StRNA for treating hemophilia B and screening method thereof
By designing stRNA to recognize the PTC encoding the factor IX gene F9, and using an AAV vector to deliver and restore the expression of factor IX, the problem of high dosing frequency and gene therapy risks in existing treatments for hemophilia B is solved, achieving safe and efficient endogenous repair.
Patent Information
- Application Number
- CN202610241413.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-28
- Publication Date
- 2026-05-29
AI Technical Summary
Existing treatments for hemophilia B, such as replacement therapy, involve frequent and expensive administration. Gene therapy carries risks of liver toxicity, anti-AAV immune responses, and genome integration. It cannot mimic the entire pathophysiological process of patients and has limited efficacy against nonsense mutations.
Using naturally or artificially designed stRNAs, the expression of endogenous coagulation factor IX is restored by recognizing the premature stop codon (PTC) of the F9 gene encoding coagulation factor IX and delivered via an AAV vector. The coagulation function is restored in a mouse model by delivering Arg-stRNA via AAV.
It achieves effective treatment in terms of both molecular mechanism and clinical phenotype, reduces clotting time, increases the expression of coagulation factor IX, reduces carrier toxicity, provides a safe endogenous repair strategy, and reduces the complexity of clinical application.
Smart Images

Figure CN122097401A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biology technology, specifically relating to an stRNA for treating hemophilia B and its screening method, and particularly to a gene encoding a coagulation factor for treatment. F9 stRNAs for hemophilia B caused by nonsense mutations and their applications. Background Technology
[0002] Hemophilia B is an X-linked recessive genetic disorder caused by the gene encoding coagulation factor IX (FIX). F9 Mutations in FIXa lead to functional defects, resulting in coagulation dysfunction. In the coagulation cascade, FIXa, as a serine protease, binds to FVIIIa to form a complex. The A2 domain of the FIXa gene reduces dissociation and efficiently activates FIXa, playing a crucial role in thrombin generation. Currently, the preferred treatment is replacement therapy, involving regular exogenous injections of plasma complexes or recombinant coagulation factor (rhFIX). However, this requires frequent administration, is expensive for life, and its effectiveness is limited in some patients due to inhibitor production.
[0003] In recent years, gene therapy has offered hope for the cure of hepatitis B (HB). One of the key reasons for its success is the development of the naturally occurring missense mutant FIX-Padua, which increases the catalytic activity of FIX by 8 times. This is achieved through AAV delivery. F9Strategies targeting hepatocytes with genes have been approved for hemophilia B (HB) treatment. However, AAV-mediated gene therapy still faces challenges: high vector doses may induce liver toxicity and anti-AAV immune responses; there is a risk of thrombosis due to increased FIX activity; and there is a potential carcinogenic risk from random genomic integration, all of which can be life-threatening. Therefore, current research focuses on innovation in gene therapy technologies. The efficacy of HB replacement therapy is usually evaluated by the activity of FIX in plasma. Engineered FIX, fused with human serum albumin HSAQMP, helps prolong the therapeutic half-life. Low-dose AAV-CRISPR-mediated non-homologous end linkage (NHEJ) knock-in can efficiently express hFIX and stably restore coagulation function in hemophilia B mice. Photoactivated RNA adenosine base editor (PA-rABE) can achieve UAG to UIG editing at the single nucleotide level with minimal off-target effects. The engineered B-cell drug BE-101 can continuously produce FIX; in addition, FIX-R338Q, obtained after cytosine base editing, is a gain-of-function mutation that can enhance FIX activity. However, hemophilia is a complex disease, and a high proportion of patients with HB have single nucleotide mutations. Current gene therapies restore gene coding function by altering the genome sequence, but they cannot simulate the entire pathophysiological process of patients. Furthermore, gene therapy has limited packaging capacity, and there is a risk of integration when introducing exogenous genes.
[0004] According to reports, the gene encoding coagulation factor IX (FIX) F9 Most nonsense mutations lead to a severe phenotype of hemorrhage (<1% of normal coagulation factor activity, <0.01 IU / mL), targeting the gene encoding coagulation factor IX (FIX). F9 Developing new therapeutics for hemophilia B caused by nonsense mutations is particularly urgent. Suppressor tRNAs (sup-tRNAs), derived from natural tRNAs, can be modified with anticodon loops to recognize premature termination codons (PTCs). When they bind to PTCs, they do not stop protein synthesis; instead, they add the correct amino acid at the PTC position, allowing protein synthesis to proceed smoothly and contributing to endogenous recovery. F9 This provides new insights into the expression and function of the protein and the treatment of hemophilia B. Summary of the Invention
[0005] Targeting the gene encoding coagulation factor IX (FIX) F9 Nonsense mutations can cause severe coagulation disorders in hemophilia B patients. There are technical problems such as the high frequency of replacement therapy and the risk of genome integration in gene therapy. This paper proposes an stRNA for treating hemophilia B caused by nonsense mutations in coagulation factor genes, its screening method and application.
[0006] Based on the analysis of the probability of nonsense mutations in coagulation factor IX in hemophilia patients, the effects of stRNA on the gene encoding coagulation factor IX were analyzed. F9 The feasibility of the technique was verified by prematurely terminating the readthrough function of the proto-codon (PTC). Seven Arg-stRNAs were specifically designed for the coagulation factor IX R75* mutation, which is frequently observed and causes severe coagulation dysfunction, and its readthrough efficiency was tested at the cellular level. Furthermore, a mouse model of the coagulation factor IX R75* mutation was constructed, and Arg-stRNA was delivered via AAV, restoring the protein expression of endogenous coagulation factor IX and reducing clotting time. This demonstrated the effectiveness of stRNA therapy for hemophilia B from both molecular mechanism and clinical phenotype perspectives.
