A pharmaceutical composition and use

Abstract

The application provides a pharmaceutical composition and use. The pharmaceutical composition comprises tryptophan, salicylic acid and protocatechuic acid; the mass percentage of tryptophan is 1% to 1.5%, the mass percentage of salicylic acid is 0.4% to 0.6%, and the mass percentage of protocatechuic acid is 97.9% to 98.6% based on the mass of the pharmaceutical composition. The application first combines tryptophan, salicylic acid and protocatechuic acid in a specific manner, and uses a leading human lung organoid model to confirm the novel therapeutic effect of the pharmaceutical composition in resisting respiratory syncytial virus infection, which provides direct and feasible formula basis for developing modern traditional Chinese medicine or natural medicine with clear components and controllable quality.

Description

Technical Field

[0001] This application relates to the field of biotechnology, and in particular to a pharmaceutical composition and its use. Background Technology

[0002] Respiratory syncytial virus (RSV) is a major pathogen causing lower respiratory tract infections (such as bronchiolitis and pneumonia) in infants, the elderly, and immunocompromised individuals. There is currently no specific treatment.

[0003] Currently, clinical interventions for RSV infection mainly include chemotherapy, biologics, and supportive therapy, but all have significant limitations and cannot meet ideal clinical needs. Chemotherapy has drawbacks such as limited efficacy and prominent side effects. For example, ribavirin, a broad-spectrum nucleoside analog, has controversial anti-RSV activity; clinical studies have shown its efficacy to be uncertain, and it may cause serious side effects such as hemolytic anemia and teratogenicity. It is usually only used for severely immunosuppressed patients, limiting its routine use in infants and other patients. While other small-molecule drugs have seen approval or enter clinical trials in recent years for inhibitors targeting RSV fusion proteins (such as palizumab, but a biologic) and polymerase inhibitors (such as retissavir), they generally carry the risk of viral resistance mutations, and their high cost and specific administration methods (such as intravenous injection) affect their accessibility. The disadvantages of biologics lie in their high cost and the limitations of passive immunization. For example, palizumab and nisevizumab are both monoclonal antibodies that provide protection through passive immunization. Their main drawbacks are: extremely high price; only for prevention in high-risk infants, unable to treat existing infections; and limited protection period, requiring monthly or annual re-administration. The disadvantages of supportive therapy and vaccines lie in the lack of fundamental treatment options. Currently, for most children infected with RSV, supportive therapy mainly involves oxygen therapy, fluid replacement, and sputum suction, providing only symptomatic relief and unable to directly inhibit viral replication or shorten the course of the disease. While vaccines for the elderly have been approved, safe and effective vaccines for infants and young children are not yet fully realized, and the long-term protective effects and widespread vaccination strategies are still under investigation.

[0004] Therefore, there is an urgent need in the field of RSV prevention and treatment for highly effective, low-toxicity, low-cost therapeutic drugs that are suitable for a wide range of patients. Summary of the Invention

[0005] The purpose of this application is to provide a pharmaceutical composition and its use for the prevention and / or treatment of RSV infection. The specific technical solution is as follows:

[0006] The first aspect of this application provides a pharmaceutical composition comprising tryptophan, salicylic acid, and protocatechuic acid; based on the mass of the pharmaceutical composition, the mass percentage of tryptophan is 1% to 1.5%, the mass percentage of salicylic acid is 0.4% to 0.6%, and the mass percentage of protocatechuic acid is 97.9% to 98.6%.

[0007] In one embodiment of this application, based on the mass of the pharmaceutical composition, the mass percentage of tryptophan is 1.16% to 1.47%, the mass percentage of salicylic acid is 0.49% to 0.54%, and the mass percentage of protocatechuic acid is 98% to 98.35%.

[0008] In one embodiment of this application, the mass ratio of tryptophan, salicylic acid and protocatechuic acid is 0.010~0.015:0.004~0.006:1.

[0009] In one embodiment of this application, the pharmaceutical composition further includes a pharmaceutically acceptable carrier or excipient.

