) Reverse transcription: Prepare the reaction system according to the conditions described in the kit and complete reverse transcription; (3) Perform fluorescent quantitative PCR using the TIANGEN SYBR green kit. The reverse transcription process was completed using a BIO-RAD T100 Thermal Cycler PCR instrument, and the fluorescent quantitative PCR was completed using a Roche LC480.

[0268] 3.2 dsRNA stability testing

[0269] 3.2.1 Serum stability

[0270] Dilute dsRNA to 2uM and dilute siRNA to 100nM using FBS (Gibco, fetal bovine serum), with an FBS ratio of ≥90%, and mark it as zero point; (2) Pipette 10ul from zero point into a new tube, mark the corresponding time point, and incubate at 37°C; (3) Take out the corresponding sample according to the incubation time, quickly freeze it in liquid nitrogen prepared in advance, and then store the sample at -80°C. Mix the sample before use, use the zero point group sample gradient dilution as the standard curve, and then use the 3.1Stem-loop PCR method for detection.

[0271] GraphPad Prism software was used to perform a linear fit of the Ct values ​​obtained by PCR with different concentrations of the standard sample to generate a standard curve corresponding to the Ct value. The Ct values ​​of the samples at each incubation time point were then back-calculated from the standard curve to determine the siRNA concentration in the samples. The sample concentrations at each time point were normalized to the concentration of the sample at 0 h, and the percentage of residual siRNA concentration at each time point relative to the 0 h concentration was calculated. The results of the siRNA serum stability test are shown in Figure 3A.

[0272] 3.2.2 Human liver microsome stability

[0273] (1) Dilute siRNA using human liver S9 (BioIVT); (2) Pipette 10 μl of the sample from the zero time point into a new tube, mark the corresponding time point, and incubate at 37°C; (3) Remove the corresponding sample according to the incubation time and quickly freeze it in liquid nitrogen prepared in advance. The sample was then stored at -80°C and subsequently detected using the 3.1 Stem-loop PCR method.

[0274] GraphPad Prism software was used to perform a linear fit of the Ct values ​​obtained by PCR with different concentrations of the standard sample to generate a standard curve corresponding to the Ct value. The Ct values ​​of the samples at each incubation time point were then back-calculated from the standard curve to determine the siRNA concentration in the samples. The sample concentrations at each time point were normalized to the concentration of the sample at 0 h, and the percentage of residual siRNA concentration at each time point relative to the 0 h concentration was calculated. The results of the siRNA stability test in human liver microsomes are shown in Figure 3B.

[0275] Example 4: dsRNA pharmacokinetic detection method

[0276] 4.1 Pharmacokinetics of dsRNA Drugs in Plasma

[0277] Blood was collected from mice at different times after administration. Appropriate amounts of plasma were collected and the dsRNA content in the plasma was detected using the aforementioned Stem-loop PCR method. The dsRNA concentration in the plasma of the mice in the administration group was obtained by back-calculation based on the standard curve.

[0278] 4.2 Pharmacokinetics of dsRNA Drugs in the Liver

[0279] Liver tissue was harvested from mice at various times after dosing. The liver tissue was weighed and homogenized in PBS at 4°C using a homogenizer (Shanghai Jingxin JXFSTPRP-64). dsRNA content in the liver homogenates was determined using Stem-loop PCR. dsRNA concentrations in the liver tissues of the treated mice were calculated using a standard curve.

[0280] The experimental results show that the dsRNA in this application has good stability in mouse plasma and liver.

[0281] Example 5: In vivo efficacy of LPA dsRNA in mice

[0282] In order to evaluate the effect of dsRNA on the in vivo activity of LPA, male LPA humanized mice were used for in vivo activity detection. Pre-dose serum samples were obtained after a 4-hour fast on day -1. The above-mentioned dsRNA conjugate was diluted with normal saline and injected subcutaneously on day 1 according to the experimental design. Blank normal saline was used as a negative control. Plasma was collected after a 4-hour fast on days 1, 3, 7, 14, 21, 28, 35, 42, and 49. The LPA protein level in plasma was detected by ELISA (Abcam) according to the experimental protocol provided by the supplier. The LPA level and blood lipid index in serum were detected using a fully automatic biochemical analyzer and handed over to Shanghai Biyuntian Biotechnology Co., Ltd. for testing.