[0007] Specifically, On one hand, this invention provides the application of a premature stop codon (PTC) decoding reagent in the preparation of hemophilia treatment drugs, wherein the hemophilia is a gene encoding a coagulation factor. F9 Hemophilia B caused by nonsense mutations; the decoding reagent is a natural or artificial stRNA, and it is capable of reading genes encoding coagulation factors. F9 PTC is caused by nonsense mutation.
[0008] Furthermore, the application of the premature stop codon (PTC) decoding reagent of the present invention in the preparation of hemophilia treatment drugs, wherein the anticodon loop of the natural or artificial stRNA is complementary to the PTC generated by a nonsense mutation in the coagulation factor; the amino acids carried by the natural or artificial stRNA are compatible with the gene encoding the coagulation factor mutation. F9 The amino acids encoded by the wild-type gene codons corresponding to the PTC codon positions may be the same or different.
[0009] Furthermore, the application of the early stop codon (PTC) decoding reagent described in this invention in the preparation of hemophilia treatment drugs, wherein the gene encoding the hemophilia B clotting factor... F9 The nonsense mutations are nonsense mutations of coagulation factor IX, including one or more nonsense mutations selected from the amino acid coding sequences of coagulation factor IX at positions 75, 96, 103, 118, 141, 142, 152, 184, 237, 253, 312, 325, 371, 406, 420, and 431 to become stop codons.
[0010] Furthermore, the application of the early stop codon (PTC) decoding reagent described in this invention in the preparation of hemophilia treatment drugs, wherein the nonsense mutation is a mutation of the coding sequence of arginine at position 75 of coagulation factor IX into a stop codon, for example, the coding sequence of arginine at position 75 of coagulation factor IX is mutated from wild-type CGA to TGA.
[0011] Furthermore, the application of the early stop codon (PTC) decoding reagent described in this invention in the preparation of hemophilia treatment drugs, wherein the natural or artificial stRNA is capable of reading the gene encoding the coagulation factor IX mutation. F9 PTC at the coding sequence of arginine at position 75 generates a functional coagulation factor IX; preferably, the natural or artificial stRNA is selected from the group consisting of SEQ ID NO: 1, 17-23.
[0012] Furthermore, in the application of any of the aforementioned early termination codon (PTC) decoding reagents in the preparation of hemophilia treatment drugs, the stRNA is delivered into cells via a vector, preferably an AAV viral vector, including but not limited to rAAV2 / 8 serotype AAV viral vectors.
[0013] Secondly, this application provides a method for screening therapeutic drugs for hemophilia targeting non-homogeneous mutation subtypes of coagulation factors, comprising the following steps: (1) Obtain nucleic acid encoding mutant coagulation factor containing PTC site from hemophilia patients; (2) The EGFP coding region is ligated to the 3' end of the mutant coagulation factor encoding nucleic acid containing the PTC site to obtain a plasmid containing the coagulation factor-PTC-EGFP fusion expression cassette; (3) Co-transfect the plasmid containing the stRNA expression cassette and the plasmid containing the coagulation factor-PTC-EGFP fusion expression cassette constructed in step (2) into eukaryotic host cells; (4) Detect green fluorescence signal and screen cells that can produce green fluorescence, wherein the transfected stRNA is an active stRNA molecule that can read the PTC on the nucleic acid encoded by the mutant coagulation factor; (5) Prepare hemophilia treatment drugs with nonsense mutation subtypes of the coagulation factor from the stRNA obtained in step (4).
[0014] Furthermore, the method for screening therapeutic drugs for hemophilia targeting nonsense mutation subtypes of coagulation factors according to the present invention is characterized in that the nonsense mutation subtypes of coagulation factors include one or more nonsense mutations selected from the amino acid coding sequences of coagulation factor IX at positions 75, 96, 103, 118, 141, 142, 152, 184, 237, 253, 312, 325, 371, 406, 420, and 431, which are mutated into stop codons.
[0015] Furthermore, in the method for screening therapeutic drugs for hemophilia targeting non-homogeneous mutation subtypes of coagulation factors described in this invention, step (4) further includes: Step (4.1): Construct an animal model with the nonsense mutation subtype of the coagulation factor; Step (4.2) uses the animal model constructed in step (4.1) to evaluate the therapeutic effect of the stRNA obtained from the screening on hemophilia with the nonsense mutation subtype of the coagulation factor.
[0016] Furthermore, in the method for screening therapeutic drugs for hemophilia targeting nonsense mutation subtypes of coagulation factors according to the present invention, step (5) further includes preparing a drug formulation that can deliver the stRNA into cells using a suitable vector; the suitable vector is preferably a viral vector, including but not limited to rAAV2 / 8 serotype AAV virus vector.
[0017] Thirdly, this application provides an application of a coagulation factor nonsense mutant mouse model in screening and identifying drugs for the treatment of hemophilia, wherein the coagulation factor nonsense mutant mouse is a genetically engineered mouse whose coagulation factor coding sequence has been mutated to produce a premature stop codon (PTC); the coagulation factor expression level and / or function of the mouse is reduced, resulting in coagulation dysfunction.
[0018] Furthermore, the application of the coagulation factor nonsense mutant mouse model described in this invention in screening and identifying drugs for the treatment of hemophilia, wherein the coagulation factor nonsense mutant mouse is a genetically engineered mouse and its homozygous offspring in which the coding sequence of arginine at position 75 of coagulation factor IX is mutated to the premature stop codon PTC using gene editing technology; preferably, the coagulation factor IX coding gene is mutated using CRISPR / Cas technology. F9 The homozygous mice were generated by replacing C with T at position 223.
[0019] Furthermore, the present invention relates to the application of a coagulation factor nonsense mutant mouse model in screening and identifying drugs for the treatment of hemophilia. In this model, candidate stRNAs are administered to the coagulation factor nonsense mutant mice, and the therapeutic effect of the candidate stRNAs on the coagulation factor nonsense mutant hemophilia is evaluated by the recovery of coagulation factor expression and / or function and the relief of coagulation dysfunction.
