Schizochytrium sp. strain for producing dha and astaxanthin and preparation method and application thereof
Through multi-level precise metabolic engineering and targeted domestication methods, the bottleneck of astaxanthin synthesis in Schizochytrium fungi was solved, achieving synergistic high yield of DHA and astaxanthin. This breakthrough overcomes the limitations of traditional screening methods, achieving internationally leading astaxanthin yield and stable DHA yield, reducing industrial costs, and endowing the product with natural antioxidant protection functions.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-11
- Publication Date
- 2026-05-29
AI Technical Summary
Existing technologies struggle to systematically, predictably, and efficiently enhance the astaxanthin synthesis capacity of Schizochytrium without compromising its high DHA production capacity, thus achieving synergistic high yields. Furthermore, existing methods suffer from high randomness, poor reproducibility, and difficulty in scaling up.
A multi-level precision metabolic engineering approach was adopted for synergistic targeted domestication. The basic mutant strain A01 was screened using ARTP mutagenesis technology. The tHMG1, IDI, and ArGPS genes were introduced to enhance the biosynthetic flux of farnesyl pyrophosphate and gerany pyrophosphate. The SpCrtYB and SpCrtI genes were combined to improve the β-carotene synthesis efficiency. The double-copy HpCrtW and HpCrtZ genes were used to overcome the rate-limiting step of astaxanthin ketosis. Finally, high astaxanthin production was achieved through targeted domestication of β-ionone.
It has achieved a leap in astaxanthin production from less than 0.5 mg/L in the wild type to 1506 mg/L, reaching the international leading level, while maintaining stable DHA production. It has achieved "dual high-yield synergy" of DHA and astaxanthin, reduced industrialization costs, and endowed the final product with natural antioxidant protection function.
Smart Images

Figure CN122104446A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically to a Schizochytrium strain for producing DHA and astaxanthin, its preparation method, and its application. Background Technology
[0002] The information disclosed in the background section of this invention is intended only to enhance the understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.
[0003] Schizochytrium ( Aurantiochytrium Algal microalgae (species sp.) are a type of marine heterotrophic microalgae with significant industrial value. Due to their high biomass, abundant oil content (over 50% of cell dry weight), excellent docosahexaenoic acid (DHA) yield, and ease of large-scale heterotrophic fermentation, they have become the mainstream microbial cell factory for DHA production, replacing fish oil. The application of their produced DHA in the food industry is relatively mature, with DHA algal oil used in infant formula and milk powder. The application of DHA as feed in aquaculture and animal husbandry also has enormous market potential.
[0004] In addition to DHA, Schizochytrium naturally contains trace amounts of carotenoids, including beta-carotene, canthaxanthin, and astaxanthin. Astaxanthin, in particular, is a potent natural ketocarotenoid with antioxidant capabilities far exceeding those of vitamin E and coenzyme Q10. It possesses significant anti-inflammatory, eye-protecting, liver-protecting, and lipid-regulating physiological functions, and is widely used in high-value-added markets such as high-end health products, cosmetics, pharmaceuticals, and aquaculture feed. Global market demand continues to grow rapidly.
[0005] Theoretically, Schizochytrium possesses the metabolic potential to synthesize both DHA and astaxanthin simultaneously. Achieving synergistic high-yield synthesis of both would bring revolutionary advantages. However, a significant practical bottleneck exists: wild-type Schizochytrium produces extremely low astaxanthin yields, far from meeting the demands of industrial production. Existing technological approaches face two fundamental dilemmas: First, using natural selection, strain SC01, obtained through conventional screening methods, can synthesize astaxanthin in the dark, but its yield remains only at the original level of 0.3-0.5%. The metabolic network of this strain has not been systematically modified, limiting its optimization potential, and technological development has stagnated. Second, relying on random mutagenesis, using ion beam mutagenesis combined with flow cytometry sorting, a mutant strain CABIO-A-2-III with an astaxanthin content increased to 2.5% has been obtained. However, this method is essentially non-directional physical mutagenesis, with a highly random and unpredictable mutation process, leading to global variations in the genome. This method lacks rational design and precise regulation of metabolic pathways, the direction of mutation cannot be controlled, it is easy to introduce unfavorable traits such as growth defects, and the experimental results have poor reproducibility, making it difficult to achieve large-scale expansion and engineering application.