[0010] In one embodiment of this application, the pharmaceutically acceptable carrier or excipient includes at least one of solvents, diluents, dispersants, suspending agents, surfactants, isotonic agents, thickeners, emulsifiers, preservatives, binders, lubricants, stabilizers, hydrating agents, emulsification accelerators, buffers, absorbents, colorants, flavorings, sweeteners, ion exchangers, release agents, coating agents, flavoring agents, and antioxidants.

[0011] In one embodiment of this application, the pharmaceutical composition is formulated as any one of the following dosage forms: powder, tablet, capsule, pill, emulsion, suspension, or tincture.

[0012] The second aspect of this application provides the use of the pharmaceutical composition described in the first aspect of this application in the preparation of a medicament for the prevention and / or treatment of RSV infection.

[0013] In one embodiment of this application, the RSV infection includes at least one of the following: fever, rhinitis, pharyngitis, laryngitis, bronchitis, bronchiolitis, and viral pneumonia caused by RSV infection.

[0014] The beneficial effects of this application are:

[0015] This application provides a pharmaceutical composition comprising tryptophan, salicylic acid, and protocatechuic acid. Based on the mass of the pharmaceutical composition, the mass percentage of tryptophan is 1%–1.5%, the mass percentage of salicylic acid is 0.4%–0.6%, and the mass percentage of protocatechuic acid is 97.9%–98.6%. This application is the first to use a specific combination of tryptophan, salicylic acid, and protocatechuic acid as the core active ingredient of a pharmaceutical composition, and to limit the content of the three to the above-mentioned ranges, which can achieve a good anti-RSV infection effect. Furthermore, the tryptophan, salicylic acid, and protocatechuic acid contained in the pharmaceutical composition of this application can all be derived from natural products, have good safety potential, and are low in cost. The pharmaceutical composition of this application has clearly defined active ingredients and fixed contents, providing a direct and feasible formulation basis for developing modern traditional Chinese medicine or natural drugs with clear components and controllable quality.

[0016] Furthermore, this application also provides the use of the pharmaceutical composition in the preparation of medicaments for the prevention and / or treatment of RSV infection. Using a human lung organoid model, this application verifies that the pharmaceutical composition of this application can significantly reduce the expression level of RSV viral F protein in human lung organoids, upregulate the expression of type I interferon (IFN-α and IFN-β), downregulate the levels of inflammatory factors IL-6 and TNF-α, alleviate swelling and fusion in human lung organoids, and significantly improve tissue damage caused by RSV infection, thereby enabling its use in the preparation of medicaments for the prevention and / or treatment of RSV infection.

[0017] Of course, implementing any product or method of this application does not necessarily require achieving all of the advantages described above at the same time. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of this application, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of this application. For those skilled in the art, other embodiments can be obtained based on these accompanying drawings.

[0019] Figure 1 This application demonstrates the effect of the pharmaceutical composition of this application on the relative expression level of RSV virus fusion protein (F protein) mRNA in human lung organoids;

[0020] Figure 2 The effect of the pharmaceutical composition of this application on the content of interferon-alpha (IFN-α) is shown;

[0021] Figure 3 The effect of the pharmaceutical composition of this application on the content of β-interferon (IFN-β) is shown;

[0022] Figure 4The effect of the pharmaceutical composition of this application on the level of interleukin-6 (IL-6) is shown;

[0023] Figure 5 The effect of the pharmaceutical composition of this application on the content of tumor necrosis factor α (TNF-α) was demonstrated;

[0024] Figure 6 The effects of the pharmaceutical composition of this application on the morphology of human lung organoids are shown;

[0025] Figure 7 The effect of the pharmaceutical composition of this application on the average area of ​​non-fused human lung organoids is shown;

[0026] Figure 8 This demonstrates the effect of the pharmaceutical composition of this application on the degree of fusion of fused human lung organoids. Detailed Implementation

[0027] The technical solutions of this application will be clearly and completely described below with reference to the embodiments and accompanying drawings. Obviously, the described embodiments are only some embodiments of this application, and not all embodiments. All other embodiments obtained by those skilled in the art based on this application are within the scope of protection of this application.