[0020] Furthermore, the application of the coagulation factor nonsense mutant mouse model of the present invention in screening and identifying hemophilia treatment drugs is characterized in that the candidate stRNA is an active stRNA molecule obtained by the method described in the second aspect of the present invention, capable of reading the PTC on the nucleic acid encoding the mutant coagulation factor.
[0021] Advantages and beneficial effects of the present invention: First, based on an analysis of the probability of nonsense mutations in coagulation factor IX in hemophilia patients, taking the frequently occurring and severely impaired coagulation factor IX R75* mutation as an example, a method for screening therapeutic stRNAs was provided. Using this method, a stRNA therapy with high readability and good therapeutic effect against PTCs causing coagulation factor IX R75* mutations was successfully obtained. Furthermore, stRNA therapy has irreplaceable advantages in AAV vector adaptation and safety. stRNA molecules are compact, adapting more efficiently to AAV vectors and reducing vector-related toxicity. In full-length gene therapy, exogenous genes have the probability of integrating into the host genome, posing a risk of activating oncogenes. tRNAs do not insert into the genome, functioning only at the translational level, theoretically offering superior long-term safety.
[0022] Second, this invention is the first to use homozygous nonsense mutations ( F9 The male R75* mouse model (-R75*, TCA→TGA) was used to verify the therapeutic effect of AAV delivery of repressive tRNA. This mouse model reproduced hemophilia B caused by FIX deficiency, simulated the pathophysiological process of hemophilia B from both molecular mechanism and clinical phenotype aspects, and reproduced the human arginine nonsense mutation phenotype, providing an ideal platform for endogenous repair strategies.
[0023] Third, this invention is the first to deliver the full length of AAV. F9 This study compared gene therapy methods with those of other approaches, evaluating treatment efficacy using mouse models by assessing liver coagulation factor FIX protein expression levels and coagulation function. Results showed that AAV-stRNA had good safety profile, with coagulation time closer to wild-type levels. Endogenously restored proteins, when localized and modified within cells and interacting with other molecules, more closely resembled wild-type proteins, while exogenously expressed full-length proteins exhibited abnormal localization or functional deficiencies. This provides a novel approach for the precise repair of endogenous gene mutations. Furthermore, from a clinical translation perspective, the short stRNA sequence is simpler to construct and facilitates mass production. Further exploration could involve combining it with small molecule drugs to enhance pathway efficiency.31,32 Theoretically, AAV-delivered stRNA can recognize specific terminators, covering patients with various nonsense mutations, eliminating the need to design separate vectors for each disease and reducing the complexity of clinical applications. Attached Figure Description
[0024] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the following description of the embodiments will be briefly introduced. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.
[0025] Figure 1: F9 Screening of gene mutation data and engineering design of repressive tRNA a. F9 Gene mutation types. A total of 5358 patients were included, and missense mutations, nonsense mutations, frameshift mutations, splicing mutations, silent mutations, large deletions, large duplications, intron mutations, and NA (null) mutations were displayed in pink, purple, blue, cyan, green, yellow, red, light pink, and orange, respectively.
[0026] b. F9 Nonsense mutation types of genes. Arginine (Arg), cysteine (Cys), glycine (Gly), leucine (Leu), serine (Ser), tryptophan (Try), glutamine (Gln), glutamic acid (Glu), lysine (Lys), and tyrosine (Tyr) are shown in purple, dark blue, blue, green, yellow, orange, light pink, pink, dark purple, and gray, respectively.
[0027] c. F9 The genetic structure. F9 The gene contains eight exon regions. Nonsense mutation sites of the TGA stop codon are shown in purple, TAG in pink, and TAA in orange.
[0028] d. Schematic diagram of the engineering of repressive tRNA (stRNA). Natural tRNA recognizes sense codons (CGA); while stRNA recognizes stop codons (UGA) through engineered anticodons.
[0029] e. Repressive tRNAs restore the full-length expression of truncated proteins.
[0030] f. F9 -PTC-EGFP and stRNA plasmid were co-transfected into HEK293T cells.
[0031] Figure 2 Repressive tRNA restores F9 protein expression under different nonsense mutation conditions. a. Display F9 -TGA、 F9 -TAG、 F9 Microscopic images of differentially expressed EGFP-positive cells in the TAA group. Consistent results were obtained from at least three independent biological replicates. Scale bar = 100 micrometers.
[0032] b. Flow cytometry detection F9 -Mean EGFP FITC-A signal in the TGA / TAG / TAA group. Data are mean ± standard deviation of four biological replicates.
[0033] c. Readability.
[0034] d. stRNA recovers different nonsense mutations F9 Representative Western blot images of protein expression (TGA / TAG / TAA group).
[0035] Figure 3 nonsense mutations in arginine in the F9 gene a. Nonsense mutations in arginine. A total of 414 patients were included, with Arg62*, Arg75*, Arg162*, Arg294*, Arg298*, Arg379*, and Arg384* displayed in pink, purple, green, yellow, orange, light pink, and blue, respectively.
[0036] b. Verify the readability of R-UGA at different arginine nonsense mutation sites, scale bar = 100 μm.
[0037] c. F9 Arg-PTC and Arg-stRNA plasmid transfection and Western blotting experimental design.
[0038] d. Screen for Arg-stRNAs (R1 / R2 / R3 / R4 / R5 / R6 / R7) at the R75* site, scale bar = 100 μm.
[0039] e. Different stRNAs restored the R75* site to a missense mutation, scale bar = 100 μm.
[0040] f. Representative protein blot images of different Arg-stRNAs restoring factor IX protein expression at the R75* site.
[0041] g. FIX protein expression after R75* missense mutation.
[0042] Among them, b, d, and e were performed in at least three biological replicates, and consistent results were obtained independently.