[0006] In summary, the core challenge of current technology lies in how to systematically, predictably, and efficiently enhance the astaxanthin synthesis capacity of Schizochytrium without compromising its high DHA production capacity, thereby achieving synergistic high yield. Existing methods are either limited to naturally occurring low-yielding strains or rely on highly random screening, neither of which can achieve precise control over carbon flux allocation, let alone overcome the metabolic conflict between the "astaxanthin synthesis bottleneck" and "DHA production maintenance." Summary of the Invention
[0007] In view of this, the present invention provides a Schizochytrium strain for producing DHA and astaxanthin, its preparation method, and its applications. The present invention provides a Schizochytrium strain that overcomes the limitations of existing technologies and possesses significant innovation. The core of the present invention lies in abandoning the traditional approach of relying on random screening and creatively constructing a new paradigm for systematic strain modification through "multi-level precise metabolic engineering and synergistic directional domestication."
[0008] To achieve the above objectives, the present invention is implemented through the following technical solution: In a first aspect, the present invention provides a Schizochytrium strain for producing DHA and astaxanthin, wherein the Schizochytrium strain is classified and named Schizochytrium. Aurantiochytrium sp. AST-02 was deposited on August 22, 2025 at the China Center for Type Culture Collection (CCTCC, No. 299 Bayi Road, Wuchang District, Wuhan, Hubei Province, 430072, China), with accession number CCTCC NO: M20251885.
[0009] The Schizochytrium strain provided by this invention can simultaneously synthesize DHA and astaxanthin, achieving high yield through synergistic effects. This results in: (1) efficient resource utilization: the same strain and the same fermenter can simultaneously produce two high-value components, significantly reducing the overall cost of raw materials, equipment, and energy; (2) improved product stability: astaxanthin, as a powerful natural antioxidant, can effectively protect DHA from oxidative degradation, greatly improving the oxidative stability and shelf life of oil products; (3) integrated product functions: the compound oil rich in DHA and astaxanthin can be directly developed into a "one-dose-multiple-effects" nutrient product, meeting the urgent demand of modern health consumers for multifunctional and high-purity components. This strain has completely broken through the technical bottleneck of traditional microbial cell factories that "produce a single high-value component," realizing a paradigm shift from "experience-based screening" to "rational design."
[0010] In a second aspect, the present invention provides a method for preparing the Schizochytrium strain described in the first aspect, comprising the following steps: (1) Basic mutagenesis: The wild-type Schizochytrium strain was preliminarily screened using ARTP mutagenesis technology to obtain the basic mutant strain A01 with increased astaxanthin production. (2) Simultaneous expression of three key genes from yeast (tHMG1), Escherichia coli (IDI), and archaea (ArGPS) enhanced the biosynthetic flux of farnesyl pyrophosphate and geraniol geraniol pyrophosphate, resulting in B01; (3) Introducing from Sporidiobolus pararoseus The SpCrtYB and SpCrtI genes efficiently and stably convert geraniol pyrophosphate into β-carotene to obtain B02; (4) The HpCrtW and HpCrtZ genes from Haematococcus pluvialis were introduced using the double-copy HpCrtW construction strategy to obtain B03; (5) Based on the above genetic engineering modification, β-ionone was used as the selection pressure, and through multiple rounds of targeted domestication with gradient increasing concentrations, the Schizochytrium strain was successfully screened. Aurantiochytrium sp. AST-02.