[0028] A first aspect of this application provides a pharmaceutical composition comprising tryptophan, salicylic acid, and protocatechuic acid; based on the mass of the pharmaceutical composition, the mass percentage of tryptophan is 1% to 1.5%, the mass percentage of salicylic acid is 0.4% to 0.6%, and the mass percentage of protocatechuic acid is 97.9% to 98.6%. Preferably, based on the mass of the pharmaceutical composition, the mass percentage of tryptophan is 1.16% to 1.47%, the mass percentage of salicylic acid is 0.49% to 0.54%, and the mass percentage of protocatechuic acid is 98% to 98.35%.

[0029] In this application, based on the mass of the pharmaceutical composition, the mass percentage of tryptophan can be 1%, 1.05%, 1.1%, 1.15%, 1.2%, 1.25%, 1.3%, 1.35%, 1.4%, 1.45%, 1.5%, or any two of these values; the mass percentage of salicylic acid can be 0.4%, 0.45%, 0.5%, 0.55%, 0.6%, or any two of these values; and the mass percentage of protocatechuic acid can be 97.9%, 98%, 98.05%, 98.1%, 98.15%, 98.2%, 98.25%, 98.3%, 98.35%, 98.4%, 98.45%, 98.5%, 98.55%, 98.6%, or any two of these values.

[0030] The inventors discovered in their research that using a specific combination of tryptophan, salicylic acid, and protocatechuic acid as the core active ingredients in a pharmaceutical composition, and limiting the content of these three components within the aforementioned range, can achieve a good anti-RSV infection effect. When the content of tryptophan, salicylic acid, and protocatechuic acid is outside the aforementioned range, it has no anti-RSV infection effect, or its anti-RSV infection effect is very small.

[0031] The pharmaceutical composition of this application has clearly defined active ingredients and fixed content, providing a direct and feasible formulation basis for developing modern Chinese medicine or natural medicine with clear ingredients and controllable quality.

[0032] In one embodiment of this application, the mass ratio of tryptophan, salicylic acid, and protocatechuic acid is 0.010~0.015:0.004~0.006:1. The inventors have found that a mass ratio of tryptophan, salicylic acid, and protocatechuic acid within the above range exhibits better anti-RSV infection activity.

[0033] In one embodiment of this application, the pharmaceutical composition further includes a pharmaceutically acceptable carrier or excipient.

[0034] In this application, the "pharmaceutically acceptable carrier or excipient" used in the pharmaceutical composition can be any conventional carrier in the field of pharmaceutical formulation, and the choice of a specific carrier will depend on the route of administration or the type and state of disease for treating a particular patient. Methods for preparing suitable pharmaceutical compositions for a specific route of administration are entirely within the knowledge of those skilled in the art of pharmaceutical work.

[0035] In one embodiment of this application, the pharmaceutically acceptable carrier or excipient includes at least one of solvents, diluents, dispersants, suspending agents, surfactants, isotonic agents, thickeners, emulsifiers, preservatives, binders, lubricants, stabilizers, hydrating agents, emulsification accelerators, buffers, absorbents, colorants, flavorings, sweeteners, ion exchangers, release agents, coating agents, flavoring agents, and antioxidants.

[0036] In this application, "pharmaceutical composition" has its general meaning. Furthermore, the "pharmaceutical composition" of this application may also exist or be provided in the form of health products, functional foods, foods, food additives, etc. The active ingredients of the raw materials for the pharmaceutical composition of this application can be obtained using conventional techniques in the pharmaceutical field, particularly in the formulation field, through extraction, separation, and purification methods commonly used in pharmaceutical production. These ingredients are optionally mixed with one or more pharmaceutically acceptable carriers or excipients to form the desired dosage form, thereby preparing the pharmaceutical composition of this application. According to this application, the pharmaceutical composition can be a pharmaceutical preparation suitable for oral administration, a pharmaceutical preparation suitable for parenteral injection (e.g., intravenous injection, subcutaneous injection) (e.g., a solution), a pharmaceutical preparation suitable for topical administration (e.g., an ointment, patch, or cream), or a pharmaceutical preparation suitable for rectal administration (e.g., a suppository), etc. Dosage forms for oral administration may include, for example, tablets, pills, hard capsules or soft capsules, solutions, suspensions, emulsions, tinctures, syrups, powders, fine granules, pellets, small pills, elixirs, etc., and are not limited thereto. In addition to the active ingredient, these formulations may also contain diluents (e.g., lactose, dextrose, sucrose, mannitol, sorbitol, cellulose, and glycine), lubricants (e.g., silica, talc, stearic acid or its magnesium and calcium salts, and polyethylene glycol). Tablets may also contain binders such as magnesium aluminum silicate, starch paste, gelatin, astragalus gum, methylcellulose, sodium carboxymethyl cellulose, and polyvinylpyrrolidone. Where necessary, they may also contain pharmaceutical additives such as disintegrants (e.g., starch, agar, alginate or its sodium salt), absorbents, colorants, flavorings, sweeteners, etc. Tablets can be prepared using commonly used mixing, granulation, or coating methods.