[0043] Figure 4 F9 R75* Development and validation of a mouse model of hemophilia B a. A gene-targeting strategy for R75* gene knock-in using CRISPR / Cas technology. This model is based on human... F9 Transcripts (NM_000133.4; NP_000124.1) and mice F9Transcripts (NM_007979.2; NP_032005.1) were designed. Genotyping of R75* male mice. '+' indicates wild type. F9 Alleles; 'Mut' indicates R75* mutant. F9 Alleles; 'Y' represents the Y chromosome.
[0044] b. Blood loss was assessed using a tail amputation assay in mice. Blood was collected in Corning 35mm x 10mm cell culture dishes. 'WT' represents the wild-type mouse group; 'R75*' represents the mouse group carrying the R75* mutation.
[0045] c. Quantification of blood loss.
[0046] d. Statistical analysis of bleeding time.
[0047] e. F9 The relative level of mRNA expression.
[0048] Figure 5 Transcriptome analysis of R75* mice and wild-type mice a. Principal component analysis (PCA) of transcriptome data. Blue dots represent samples from the R75* group, and orange dots represent wild-type samples. Each group has 3 biological replicates, showing significant transcriptome differences between the two genotypes.
[0049] b. Gene expression heatmap. This shows a high degree of reproducibility of gene expression patterns within the same group.
[0050] c. Tropical plots show differential gene expression between R75* mice and wild-type mice, used to identify 351 significantly upregulated genes and 188 significantly downregulated genes.
[0051] d. Gene Ontology (GO) enrichment analysis. The biological processes enriched by differentially expressed genes (DEGs) identified in R75* mice were annotated.
[0052] Figure 6 Representative blood routine test indicators of R75* mice and wild-type mice a. Red blood cell count (RBC).
[0053] b. Hemoglobin (HGB).
[0054] Figure 7 Coagulation function assay in F9 R75* mice after AAV-Recover and AAV-full long treatment a. Schematic diagram of the construction of the rAAV2 / 8 vector, including the promoter, transgenic fragment, and polyadenylation (pA) signal.
[0055] AAV-Recover (Group A): R -UGA Sequence and luciferase reporter gene; AAV - Full Length (Group B): Full Length F9 The gene (SEQ ID NO:26, excluding the stop codon) is fused with Luc (SEQ ID NO:27).
[0056] b. Schematic diagram of animal experimentation process.
[0057] c. Representative in vivo bioluminescence images of male R75* mice at weeks 4, 6, 8, 10, and 12 following tail vein injection of AAV (Groups A and B). Two mice were used in each group, with untreated R75* mice serving as negative controls. The pseudo-color scale represents the bioluminescence signal intensity.
[0058] d. Clotting time.
[0059] e. Blood loss was assessed using the tail-cutting bleeding method 12 weeks after AAV injection. "WT" represents the wild-type mouse group; "R75*" represents mice carrying the R75* mutation; "R75*+Group A" represents R75* mice that received AAV-Recover injection; "R75*+Group B" represents R75* mice that received AAV-full long injection.
[0060] f. Quantitative analysis of blood loss.
[0061] g. FIXa activity in wild-type, R75*, GA and GB mice.
[0062] h. Activated partial thromboplastin time (APTT) results of wild-type, R75*, GA and GB mice at 12 weeks.
[0063] i. At 12 weeks, liver tissue samples from wild-type, R75*, GA, and GB mice were analyzed. F9 A representative Western blot pattern of protein expression (molecular weight: 75 kDa); GAPDH (36 kDa) served as a control.
[0064] j. F9 Density quantification of protein levels (normalized with GAPDH as a reference) is presented as a percentage of WT expression.
[0065] Data are presented as mean ± standard deviation. Differences between groups were determined by one-way ANOVA; each group had 3 biological replicates, and p < 0.05 was considered statistically significant. Detailed Implementation
[0066] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the present invention and are not intended to limit the present invention. All other embodiments obtained by those skilled in the art without creative effort are within the protection scope of the present invention.
[0067] The experimental materials and methods used in the embodiments of this invention are as follows: Cell Culture and Transfection: Human HEK293T cells (ATCC, CRL-11268) were cultured in DMEM medium (Corning, 10-013-CVR) containing 10% (v / v) fetal bovine serum (Gbico, 10099141) and 100 mg / mL penicillin-streptomycin (Macgene, CC004) at 37°C with 5% CO2. Cells were transfected using Opti-MEM (Gibco, 31985070), and samples were collected after 48 h.
[0068] Western blot: Cell cultures were lysed on ice. The lysate contained PMSF. The total protein concentration of the lysate was determined using the BCA method. After normalization, the lysate was boiled at 95°C for 10 min with 5× protein loading buffer (Applygen, B1034). Primary antibodies were rabbit anti-Factor IX (abcam, ab255824, 1:2000 dilution) and rabbit anti-GAPDH (abcam, ab181602, 1:10000 dilution). Secondary antibodies were HRP-goat anti-mouse IgG (H+L) (Biodragon, BF03001, 1:5000 dilution) and HRP-goat anti-rabbit IgG (H+L) (Biodragon, BF03008, 1:10000 dilution). Developing was performed using a BeyoECL Moon (Beyotime, P0018FS) spectrophotometer.
[0069] Mass spectrometry: Protein purification was performed using the MYC-tagged fusion protein purification kit (Elabscience). The protein was loaded with 5× protein loading buffer (Applygen, B1034), boiled at 95°C for 10 min, and immediately subjected to SDS-PAGE. Coomassie brilliant blue staining was used to visualize the Factor IX-MYC bands, and the gel was excised for mass spectrometry analysis. For LC-MS / MS analysis, a Thermo Ultimate 3000nano-UPLC system was connected to a Thermo Fusion LUMOS mass spectrometer, using an Acclaim PepMap RSLC column (75 µm ID, 250 mm length, C18), and Proteome Discoverer software was used for data analysis.