[0011] The preparation method of this invention employs ARTP mutagenesis technology to obtain the basic mutant strain A01 with enhanced astaxanthin yield, providing an excellent genetic background for subsequent engineering modification. Based on a deep understanding of the astaxanthin biosynthetic pathway, modular, multi-gene, and synergistic precise enhancement is performed. Specifically, by simultaneously expressing three key genes—tHMG1 from yeast, IDI from Escherichia coli, and ArGPS from archaea—the biosynthetic flux of the key precursors of astaxanthin synthesis, farnesyl pyrophosphate (FPP) and geranylgeranyl pyrophosphate (GGPP), is directionally enhanced, effectively "guiding" the metabolic flux from the competitive fatty acid synthesis pathway to the carotenoid synthesis pathway; by introducing genes from... Sporidiobolus pararoseusThe SpCrtYB and SpCrtI genes efficiently and stably convert GGPP into β-carotene, overcoming the bottleneck of low efficiency in this pathway in Schizochytrium itself. The HpCrtW and HpCrtZ genes from Haematococcus pluvialis were introduced, and a key strategy of constructing a double-copy HpCrtW was adopted to specifically overcome the rate-limiting bottleneck of the ketation step in the conversion of β-carotene to astaxanthin, achieving efficient accumulation of the final product. Targeted environmental domestication using β-ionone effectively overcomes naturally occurring feedback inhibition mechanisms, further releasing the suppressed synthetic potential after genetic engineering, ultimately yielding a high-yield strain of astaxanthin and DHA.
[0012] Furthermore, in step (1), multiple ARTP mutagenesis treatments are performed; preferably three times. Further, in step (1), the specific operation of ARTP mutagenesis treatment is as follows: First, prepare a bacterial suspension, then transfer the bacterial suspension to the ARTP operating chamber, adjust the distance between it and the plasma generator jet outlet to 2-3 mm, set the gas flow rate to 8-12 SLM, set the power to 100-200 W, control the time to 10-60 s, then wash it to the seed culture medium, revive it overnight at 25 ℃, dilute the bacterial solution and spread it on a solid culture medium for culture, and then screen it.
[0013] Further, in step (2), specifically: the plasmid backbone containing the promoter pEF1 and the terminator tCYC1 is amplified using primer gu-F / R; tHMG1, IDI, ArGPS and HygB fragments are amplified using primers tHMG1-F / R, IDI-F / R, ArGPS-F / R and hygB-F / R, respectively; the amplified fragments are assembled in one step to obtain the vector pWKH-pEF1-tHMG1-IDI-ArGPS-HygB-tCYC1; different genes are linked using F2A, E2A and P2A peptide sequences; the vector pWKH-pEF1-tHMG1-IDI-ArGPS-HygB-tCYC1 is electroporated into the mutagenized strain A01, incubated, and screened to obtain B01.
[0014] This design achieved a new metabolic flux regulation paradigm in Schizochytrium, shifting from "passive accumulation" to "active guidance": instead of gene knockout, it actively attracts upstream "sources" (FPPs) by overexpressing downstream "sinks" (ArGPS), thereby precisely overcoming the precursor bottleneck in carotenoid synthesis without interfering with high DHA production. The surge in astaxanthin production validates the core role of this FPP / GGPP synergistic enhancement module in resolving the carbon flux competition conflict.
[0015] Further, in step (3), specifically: the backbone containing the promoter pActin and the terminator tActin is amplified using primer gu-F1 / R1, and the SpCrtYB, SpCrtI, and neo fragments are amplified using primers SpCrtYB-F / R, SpCrtI-F / R, and neo-F / R, respectively. The above fragments are assembled to obtain the vector pWKN-pActin-SpCrtYB-SpCrtI-neo-tActin. The genes are ligated using E2A and P2A, incubated, and screened to obtain B02.
[0016] This step introduces SpCrtYB and SpCrtI, which solves the inherent defect of weak β-carotene synthesis in Schizochytrium, further increasing astaxanthin production and verifying the synergistic effect of the intermediate module.