[0037] In one embodiment of this application, the pharmaceutical composition is formulated as any one of the following dosage forms: powder, tablet, capsule, pill, emulsion, suspension, or tincture.

[0038] The dosage of the pharmaceutical composition used in this application is not particularly limited and may be varied depending on the age, sex, and weight of the patient to be treated, the specific disease or pathological condition to be treated, the severity of the disease or pathological condition, the route of administration, and the judgment of the diagnostician. The dosage determined taking these factors into account is within the range of expertise of someone skilled in the art.

[0039] The second aspect of this application provides the use of the pharmaceutical composition described in the first aspect of this application in the preparation of a medicament for the prevention and / or treatment of RSV infection.

[0040] In this application, the term "treatment" has its general meaning, and specifically refers to the treatment of a mammalian individual (preferably a human) already suffering from RSV with the drug of this application, with the aim of producing a therapeutic, curative, alleviating, or reducing effect on the disease. Similarly, the term "prevention" as used in this application has its general meaning, and specifically refers to the treatment of a mammalian individual who may be at risk of contracting RSV with the drug of this application, with the aim of producing a preventative, preventative, blocking, or isolating effect on the disease.

[0041] In this application, using a human lung organoid model, it was verified that the pharmaceutical composition of this application can significantly reduce the expression level of RSV virus F protein in human lung organoids, upregulate the expression of type I interferon (IFN-α and IFN-β), downregulate the content of inflammatory factors IL-6 and TNF-α, alleviate swelling and fusion of human lung organoids, and significantly improve tissue damage caused by RSV infection. Therefore, it can be used to prepare drugs for the prevention and / or treatment of RSV infection.

[0042] In one embodiment of this application, the RSV infection includes at least one of the following: fever, rhinitis, pharyngitis, laryngitis, bronchitis, bronchiolitis, and viral pneumonia caused by RSV infection.

[0043] Example

[0044] The following examples illustrate the implementation of this application in more detail. Various tests and evaluations were conducted according to the methods described below. Furthermore, unless otherwise specified, "parts" and "%" are quality standards.

[0045] I. Preparation of the test solution

[0046] A drug composition was prepared by mixing tryptophan, salicylic acid, and protocatechuic acid in a mass ratio of 1.3:0.5:98.2. The drug composition was then dissolved in a human lung organoid culture medium (components: DMEM / F12 medium (Gibco, 11320033) supplemented with 3 μM CHIR99021 (StemRD, CHIR-10), 10 ng / ml human fibroblast growth factor 10 (R&D Systems, 345-FG), 10 ng / ml human keratinocyte growth factor (R&D Systems, 251-KG), 50 nM dexamethasone (R&D Systems, 1126), 0.1 mM 8-bromocyclic adenosine monophosphate (Sigma Aldrich, ST9H9BC0DEC1), and 0.1 mM 3-isobutyl-1-methylxanthine (Sigma Aldrich, ST9H9BC1329A)). The working concentration of each component was set as follows: tryptophan 1.24 g / mL. The solution contained 0.49 μg / mL of salicylic acid and 92.54 μg / mL of protocatechuic acid. The solution was sterilized by filtration through a 0.22 μm filter membrane and stored at 4℃ for later use.