[0070] Flow cytometry analysis: Cells were isolated using trypsin and collected in 2 ml centrifuge tubes. The pellet was washed with PBS and resuspended in FACS buffer (PBS with 2% FBS). Flow cytometry analysis was performed on a Cytoflex flow cytometer (Beckman), and data analysis was performed using software.
[0071] AAV vector: Constructing Arg-stRNA driven by the U6 promoter. F9 -full and Luc's single-chain AAV2 / 8.
[0072] Plasma collection and enzyme activity assay: Blood was collected by enucleation and added to centrifuge tubes containing 3.2% citrate anticoagulant (anticoagulant to blood ratio of 1:9). The supernatant was obtained by centrifugation at 3000 rpm for 10 min within 1 hour. The activity of coagulation factor 9 in mouse plasma was detected using the Mouse FIX ELISA KIT kit (AE2125B).
[0073] Mouse genotyping: The point mutation mouse was verified by sequencing for the (TCA→TGA) mutation at arginine position 75. PCR primer information is as follows: F9 -F:GATCGTGAAAATGCCACCAAAATT (SEQ ID NO:24) F9 -R: TGTGTATGAGTGTTCTATCTGTGTG (SEQ ID NO:25) Animal experiments and hemorrhage measurement: Eight-week-old SPF-grade male C57BL / 6j mice were used. The environment was maintained at 22-25℃ with a relative humidity of 40%-60%, using a 12-hour light-12-hour dark cycle. Mice were fed standard mouse feed and sterile drinking water, in accordance with the institution's laboratory animal ethics committee approval. Mice were fasted for 12 hours prior to the experiment and anesthetized with isoflurane. They were placed supine in a fixation device, and the tail was docked at 2 / 3 of the way from the tail tip. Bleeding time was recorded after 5 consecutive seconds without any visible blood droplets.
[0074] Transcriptome analysis: Liver samples were taken, and the reference genome was GRCm39.112, which was then sequenced using novaseqpe150.
[0075] Example 1: Screening for F9 gene mutation sites and validation of stRNA effectiveness For hemophilia B patients in the database F9 The types, sites, and probabilities of gene mutations were analyzed to determine the PTC site of the coagulation factor FIX encoding gene. Corresponding stRNAs were selected and designed to verify the effectiveness of using stRNAs to read the PTC site of the coagulation factor FIX encoding gene.
[0076] A search of the Factor IX Gene Variant Database yielded 1,692 mutations from 5,358 individuals. Missense mutations were the most frequent (62.82%), followed by nonsense mutations (11.93%). Ten amino acids (Arg / Cys / Gly / Leu / Ser / Trp / Gln / Glu / Lys / Tyr) were susceptible to nonsense mutations, producing three different types of terminators (TGA / TAG / TAA). Arginine showed the highest proportion of TGA nonsense mutations (65.19%). Figure 1 Therefore, combining gene structure and incidence information, we selected... F9 The 16 nonsense mutation sites on the gene (Table 1) were used to design plasmids containing PTC sites for subsequent experiments. The 16 nonsense mutation sites in Table 1 cover all types of nonsense mutations in HB.
[0077] Table 1: F9 nonsense mutation sites on genes
[0078] The anticodon loop on natural tRNA pairs with the three-base codon on mRNA through base complementarity, inserting the corresponding amino acid at a specific site. However, natural tRNA cannot recognize terminators, thus prematurely terminating translation at the PTC site. Modified stRNA, on the other hand, can recognize PTC terminators and endogenously restore full-length protein expression. Based on the stRNA database previously constructed by our research group, and according to the wild-type amino acid types and PTC stop codon sequences for the 16 PTC sites listed in Table 1, we selected the 16 stRNA sequences with the highest readability (Table 2) for subsequent experiments.
[0079] Table 2: stRNA sequences (SEQ ID NO:1-16)
[0080] Note: Lowercase letters in the sequence are anticodons. To verify the effectiveness of our designed stRNA, we used a method containing a PTC site. F9 The plasmid ends of the gene are ligated with EGFP. If readthrough is successfully restored, a green fluorescent signal can be detected. The stRNA plasmid is then combined with... F9 -PTC-EGFP plasmid was co-transfected into HEK293T cells, and green fluorescence was detected 48 hours later. In the TGA terminator group, R75* and S406* showed obvious green fluorescence, and Western blot verification showed obvious protein bands; in the TAG terminator group, except for E142*, the other four groups showed obvious green fluorescence, and protein expression was somewhat restored; in the TAA terminator group, only Q237* showed a significant fluorescence signal, but protein recovery was not obvious. Figure 2 (a, b). Overall, stRNA therapy has better general applicability for TAG terminator treatment and the best therapeutic effect for Arg-TGA. Further research is needed on... F9 All arginine TGA nonsense mutation sites on the gene were analyzed to screen for stRNAs with high reading efficiency. Further modification and exploration are needed for the TAA terminator; subsequent sequence optimization or modification of the stRNA could be considered to improve reading efficiency.
[0081] Based on the results of flow cytometry experiments, the readthrough rate was calculated using the ratio of the detected value to the average fluorescence signal intensity of the wild-type group (we defined a readthrough rate >20% as effective). We found that 50% of the 16 selected sites showed effective readthrough, demonstrating the universality of stRNA therapy. Among them, R75* had the highest readthrough rate (>80%), and this site is also... F9 The site with the highest incidence of nonsense mutations ( Figure 2(c) Mass spectrometry confirmed that the arginine insertion efficiency at the R75* site on the stRNA was 100%. The R75* mutation is located in the Gla domain, and γ-carboxylation at this position is crucial for FIX activity. Therefore, the R75* mutation was subsequently selected to construct an animal model for further investigation of this site.