[0017] Further, in step (4), specifically: the plasmid backbone containing promoter pEF1 and terminator tCYC1 is amplified using primer gu-F / R, and HpCrtW, HpCrtZ and HpCrW1 fragments are amplified using primers HpCrW-F / R, HpCrtZ-F / R and HpCrW-F1 / R1 respectively, wherein HpCrtW has two copies. The amplified fragments are assembled in one step, and the plasmid pWKZ-pEF1-HpCrtW-HpCrtZ-HpCrtW-Zeo-tCYC1 is cloned. Different genes are linked using F2A, E2A and P2A peptide sequences, incubated, screened, and B03 is obtained.
[0018] This step employs a dual-copy HpCrtW construction strategy, which specifically addresses the rate-limiting step in astaxanthin synthesis, resulting in an explosive increase in astaxanthin production.
[0019] Furthermore, in step (5), the acclimatization process is carried out in three rounds; the gradient concentration is 50-500 mg / L, preferably 50 mg / L, 100 mg / L, and 200 mg / L.
[0020] Using β-ionone as selection pressure, the high-yielding astaxanthin-producing strain B03, modified by metabolic engineering, underwent multiple rounds of targeted acclimatization with progressively increasing concentrations. Based on the characteristic of β-ionone as a feedback inhibitor of the carotenoid synthesis pathway, mutants that could maintain the red phenotype (i.e., overcome feedback inhibition) were successfully screened on a medium containing the inhibitor, resulting in the successful acquisition of the high-yielding astaxanthin-producing strain C03.
[0021] Thirdly, the present invention provides the application of the Schizochytrium strain described in the first aspect in the synergistic high production of DHA and astaxanthin.
[0022] Furthermore, the DHA yield is ≥ 34 g / L, and the astaxanthin yield is ≥ 650 mg / L.
[0023] Fourthly, the present invention provides a method for synergistic high-yield production of DHA and astaxanthin, comprising fermenting DHA and astaxanthin using the Schizochytrium strain described in the first aspect.
[0024] Further, the specific steps of the method are as follows: after activating the Schizochytrium strain on a solid culture medium, transferring it to a primary seed culture medium and a secondary seed culture medium, fermenting it on a fermentation culture medium to prepare DHA and astaxanthin.
[0025] Further, the primary seed solution comprises: 5-15 g / L glucose, 15-25 g / L yeast extract, and 10-20 g / L sea salt; the secondary seed solution comprises: 55-65 g / L glucose, 15-25 g / L yeast extract, and 10-20 g / L sea salt.
[0026] Furthermore, the fermentation medium comprises: 45-55 g / L glucose, 8-10 g / L yeast extract, 25-35 g / L monosodium glutamate, and 15-25 g / L sea salt; the culture conditions are: culture temperature 25 ℃, culture time 100-140 h, rotation speed 200-600 rpm, pH 5.0-5.5, dissolved oxygen 20-30%, and glucose is added in batches. Alternatively, use 55-65 g / L glucose, 15-25 g / L yeast extract, 90-110 μM ferrous sulfate heptahydrate, and 5-15 g / L sea salt. Transfer the secondary seed culture to the fermenter at an inoculum rate of 8-12%. Incubate at 25℃ for 100-140 hours, with a rotation speed of 200-600 rpm, pH 5.0-5.5, and dissolved oxygen at 20-30%. Add glucose in batches. Alternatively, use 110-130 g / L glucose, 3-5 g / L yeast extract, 3-7 g / L corn steep liquor powder, 2-5 g / L ammonium sulfate, 1-3 g / L magnesium sulfate, 5-7 g / L sodium glutamate, 3-5 g / L potassium dihydrogen phosphate, and 10-20 g / L sea salt. Transfer the secondary seed culture to the fermenter at an inoculum rate of 8-12%. Incubate at 25 ℃ for 100-140 h at a rotation speed of 200-600 rpm, pH 6.0-6.5, and dissolved oxygen 20-30%. Add glucose in batches. Alternatively, use 70-90 g / L glucose, 7-9 g / L yeast extract, 1-2 g / L potassium sulfate, 3-5 g / L magnesium sulfate heptahydrate, 0.1-0.2 g / L potassium dihydrogen phosphate, 0.05-0.1 g / L calcium chloride, and 