[0283] LPA protein levels and lipid profiles were normalized for each animal. Normalization was performed by dividing each animal's LPA protein, insulin, blood glucose, and lipid profiles at a given time point by their pre-treatment levels (in this case, day -1) to determine a "normalized to pre-treatment" ratio. Expression at a specific time point was then normalized to the saline group by dividing the "normalized to pre-treatment" ratio for each individual animal by the average "normalized to pre-treatment" ratio for all mice in the saline group.

[0284] Example 6: In vivo efficacy of LPA dsRNA in healthy cynomolgus monkeys

[0285] To evaluate the in vivo activity of dsRNA against LPA, in vivo activity assays were performed using healthy cynomolgus monkeys. Pre-dose serum samples were obtained on days -7 and -14 after a 4-hour fast. The dsRNA conjugate was diluted with saline and subcutaneously injected on day 1 according to the experimental design. Blank saline was used as a negative control. Plasma was collected after a 4-hour fast on days 3, 7, 14, 28, 42, 56, 70, and 84. The LPA protein level in plasma was detected by ELISA (Abcam) according to the experimental procedures provided by the supplier. Lp(a), triglycerides, total cholesterol, high-density lipoprotein cholesterol (HDL-c), low-density lipoprotein cholesterol (LDL-c), Apo-A1, and Apo-B in serum were detected using an automatic biochemical analyzer.

[0286] LPA protein levels, Lp(a) levels, triglyceride levels, total cholesterol levels, HDL-c levels, and LDL-c levels were normalized for each animal. For normalization, the LPA protein level for each animal at a time point was divided by the animal's pre-treatment expression level (the average of the pre-experimental samples from that group) to determine a "normalized to pre-treatment" expression ratio. Expression at a specific time point was then normalized to the saline group by dividing the "normalized to pre-treatment" ratio for the individual animal by the average "normalized to pre-treatment" ratio for all mice in the saline group.

[0287] Although the present invention has been described in detail with reference to the embodiments of the present invention, these embodiments are provided to illustrate rather than limit the present invention. Other embodiments that can be obtained according to the principles of the present invention all fall within the scope defined by the claims of the present invention.

Claims

1. A double-stranded ribonucleic acid (dsRNA) for inhibiting LPA expression, the dsRNA comprising a sense strand and an antisense strand, the antisense strand comprising a complementary region to an LPA mRNA target sequence, wherein the sense strand and the antisense strand form a duplex region; in, The antisense strand comprises at least 17 consecutive nucleotides that differ from any of the sequences shown in Table 1 or Table 2 by 0, 1, 2 or 3 nucleotides.

2. The dsRNA according to claim 1, wherein The antisense strand is 17 to 25 nucleotides in length.

3. The dsRNA according to claim 1 or 2, wherein The antisense strand is 19 to 23 nucleotides in length.

4. The dsRNA according to any one of claims 1 to 3, wherein The antisense strand is 21 nucleotides in length, and wherein the antisense strand and the sense strand form a duplex region of at least 19 nucleotides in length.

5. The dsRNA according to any one of claims 1 to 4, wherein The duplex region is 19 base pairs in length.

6. The dsRNA according to any one of claims 1 to 5, wherein at least one strand comprises a 3' overhang of at least 1 nucleotide or 2 nucleotides.

7. The dsRNA according to any one of claims 1 to 6, wherein The antisense strand and the sense strand comprise at least one modified nucleotide, preferably the modification is selected from: 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy nucleotides, 2'-methoxyethyl modified nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, 2'-alkoxy modified nucleotides, 2'-F-arabino nucleotides, 5'-vinyl phosphite modified nucleotides, phosphorothioate modified nucleotides, abasic nucleotides, morpholino nucleotides, locked nucleotides, inverted nucleotides and non-canonical base pairing modifications.

8. The dsRNA according to claim 7, wherein The modified nucleotides are selected from the group consisting of 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy nucleotides and phosphorothioate modified nucleotides.

9. The dsRNA according to claim 8, wherein The modified nucleotides include one or a combination of the following: (1) The antisense strand contains at least 5 2'-fluoro modified nucleotides or 5 2'-deoxy modified nucleotides, and the remaining sites are 2'-O-methyl modified nucleotides; (2) In the antisense strand, positions 2, 5, 7, and 12 are 2'-deoxy modified nucleotides, position 14 is a 2'-fluoro modified nucleotide, positions 9 and 16 contain 0, 1, and 2 2'-fluoro modified nucleotides, and the remaining positions are 2'-O-methyl modified nucleotides; (3) the first position of the antisense strand is a 5′-vinylphosphite-modified nucleotide; (4) the sense strand contains more than three 2′-fluorinated nucleotides at positions 7, 8, 9, and 10; (5) In the direction from the 5' end to the 3' end, at least one or two of the three nucleotides at the 5' end of the sense strand are phosphorothioate modified nucleotides; and / or at least one or two of the three nucleotides at the 5' end and the 3' end of the antisense strand are phosphorothioate modified nucleotides, respectively; and / or (6) From the 5' end to the 3' end, at least one G in positions 2 to 8 of the antisense strand is replaced by I.