[0082] Example 2: Analysis of Arginine TGA nonsense mutation sites in the F9 gene and screening of high-readthrough-rate stRNAs A statistical analysis of nonsense mutations in arginine revealed seven nonsense mutation sites: R62*, R75*, R162*, R294*, R298*, R379*, and R384*. Among these, γ-carboxylation of the Gla domain containing R75* is crucial for FIX activity. Figure 3 a). At the R75* site, we screened 7 Arg-stRNAs (Table 3), and combined the fluorescence results with Western blotting, R5, i.e., R in the following text. -UGA The readthrough efficiency is the highest. R-UGA can restore all PTC sites on arginine, verifying the good universality of our modified repressive tRNA. Figure 3 (b, d, f).
[0083] Table 3: Arginine stRNA sequences (SEQ ID NO:17-23)
[0084] The hypothesis of recoding genes through codon substitution is based on the premise that synonymous substitution does not alter the primary sequence of a protein; however, recoding may change protein structure, thereby affecting therapeutic efficacy. In addition to synonymous restoration, we also explored missense mutation restoration strategies, using stRNA tools... F9 Different amino acids are inserted at -R75*, with serine being even more efficient than arginine, and the protein expression at this position is higher than that of the wild type. Figure 3 (e, g), this discovery proves F9 -R75S has the potential to be a high-functioning mutation. Meanwhile, mass spectrometry analysis showed that the serine insertion efficiency was close to 100%. This demonstrates that our designed and modified stRNA can precisely insert into the PTC site and restore... F9 Protein expression, and has the potential to be artificially engineered to obtain missense mutations. F9 protein.
[0085] Example 3: Construction and Phenotypic Evaluation of R75* Mouse Model of Hemophilia B Most existing mouse models of hemophilia B are F9-KO mice and missense mutation models were not available, as there were no commercially available nonsense mutant mice. Therefore, based on experimental results in HEK293T cells, we rationally designed a c57BL / 6J mouse model containing the R75* mutation. F9 The Arg mutation at amino acid position 75 of the gene became a terminator (TCA→TGA), and it was verified that this type of mouse had severe coagulation dysfunction.
[0086] Point mutation gene knock-in model mice were prepared by Beijing Biocytogen based on the CRISPR / Cas9-based EGE system. F9 Targeting strategies for gene R75* knock-in, such as Figure 3 (as shown in a). Propagation was carried out by mating with wild-type mice, using... F9 -F (SEQ ID NO:24) / F9 After amplification using the -R (SEQ ID NO:25) primer pair, the mouse genotype was determined by sequencing. F9 A substitution of C for T at position 223 of the gene results in homozygosity. Since HB is inherited in an X-linked recessive manner, heterozygous mice do not exist in male mice. After homozygous male mice reach eight weeks of age, a tail-clipping test can be used to preliminarily verify whether the bleeding time and amount meet the modeling criteria. R75* mice showed a significantly increased bleeding amount after tail-clipping, approximately 5.45 times that of wild-type mice. Figure 4 (b, c) The bleeding time was longer (658.66±22.66 s), which was 3.35 times that of healthy wild-type mice (196.66±5.66 s). Figure 4 ,d). R75*mouse F9 The mRNA expression of the gene was significantly reduced. Figure 4 This is due to the presence of the PTC site, which triggers the nonsense-mediated mRNA degradation pathway (NMD pathway).
[0087] Principal component analysis of the transcriptome also indicated significant differences in gene expression patterns between R75* mice and wild-type mice. Figure 5 (a) The gene expression correlation heatmap showed that the gene expression patterns were similar among the three mice in the same group. Figure 5 (b) Data quality control was satisfactory. The volcano plot of the transcriptome analysis showed that, compared to wild-type mice, R75* mice had 351 upregulated genes and 188 downregulated genes. Figure 5 c). Relevant genes were screened and clustered, among which, R75* mice compared with wild-type mice, F8 Genes and F2R Increased gene expression levels reveal the compensatory and feedback regulatory mechanisms of the coagulation cascade pathway. GO enrichment indicates that related genes play functions in coagulation, osteoclast differentiation, and inhibition of MHC receptor activity. Figure 5 ,d).
[0088] In addition, the levels of red blood cells (RBC) and hemoglobin (HGB) in the routine blood tests indicated anemia in the R75* mice due to repeated bleeding. Figure 6 ).
[0089] Example 4: Validation of the therapeutic effect of AAV-Recover on R75* mouse model of hemophilia B Both AAV-Recover and AAV-full long were constructed by Heyuan Biotechnology, with serotypes rAAV2 / 8, and target the liver. Among them, AAV-Recover carries Arg-stRNA (i.e., R5 shown in SEQ ID NO:21 above). -UGA ), followed by Luc; AAV-full long carries F9 The full-length coding gene (SEQ ID NO:26, excluding the stop codon) was followed by Luc (SEQ ID NO:27). The efficacy of AAV delivery of stRNA to restore endogenous + expression and direct delivery of the full-length gene was objectively and rationally evaluated. R75* male rats were injected intravenously with AAV-Recover (Group A) and AAV-full long (Group B) at eight weeks of age. Blood and liver samples were collected at 6 and 12 weeks for testing. Because the target gene was followed by Luc, fluorescein potassium was injected periodically to observe AAV expression. Both groups of AAV were specifically delivered to the liver. The overall expression level in the GA group was lower than that in the GB group. The GA group reached its peak expression level at 6 weeks, after which AAV expression gradually decreased; the GB group reached its peak expression level at 8 weeks. AAV expression was still detectable in both groups until 12 weeks. Figure 7 (c) After tail amputation, the GA and GB groups showed significantly less bleeding and significantly less clotting time compared to the untreated R75* group. Figure 7 d, e, f). Detecting FIXa activity, activated partial thromboplastin time (APTT) is one of the most critical evaluation indicators of coagulation disorders. Plasma samples were tested at 12 weeks. The time taken in both the GA and GB groups was lower than that in the untreated group, with the GA group being closer to wild-type levels. Figure 7 (g, h). Western blot analysis of liver tissue revealed significantly elevated levels of histone expression in GA (g, h). Figure 7 (i, j). Overall, after AAV-Recover injection, R75* mice recovered. F9 Protein expression enhances FIXa activity, and endogenous restoration of expression is also an effective strategy compared to full-length gene delivery.