10-20 g / L sea salt. Transfer the secondary seed culture to the fermenter at an inoculum rate of 8-12%. Incubate at 25 ℃ for 100-140 h at a rotation speed of 200-600 rpm, pH 5.0-6.0, and dissolved oxygen 20-30%. Control the glucose concentration in the fermentation broth to 4-6 g / L by feeding glucose. Alternatively, use 70-90 g / L glucose, 7-9 g / L yeast extract, 1-2 g / L potassium sulfate, 3-5 g / L magnesium sulfate heptahydrate, 0.1-0.2 g / L potassium dihydrogen phosphate, 0.05-0.1 g / L calcium chloride, and 10-20 g / L sea salt. Transfer the secondary seed culture to the fermenter at an inoculum rate of 8-12%. Incubate at 20 ℃ for 100-140 h at a rotation speed of 200-600 rpm, pH 5.0-6.0, and dissolved oxygen 10-15%. Control the glucose concentration in the fermentation broth to 2-3 g / L by feeding glucose.
[0027] Furthermore, the DHA yield is ≥34 g / L and the astaxanthin yield is ≥650 mg / L.
[0028] Fifthly, the present invention provides a DHA-astaxanthin complex oil, wherein the oil content is greater than or equal to 45%, the DHA yield is ≥34 g / L, and the astaxanthin yield is ≥650 mg / L.
[0029] Compared with the prior art, the present invention has achieved the following beneficial effects: (1) This invention adopts a synergistic modification paradigm of "multi-level precise metabolic engineering + targeted environmental domestication" to achieve a revolutionary breakthrough in astaxanthin production. This invention abandons the traditional random mutagenesis and inefficient screening path and innovatively constructs a four-step progressive metabolic engineering system of "precursor enhancement → intermediate supplementation → rate-limiting breakthrough of final product → relief of feedback inhibition". By modularly and precisely expressing tHMG1, IDI, ArGPS (enhancing FPP / GGPP precursor), SpCrtYB / SpCrtI (efficiently synthesizing β-carotene) and dual-copy HpCrtW-HpCrtZ (breaking through the rate-limiting step of astaxanthin ketosis), and combining β-ionone gradient domestication to relieve natural feedback inhibition, the astaxanthin production was finally increased from less than 0.5 mg / L in wild type to 1506 mg / L, an increase of more than 3000 times, reaching the international leading level.
[0030] (2) This invention achieves "dual high-yield synergy" of DHA and astaxanthin, solving the metabolic competition problem. While achieving a historic breakthrough in astaxanthin production, the strain of this invention completely retains and maintains the inherent high DHA synthesis capacity of Schizochytrium, with a stable DHA yield of up to 34 g / L under optimized fermentation conditions. This characteristic of "high astaxanthin production without sacrificing DHA" is a major breakthrough never achieved in the prior art, proving that the metabolic pathway modification of this invention has high specificity and precision, successfully solving the long-standing carbon flow competition contradiction between carotenoid and fatty acid synthesis pathways, and providing a replicable engineering paradigm for "one strain with dual high yields".
[0031] (3) This invention constructs an integrated production system of "single strain, single tank, and no light," which significantly reduces industrialization costs. The strain of this invention is fully adapted to the industrial production environment of high-density, lightless, heterotrophic fermentation, without relying on expensive photobioreactors or additional culture conditions. It can simultaneously produce high-purity DHA and astaxanthin in a single fermenter, realizing the integration of raw materials, equipment, energy consumption, purification, and downstream processing. The comprehensive production cost per unit product can be significantly reduced compared to the traditional "two strains separate production" model, greatly improving the industrial economy and scalability.