10. The dsRNA according to claim 7, wherein The non-canonical base pairing modification uses bases of natural rare nucleotides, preferably the natural rare nucleotides are bases in inosine and pseudouracil.

11. The dsRNA according to claim 10, wherein The non-canonical base pairing modification is located at positions 2-8 from the 5' end of the antisense strand.

12. The dsRNA according to any one of claims 1 to 11, wherein The antisense strand comprises any one of the antisense strand nucleotide sequences shown in Table 2, and the sense strand comprises any one of the sense strand nucleotide sequences shown in Table 2.

13. The dsRNA according to claim 12, wherein The sense strand comprises a nucleotide sequence selected from SEQ ID NO 330, 332, 334, 336, 338, 340, 342, 344, 346, 348, 350, 352 or 354, and the antisense strand comprises a nucleotide sequence selected from SEQ ID NO 329, 331, 333, 335, 337, 339, 341, 343, 345, 347, 349, 351 or 353; or, The sense strand comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 414, 416, 418, 420, 422, 424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452, 454, 456, 458, 460, 462, 464, 466 or 468, and the antisense strand comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 413, 415, 417, 419, 421, 423, 425, 427, 429, 431, 433, 435, 437, 439, 441, 443, 445, 447, 449, 451, 453, 457, 459, 461, 463 or 465; or The sense strand comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1082, 1084, 1086, 1088, 1090, 1092, 1094, 1096, 1098, 1100, 1102, 1104, 1106, 1108, 1110 or 1112, and the antisense strand comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109 or 1111; or The sense strand comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1666, 1670, 1674, 1676, 1678, 1680, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1706, 1708, 1710, 1712, 1714, 1716, 1718, 1720, 1722, 1724, 1726, 1728, 1730, 1732, 1734, 1736, 1738 or 1740, and the antisense strand comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: The nucleotide sequence shown in 1665, 1669, 1673, 1675, 1677, 1679, 1681, 1683, 1685, 1687, 1689, 1691, 1693, 1695, 1697, 1699, 1701, 1703, 1705, 1707, 1709, 1711, 1713, 1715, 1717, 1719, 1721, 1723, 1725, 1727, 1729, 1731, 1733, 1735, 1737 or 1739. 14 . A dsRNA conjugate, the dsRNA conjugate being conjugated with the dsRNA according to claim 1 and a ligand group, wherein the ligand group is attached to the 3′ end of the sense strand of the dsRNA.

15. The dsRNA conjugate according to claim 14, wherein the ligand group is conjugated with a bivalent compound and N-acetyl-galactosamine (GalNAc).

16. The dsRNA conjugate of claim 14, wherein the ligand group is:

17. A dsRNA conjugate selected from Table A, wherein R 2 The dsRNA selected from any one of claims 1-13.

18. A pharmaceutical composition comprising the dsRNA as claimed in any one of claims 1 to 13 or the dsRNA conjugate as claimed in any one of claims 14 to 17, an isomer thereof or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

19. Use of the dsRNA according to any one of claims 1 to 13, the dsRNA conjugate according to any one of claims 14 to 17, its isomer or pharmaceutically acceptable salt thereof, or the pharmaceutical composition according to claim 18 in the preparation of a medicament for treating and / or preventing LPA-mediated diseases or disorders.

20. The use according to claim 19, wherein The diseases or conditions include Bergey's disease, metabolic syndrome, aortic regurgitation, aortic dissection, retinal artery occlusion, mesenteric ischemia, superior mesenteric artery occlusion, renal artery stenosis, stable / unstable angina, heterozygous or homozygous familial hypercholesterolemia, hyperlipoproteinemia, cerebrovascular atherosclerosis, cerebrovascular disease and venous thrombosis, coronary artery disease, congestive heart failure, ischemic heart disease, carotid artery disease, peripheral artery disease, myocardial infarction, stroke, aortic stenosis, atrial fibrillation, heart failure, hyperlipidemia; type 2 diabetes, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis (NASH).