[0090] AAV delivery F9The essence of full-length gene therapy is to replenish exogenous proteins, while stRNA, by activating the cell's endogenous translation mechanism, enables the mutated gene to restore its own full-length protein synthesis, essentially repairing endogenous function. This study is the first to demonstrate that a pathway therapy strategy mediated by arginine-stRNA can achieve full-length exogenous protein delivery in R75* mice. F9 The comparable therapeutic effect provides a novel approach for the precise repair of mutated genes. Our experiments demonstrate that restoring endogenous gene expression via stRNA is a promising treatment for hepatitis B. F9 Precise gene repair replaces exogenous gene supplementation, overturning traditional treatment logic.
[0091] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention. The patent protection scope of the present invention should be determined by the described claims.
[0092] The following prior art is incorporated herein by reference in its entirety: 1 Young, G. et al. Efficacy and safety of fitusiran prophylaxis in people with haemophilia A or haemophilia B with inhibitors (ATLAS-INH): amulticentre, open-label, randomized phase 3 trial. Lancet 401, 1427-1437(2023). https: / / doi.org / 10.1016 / s0140-6736(23)00284-2 2 Morris, JJ et al. Factor IXa and factor 3 Bos, M. H. A., van Diest, R. E.&Monroe, D. M. Blood coagulationfactor IX: structural insights impacting hemophilia B therapy. Blood 144,2198-2210 (2024). https: / / doi.org / 10.1182 / blood.2023023276 4 Sarangi, P. et al. AAV mediated genome engineering with a bypasscoagulation factor alleviates the bleeding phenotype in a murine model ofhemophilia B. Thrombosis Research 238, 151-160 (2024). https: / / doi.org / 10.1016 / j.thromres.2024.04.031 5 Nathwani, A. C. Gene therapy for hemophilia. Hematology Am SocHematol Educ Program 2022, 569-578 (2022). https: / / doi.org / 10.1182 / hematology.2022000388 6 Kavakli, K. et al. Health-related quality of life in adults withhemophilia B after gene therapy with fidanacogene elaparvovec: results fromthe BENEGENE-2 trial. J Thromb Haemost (2025). https: / / doi.org / 10.1016 / j.jtha.2025.09.029 7 Simioni, P. et al. X-linked thrombophilia with a mutant factor IX(factor IX Padua). N Engl J Med 361, 1671-1675 (2009). https: / / doi.org / 10.1056 / NEJMoa0904377 8 Pipe, S. W. et al. Gene Therapy with Etranacogene Dezaparvovec forHemophilia B. N Engl J Med 388, 706-718 (2023). https: / / doi.org / 10.1056 / NEJMoa2211644 9 Anguela, X. M.&High, K. A. Hemophilia B and gene therapy: a newchapter with etranacogene dezaparvovec. Blood Adv 8, 1796-1803 (2024).https: / / doi.org / 10.1182 / bloodadvances.2023010511 10 Dou, D. et al. Preclinical Evaluation of AAV8-R338L Gene Therapyfor Hemophilia: Efficacy, Pharmacokinetics, Distribution, Excretion andToxicity in Mouse Models and Non-human Primates. Pharm Res 42, 1717-1732(2025). https: / / doi.org / 10.1007 / s11095-025-03918-z 11 Aaen, K. H. et al. Tailored collagen binding of albumin-fusedhyperactive coagulation factor IX dictates in vivo distribution andfunctional properties. Nat Commun 16, 8433 (2025). https: / / doi.org / 10.1038 / s41467-025-62955-9 12 He, X. et al. Low-dose AAV-CRISPR-mediated liver-specific knock-inrestored hemostasis in neonatal hemophilia B mice with subtle antibodyresponse. Nat Commun 13, 7275 (2022). https: / / doi.org / 10.1038 / s41467-022-34898-y 13 Li, H. et al. Engineering a photoactivatable A-to-I RNA baseeditor for gene therapy in vivo. Nat Biotechnol (2025). https: / / doi.org / 10.1038 / s41587-025-02610-2 14 Liu, H. et al. A precision gene-engineered B cell medicineproducing sustained levels of active factor IX for hemophilia B therapy. MolTher (2025). https: / / doi.org / 10.1016 / j.ymthe.2025.09.001 15 Baatartsogt, N. et al. Therapeutic base editing to generate again-of-function F9variant for hemophilia B. Blood (2024). https: / / doi.org / 10.1101 / 2024.11.13.623331 16 Reiss, U. M. et al. Sustained Clinical Benefit of AAV Gene Therapyin Severe Hemophilia B. N Engl J Med 392, 2226-2234 (2025). https: / / doi.org / 10.1056 / NEJMoa2414783 17 Thornburg, C. D., Simmons, D. H.&von Drygalski, A. Evaluating GeneTherapy as a Potential Paradigm Shift in Treating Severe Hemophilia. BioDrugs37, 595-606 (2023). https: / / doi.org / 10.1007 / s40259-023-00615-4 18 Ma, Y. et al. Generation of an mESC model with a human hemophiliaB nonsense mutation via CRISPR / Cas9 technology. Stem Cell Res Ther 13, 353(2022). https: / / doi.org / 10.1186 / s13287-022-03036-2
Claims
1. The application of a premature stop codon (PTC) decoding reagent in the preparation of hemophilia treatment drugs, characterized in that, The hemophilia mentioned is a gene encoding clotting factors. F9 Hemophilia B caused by nonsense mutations; the decoding reagent is a natural or artificial stRNA, and it is capable of reading genes encoding coagulation factors. F9 PTC is caused by nonsense mutation.