[0032] (4) It endows the final product with natural antioxidant protection function, creating a new track for high-end nutritional products with "one dose, multiple effects". Astaxanthin, as one of the strongest natural antioxidants in nature, can effectively inhibit the oxidative degradation of DHA during extraction, storage and application, and significantly improve the oxidative stability and shelf life of DHA algal oil. The resulting DHA-astaxanthin complex oil is not only natural and highly pure, but also has multiple physiological functions such as "brain health + eye health + anti-inflammatory and liver protection". It can be directly developed into a new generation of high-end nutritional supplements with "one dose, multiple effects", infant formula, functional cosmetics and aquaculture feed, precisely targeting the global health consumer market worth tens of billions. Attached Figure Description
[0033] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.
[0034] Figure 1 Liquid chromatography images of astaxanthin and its carotenoids from mutant strain A01; Figure 2 This describes the metabolic pathway of astaxanthin synthesis in Schizochytrium. Figure 3 The pWKH-pEF1-tHMG1-IDI-ArGPS-hygB-tCYC1 plasmid map; Figure 4The pWKN-pActin-SpCrtYB-SpCrtI-neo-tActin plasmid map; Figure 5 The plasmid map of pWKZ-pEF1-HpCrtW-HpCrtZ-HpCrtW-Zeo-tCYC1; Figure 6 The astaxanthin content is for different strains. Detailed Implementation
[0035] It should be noted that the following detailed descriptions are exemplary and intended to provide further illustration of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0036] The culture medium involved in this invention is as follows: Seed liquid culture medium: 10 g / L glucose, 20 g / L yeast extract, 15 g / L sea salt.
[0037] Solid culture medium: 10 g / L glucose, 20 g / L yeast extract, 10 g / L sea salt, 10 g / L agar.
[0038] Shake-flask fermentation liquid culture medium: 60 g / L glucose, 20 g / L yeast extract, 15 g / L sea salt.
[0039] Pigment extraction methods and detection: (1) Take 10 mL of fermentation broth into a 15 mL centrifuge tube (weigh), centrifuge at 5000 rpm for 5 min at 4 ℃, discard the supernatant, and pre-freeze at -80 ℃ for more than 30 min; (2) Place the sample in a freeze-drying oven and freeze-dry overnight; (3) Weigh the sample and calculate the dry weight of the cells; (4) Take a portion of the bacterial cells and grind them in liquid nitrogen. Repeat this process at least three times to ensure complete cell disruption. (5) Weigh 200 mg of the ground bacterial powder into a 5 mL centrifuge tube, add 2-3 mL of acetone, shake thoroughly to extract, let stand, and then filter the upper layer. (6) HPLC detection and calculation of astaxanthin concentration.
[0040] Oil extraction methods and testing: (1) Take 2 mL of fermentation broth into a 2 mL centrifuge tube (weigh), centrifuge at 12000 rpm for 1 min, remove the supernatant, and after a short centrifugation, open the cap of the centrifuge tube and place it at -80 ℃ for at least 30 min to pre-freeze. (2) Place the sample in a freeze dryer and freeze overnight; (3) Take out the sample, weigh it, and calculate the dry weight of the bacterial cells; (4) Take 40-50 mg of bacterial cells, add 600 μL of 1 M HCl, shake to mix, let stand for 30 min, boil in water for 5 min, then freeze at -80 ℃ for 5 min, and repeat once. (5) After the temperature returns to room temperature, add 900 μL of chloroform-methanol mixture (2:1), shake to mix, centrifuge at 12000 rpm for 3 min, take the lower organic phase into a new 2 mL centrifuge tube, add 600-750 μL of saturated sodium chloride, shake to mix, centrifuge at 12000 rpm for 3 min. (6) Use a 200 μL pipette tip to transfer the lower oil phase into a 10 mL glass bottle (weighed beforehand), and vacuum dry at 55 ℃ for 2-2.5 h; (7) After the temperature returns to room temperature, weigh and calculate the total amount of oil, add 1 mL of chloroform and 2.5 mL of sulfuric acid-methanol mixture (2% sulfuric acid), cap and methyl esterify at 85 °C for 1-2.5 h; (8) After returning to room temperature, open the lid, add 3 mL of n-hexane and 3 mL of saturated sodium chloride, mix vigorously and extract, and let stand until the layers are completely separated; (9) Take 1 mL of the upper organic phase and filter it into a sample vial; (10) GC-MS detection.