[0047] II. Experimental Methods

[0048] 1. Tissue model: Lung organoids derived from human pluripotent stem cells (human lung organoids), kindly donated by Researcher Han Yuling of the Institute of Zoology, Chinese Academy of Sciences;

[0049] 2. Virus strain: Respiratory syncytial virus (RSV) A2 strain;

[0050] 3. Experimental Procedure:

[0051] (1) Human lung organoids were placed in a carbon dioxide incubator in a biosafety level 2 laboratory for 24 hours for acclimatization. The incubator environment was set at a constant temperature of 37°C, a CO2 concentration of 5%, and a humidity of saturation (above 95%).

[0052] (2) Before using RSV A2 strain, the endpoint dilution method (TCID) was used. 50 Viral titer determination: First, Hep-2 cells are pre-seeded in 96-well plates and allowed to confluence to the bottom of the wells to reach 80%–90% confluence before use in the experiment. The virus solution is then serially diluted 10-fold (1×10⁻⁶) using maintenance medium (DMEM medium containing 2% fetal bovine serum). -1 Up to 1×10 -8After aspirating the old culture medium (DMEM medium containing 10% fetal bovine serum) from the cell culture plate, add 100 μl of virus solution to each well in ascending order of concentration, with 6 replicates per well. Also, set up control wells with only maintenance medium. Incubate the plate at 37°C in a 5% CO2 incubator for 2 hours for adsorption, then add 100 μl of maintenance medium to each well and continue culturing for 5 days. Observe the cytopathic effect daily under an inverted microscope and record the number of wells showing cytopathic effects (cells merging to form syncytia, resembling grape clusters, which eventually detach). When the low dilution wells (1×10⁻⁶) show the cytopathic effect, the virus solution is added to the corresponding wells. -4 All lesions, high dilution wells (1×10) -8 When all cells were normal and the control wells were intact, the viral dilution required to infect half of the wells was calculated using the Reed-Muench method. The final result was expressed as TCID50. 50 / ml represents the viral concentration. The measured results are used to ensure that the viral concentration used in each organoid experiment is 500 TCID. 50 / mL.

[0053] (3) Using RSV A2 strain (500 TCID) 50 Human lung organoids were infected with a drug combination ( / mL) and treated simultaneously. The specific steps were as follows: After 24 hours of adaptive culture, the human lung organoids were confirmed to be in good condition under a microscope. The old culture medium in each well was discarded, and 1 ml of sterile PBS was added to each well for rinsing and then discarded. The experiment included a normal group, a virus group, and a drug group, with three replicates for each group. Before adding the samples, the working solution was prepared in advance: RSV A2 strain was diluted to 500 TCID50 using organoid-specific culture medium. 50 / mL was used as the virus working solution; the drug composition was diluted to twice the target final concentration using organoid-specific culture medium to obtain the drug stock solution. Simultaneously, the virus was diluted to 1000 TCID using culture medium. 50 / mL was used as the virus stock solution. For the normal group, 1ml of organoid culture medium was added directly to each well, and for the virus group, 1ml of virus working solution (500 TCID50) was added to each well. 50 / mL), 500 μl of virus stock solution and 500 μl of drug stock solution were added to each well of the drug group (to make the total volume of each well 1 ml, and the final virus concentration reached 500 TCID). 50 / mL (drug composition reaches the target final concentration). After each group of samples was added, the culture plates were placed in a 37℃, 5% CO2 incubator for 48 hours. After the culture was completed, the morphological changes of the organoids in each group were observed and photographed under an inverted microscope. Subsequently, the culture medium and human lung organoids from each well were collected for subsequent detection.

[0054] (4) After co-incubation for 48 hours, the morphology of the human lung organoids was observed and photographed under a light microscope. Then, ImageJ software was used to collect the area of ​​the non-fused human lung organoids and to calculate the fusion area of ​​the fused organoids. The specific steps are as follows:

[0055] Pre-experimental preparation and baseline data acquisition: Before the experiment, photographs of the organoids in each well of the 24-well plate were taken under an inverted microscope. To ensure consistency of the field of view before and after the experiment, the bottom of the culture plate was marked and the coordinates of the microscope stage were recorded. At least three different fields of view were taken for each well, and each field of view should contain organoids with clear boundaries. ImageJ software was opened, the photos were imported, and the line tool was used to draw a line along the scale bar in the image. The scale bar was set through Analyze→Set Scale. For all organoids to be included in the experiment, the outline of each organoid was drawn along its edge using the freehand drawing tool, and the area was measured. The data in the Results window was exported and saved. This data will be used as the basis for calculating the "sum of the areas of the two organoids before fusion" when calculating the degree of fusion.