2. The application of the early stop codon (PTC) decoding reagent as described in claim 1 in the preparation of hemophilia treatment drugs, characterized in that, The anticodon loop of the natural or artificial stRNA is complementary to the PTC generated by a nonsense mutation in the coagulation factor; the amino acids carried by the natural or artificial stRNA are related to the gene encoding the coagulation factor mutation. F9 The wild-type coding gene corresponding to the PTC codon F9 The codons encode the same or different amino acids.
3. The application of the early stop codon (PTC) decoding reagent as described in claim 1 in the preparation of hemophilia treatment drugs, characterized in that, The gene encoding the clotting factor in hemophilia B F9 The nonsense mutations are nonsense mutations of coagulation factor IX, including one or more nonsense mutations selected from the amino acid coding sequences of coagulation factor IX at positions 75, 96, 103, 118, 141, 142, 152, 184, 237, 253, 312, 325, 371, 406, 420, and 431 to become stop codons.
4. The application of the early stop codon (PTC) decoding reagent as described in claim 3 in the preparation of hemophilia treatment drugs, characterized in that, The nonsense mutation is a mutation in the coding sequence of arginine at position 75 of coagulation factor IX to a stop codon. Preferably, the coding sequence of arginine at position 75 of coagulation factor IX is mutated from wild-type CGA to TGA.
5. The application of the early stop codon (PTC) decoding reagent as described in claim 4 in the preparation of hemophilia treatment drugs, characterized in that, The natural or artificial stRNA can read the gene encoding the coagulation factor IX mutation. F9 PTC at the coding sequence of arginine at position 75 generates a functional coagulation factor IX; preferably, the natural or artificial stRNA is selected from the group consisting of SEQ ID NO: 1, 17-23.
6. The use of the early stop codon (PTC) decoding reagent as described in any one of claims 1-5 in the preparation of hemophilia treatment drugs, characterized in that, The stRNA is delivered into the cell via a vector, preferably an AAV viral vector, including but not limited to rAAV2 / 8 serotype AAV viral vectors.
7. A method for screening therapeutic drugs for hemophilia targeting non-homogeneous mutation subtypes of coagulation factors, comprising the following steps: (1) Obtain nucleic acid encoding mutant coagulation factor containing PTC site from hemophilia patients; (2) The EGFP coding region is ligated to the 3' end of the mutant coagulation factor encoding nucleic acid containing the PTC site to obtain a plasmid containing the coagulation factor-PTC-EGFP fusion expression cassette; (3) Co-transfect the plasmid containing the stRNA expression cassette and the plasmid containing the coagulation factor-PTC-EGFP fusion expression cassette constructed in step (2) into eukaryotic host cells; (4) Detect green fluorescence signal and screen cells that can produce green fluorescence, wherein the transfected stRNA is an active stRNA molecule that can read the PTC on the nucleic acid encoded by the mutant coagulation factor; (5) Prepare hemophilia treatment drugs with nonsense mutation subtypes of the coagulation factor from the stRNA obtained in step (4).
8. The method for screening therapeutic drugs for hemophilia targeting nonsense mutation subtypes of coagulation factors as described in claim 7, characterized in that, Nonsense mutation subtypes of coagulation factors include one or more nonsense mutations selected from the amino acid coding sequences of coagulation factor IX at positions 75, 96, 103, 118, 141, 142, 152, 184, 237, 253, 312, 325, 371, 406, 420, and 431 to be mutated into stop codons.
9. The method for screening therapeutic drugs for hemophilia targeting non-homogeneous mutation subtypes of coagulation factors as described in claim 7, wherein step (4) further comprises: Step (4.1): Construct an animal model with the nonsense mutation subtype of the coagulation factor; Step (4.2) uses the animal model constructed in step (4.1) to evaluate the therapeutic effect of the stRNA obtained from the screening on hemophilia with the nonsense mutation subtype of the coagulation factor.
10. The method for screening therapeutic drugs for hemophilia targeting nonsense mutation subtypes of coagulation factors as described in claim 7, wherein step (5) further includes preparing a drug formulation capable of delivering the stRNA into cells using a suitable vector; the suitable vector is preferably a viral vector, including but not limited to rAAV2 / 8 serotype AAV viral vectors.
11. The application of a non-sense mutant mouse model of coagulation factors in screening and identifying drugs for the treatment of hemophilia, characterized in that, The coagulation factor nonsense mutant mouse is the gene encoding the coagulation factor. F9 Genetically engineered mice with a premature stop codon (PTC) are produced by mutation; these mice exhibit reduced expression and / or decreased function of coagulation factors, resulting in coagulation dysfunction.
12. The application of the nonsensical mutant mouse model of coagulation factors as described in claim 11 in screening and identifying drugs for the treatment of hemophilia, characterized in that, The coagulation factor nonsense mutant mice are genetically engineered mice and their homozygous offspring in which the coding sequence of coagulation factor IX at position 75 (arginine) is mutated to the premature stop codon PTC using gene editing technology; preferably, the coagulation factor IX coding gene is modified using CRISPR / Cas technology. F9 The homozygous mice were generated by replacing C with T at position 223.
13. The application of the nonsensical mutant mouse model of coagulation factors as described in claim 11 in screening and identifying drugs for the treatment of hemophilia, characterized in that, Candidate stRNAs were administered to mice with coagulation factor nonsense mutants, and the therapeutic effect of the candidate stRNAs on the coagulation factor nonsense mutant hemophilia was evaluated by the restoration of coagulation factor expression and / or function and the relief of coagulation dysfunction.
14. The application of the nonsensical mutant mouse model of coagulation factors as described in claim 13 in screening and identifying drugs for the treatment of hemophilia, characterized in that, The candidate stRNA is obtained by the method described in claim 7 and is capable of reading the mutant coagulation factor encoding gene. F9 Active stRNA molecules of PTC.