[0041] The technical solution of the present invention will be further described below with reference to specific embodiments.
[0042] Example 1 Schizochytrium can synthesize astaxanthin, but in extremely low amounts. Using ARTP multi-round mutagenesis technology, astaxanthin was synthesized... Aurantiochytrium Mutagenesis of sp. sdu080 was used to enhance the ability of Schizochytrium to synthesize astaxanthin in the basal stage. The specific process is as follows: (1) Preparation of bacterial suspension: Aurantiochytrium sp. sdu080 was inoculated into seed culture medium, incubated overnight at 25°C, centrifuged to collect the culture, washed twice with physiological saline, and resuspended in physiological saline to allow its OD to adjust. 600 Between 0.6 and 0.8; (2) ARTP mutagenesis treatment: The bacterial suspension was evenly spread onto the surface of a sterile slide and transferred to the ARTP operating chamber. The position of the sample was adjusted so that the distance between it and the jet outlet of the plasma generator was about 2-3 mm. The gas flow rate was set to 8-12 SLM, the power to 100-200 W, and the time to 10-60 s. The treated sample was eluted into seed culture medium and incubated overnight at 25 ℃. The bacterial suspension was then diluted 10 times. 2 After dilution, spread the mixture onto a solid culture medium and incubate until a single colony grows.
[0043] (3) Preliminary screening: Single colonies were selected from the plates, and each independent single colony was activated and transferred to a new solid culture medium for further isolation to obtain single colonies with high purity. Colonies with redder color were selected for liquid fermentation culture, and the pigment was extracted after collecting the cells. The concentration of astaxanthin was detected by HPLC. The preliminary screening found that 5 strains had high astaxanthin content.
[0044] (4) Secondary screening: The strains obtained from the initial screening are subjected to stability tests. The fermentation performance of the strains is evaluated through multiple fermentations, and finally a strain with better stability is selected.
[0045] (5) Multiple rounds of mutagenesis: Following the above procedures, the strains obtained from the secondary screening were subjected to a second round of ARTP mutagenesis. After primary and secondary screening, a better strain was obtained. Then, a third round of ARTP mutagenesis was performed, and finally a strain A01 with high astaxanthin content was selected (product chromatogram is shown in...). Figure 1 The yield was 0.5 mg / L.
[0046] In this embodiment, strain A01 (astaxanthin 0.5 mg / L) was obtained through ARTP mutagenesis. This is a routine screening method, and its purpose is to provide a starting point for subsequent engineering.
[0047] Example 2: Enhanced metabolic pathways Using the optimal strain A01 screened in Example 1 as a baseline, the astaxanthin synthesis pathway was further enhanced through metabolic engineering. Figure 2 ).
[0048] 2.1 Enhancement of the GGPP synthesis module (1) The source Saccharomyces cerevisiae tHMG1, Escherichia coli IDI and Archaeoglobus The ArGPS gene of sp. was codon-optimized and sent to Beijing Qingke Biotechnology Co., Ltd. for gene synthesis. The plasmid backbone containing the promoter pEF1 and terminator tCYC1 was amplified using primer gu-F / R. The tHMG1, IDI, ArGPS, and HygB fragments were amplified using primers tHMG1-F / R, IDI-F / R, ArGPS-F / R, and HygB-F / R, respectively. The amplified fragments were then assembled in one step using the Novizan ClonExpress Ultra One Step Cloning Kit V3 to obtain the plasmid pWKH-pEF1-tHMG1-IDI-ArGPS-hygB-tCYC1. Different genes were ligated using F2A, E2A, and P2A peptide sequences. Figure 3 ).