[0056] 48-Hour Photography and Area Analysis: After 48 hours of co-incubation, photos were taken again at the same field of view as the coordinates recorded before the experiment. The photos were opened in ImageJ, using the same scale settings as before. At this point, the organoids were processed in two categories based on their state: ① For organoids that had fused, the outline of the two fused organoids was drawn using the freehand drawing tool, and the total area after fusion was recorded. The degree of fusion was calculated by combining this with the area of ​​the two organoids before the experiment (fusion area = sum of the areas of the two organoids before fusion - total area after fusion; degree of fusion (i.e., the proportion of area reduction of the two organoids due to fusion) = fusion area / sum of the areas of the two organoids before fusion × 100%); ② For organoids that were still in a non-fused state, the outline was directly drawn using the freehand drawing tool, and the area was measured after 48 hours. Finally, the calculated fusion degree data and the area data of non-fused organoids were statistically analyzed to compare the differences between the different treatments.

[0057] (5) Collect human lung organoid culture medium and use ELISA kit to detect the content of inflammatory cytokines IL-6 (Jianglai Biotechnology, JL14113), TNF-α (Jianglai Biotechnology, JL10208), and type I interferon IFN-α (Jianglai Biotechnology, JL12191) and IFN-β (Jianglai Biotechnology, JL19215) according to the instructions.

[0058] (6) Collect human lung organoids and detect the relative expression level of RSV virus F protein by reverse transcription quantitative PCR (RT-qPCR). The specific steps are as follows: After collecting the culture medium of human lung organoids, add 500 μl of pre-cooled sterile PBS to each well and gently wash once and discard. Add 500 μl of TRIzol lysis buffer to each well, and repeatedly pipette to fully lyse the organoids. Transfer the lysis buffer to a 1.5 ml RNase-free EP tube and let it stand at room temperature for 5 minutes. Add 100 μl of chloroform to each tube, shake vigorously for 15 seconds, let it stand at room temperature for 3 minutes, and centrifuge at 12000 rpm for 15 minutes at 4℃. Carefully aspirate the colorless aqueous phase to a new EP tube, add an equal volume of isopropanol, invert and mix, let it stand at room temperature for 10 minutes, and centrifuge at 12000 rpm for 10 minutes at 4℃. Discard the supernatant and observe the white RNA precipitate at the bottom of the tube. Wash the precipitate with 1 ml of pre-cooled 75% ethanol (prepared with RNase-free water), centrifuge at 7500 rpm for 5 minutes at 4°C, discard the supernatant, and air dry for 15 minutes. Dissolve the RNA in an appropriate amount of RNase-free water according to the precipitate volume, and determine the RNA concentration and purity. Take 1 μg of total RNA and prepare the reaction system according to the reverse transcription kit instructions (TransGen, AE301). Perform reverse transcription on a PCR instrument with the following program: 25°C for 10 minutes, 42°C for 15 minutes, and 85°C for 5 seconds to terminate the reaction. Immediately use the synthesized cDNA for qPCR. Prepare the qPCR reaction system according to the real-time quantitative PCR kit instructions (TransGen, AQ602), and amplify on a real-time quantitative PCR instrument with the following program: 94°C pre-denaturation for 30 seconds, followed by 94°C denaturation for 5 seconds and 60°C annealing and extension for 30 seconds (fluorescence acquisition), for a total of 40 cycles. After the reaction, analyze the melting curve to confirm the amplification specificity. Using human GAPDH as an internal control primer (Sangon Biotech, B661104), the following method was employed: -ΔΔCt The relative expression level of RSV F protein mRNA was calculated using the method. RSV primer sequences (5'→3'): (F)GAAATTAATACGACTCACTATAGGGAAGAAGCAAGCTGGCATATGATGTAACCAC (SEQ ID NO: 1); (R)GTTTTCATAGTGAGATCTTTAACTGTAGTTAACATA (SEQ ID NO: 2).

[0059] 4. Experimental Results

[0060] RT-qPCR results showed that, compared with the RSV group, the expression level of RSV virus F protein in human lung organoids was significantly reduced after intervention with the drug combination. Figure 1 This indicates that the pharmaceutical composition of this application is effective against RSV infection.

[0061] Elisa results showed that the drug composition upregulated the expression of type I interferon (IFN-α and IFN-β). Figure 2 and Figure 3 This indicates that the pharmaceutical composition of this application has significant antiviral activity; the pharmaceutical composition reduces the content of inflammatory factors IL-6 and TNF-α in human lung organoid culture medium ( Figure 4 and Figure 5 This indicates that the pharmaceutical composition of this application downregulates the inflammatory response induced by RSV infection.

[0062] Statistical analysis of the area and fusion degree of human lung organoids collected by ImageJ showed that the pharmaceutical composition of this application reduced swelling and fusion of human lung organoids. Figures 6 to 8 This indicates that the pharmaceutical composition of this application significantly improves tissue damage caused by RSV infection.

[0063] In summary, this application, using a human lung organoid model, verified that the pharmaceutical composition of this application can significantly reduce the expression level of RSV virus F protein in human lung organoids, upregulate the expression of type I interferon (IFN-α and IFN-β), downregulate the content of inflammatory factors IL-6 and TNF-α, alleviate swelling and fusion of human lung organoids, and significantly improve tissue damage caused by RSV infection. Therefore, it can be used for the prevention and / or treatment of RSV infection. This provides a direct and feasible formulation basis for the development of modern traditional Chinese medicine or natural drugs with clear components and controllable quality.

[0064] The above description is only a preferred embodiment of this application and is not intended to limit this application. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the scope of protection of this application.

Claims

1. A pharmaceutical composition comprising tryptophan, salicylic acid and protocatechuic acid; wherein, based on the mass of the pharmaceutical composition, the mass percentage of tryptophan is 1% to 1.5%, the mass percentage of salicylic acid is 0.4% to 0.6%, and the mass percentage of protocatechuic acid is 97.9% to 98.6%.

2. The pharmaceutical composition according to claim 1, wherein, Based on the mass of the pharmaceutical composition, the mass percentage of tryptophan is 1.16% to 1.47%, the mass percentage of salicylic acid is 0.49% to 0.54%, and the mass percentage of protocatechuic acid is 98% to 98.35%.

3. The pharmaceutical composition according to claim 1, wherein, The mass ratio of the tryptophan, the salicylic acid and the protocatechuic acid is 0.010~0.015:0.004~0.006:

1.

4. The pharmaceutical composition according to claim 1, wherein, The pharmaceutical composition also includes a pharmaceutically acceptable carrier or excipient.

5. The pharmaceutical composition according to claim 4, wherein, The pharmaceutically acceptable carrier or excipient includes at least one of the following: solvent, diluent, dispersant, suspending agent, surfactant, isotonic agent, thickener, emulsifier, preservative, binder, lubricant, stabilizer, hydrating agent, emulsification accelerator, buffer, absorbent, colorant, flavoring agent, sweetener, ion exchanger, release agent, coating agent, flavoring agent, and antioxidant.

6. The pharmaceutical composition according to any one of claims 1 to 5, wherein, The pharmaceutical composition is formulated as any one of the following dosage forms: powder, tablet, capsule, pill, emulsion, suspension, or tincture.

7. Use of the pharmaceutical composition according to any one of claims 1 to 6 in the preparation of a medicament for the prevention and / or treatment of respiratory syncytial virus infection.

8. The use according to claim 7, wherein, The respiratory syncytial virus infection includes at least one of the following: fever, rhinitis, pharyngitis, laryngitis, bronchitis, bronchiolitis, and viral pneumonia caused by respiratory syncytial virus infection.

Images