[0049] The sequence of tHMG1 is:
[0050] The sequence of IDI is as follows: atgcaaaccgaacacgtgattcttcttaacgcccagggagtgccaacgggaactcttgagaagtacgcggctcacactgctgacacacgtttgcacctcgcattctcgtcatggctctttaatgcaaaggggcagctcctggttacgcgtcgagcactgtccaaaaaagcatggccaggtgtatggaccaattccgtttgtggccacccacagcttggtgagagtaatgaagacgccgtgattcgccgctgccgttatgaacttggagtcgagattactccgccagagagcatctatcccgattttcgataccgcgctactgacccatcaggaatcgtcgagaacgaggtctgtcctgtgttcgctgcacgtaccacttctgccttgcagattaacgacgatgaggtcatggattatcagtggtgcgacctggctgacgttttgcatggcattgatgctactccttgggcttttagtccgtggatggtaatgcaagctacaaaccgtgaagcacgtaaacgcctttcggctttcacacagctcaaa, as shown in SEQ ID NO: 2.
[0051] The sequence of ArGPS is: atgcttaaagaggaaattgcaaagcgcgcagaaattattaacaaggcaattgaggaacttctccctgagcgcgaacccattggtctgtataaagcagcacgccaccttattaaggcaggagggaagcgacttcgtcctgttatctcactcctggcagttgaggccttgggcaaggattaccgtaagattattcctgctgcggtgtccatcgagacaattcataacttcaccctggttcatgatgacattatggacagagacgaaatgcgacgcggcgtcccaactgtacatcgagtgtacggtgaggcaacagccattctcgcaggcgacacccttttcgccgaggccttcaagctgctcactaagtgcgacgtggaaagcgagggtatccgtaaggcaaccgaaatgctgtccgatgtctgcatcaagatttgcgaaggtcagtactacgacatgtccttcgagaagaaagaatctgtttctgaagaggaatacctccgcatggttgaactgaaaacaggagtgctcattgctgcctccgctgctcttccagcagttctgtttggtgaaagtgaggagattgttaaagcactgtgggactacggtgtgctctctggcatcggctttcaaattcaggatgacctgttggacttgactgaggagaccggcaaggattggggctcagacctgttgaagggaaagaaaaccctcattgtaatcaaggcgtttgagaaaggcgtgaagttgaagacttttggtaaagagaaggccgatgtgtcagagattagagacgacatcgaaaagctgcgagagtgtggcgcaattgactacgcagcgagtatggctcgtaaaatggctgaggaagccaagagaaagctcgaagtccttcctgaatcaaaagctaaggaaacacttctggaactgaccgacttcctggtaacgcgcaaaaag, as shown in SEQ ID NO: 3.
[0052] The sequence of HygB is:
[0053] The sequence of F2A is: ggaagcggagctactaacttcagcctgctgaagcaggctggagacgtggaggagaaccctggacct, as shown in SEQ ID NO: 5.
[0054] The sequence of E2A is: ggttctggccagtgcactaactacgctttgctgaagctggcaggcgatgtagagtctaacccaggacca, as shown in SEQ ID NO: 6.
[0055] The sequence of P2A is: ggatccggagctactaacttcagcctgctgaagcaggctggagacgtggaggagaaccctggacct, as shown in SEQ ID NO:7.
[0056] The sequence listings of primers gu-F / R, tHMG1-F / R, IDI-F / R, ArGPS-F / R, and HygB-F / R are shown in Table 1.
[0057] Table 1 Primer sequence listing
[0058] (2) The vector plasmid pWKH-pEF1-tHMG1-IDI-ArGPS-hygB-tCYC1 was electroporated into the mutant strain A01. The electroporation parameters were 1200 V, 1000 Hz, 10% duty cycle, and 40 pulses. After adding seed culture medium, the mixture was incubated overnight and then spread onto a resistant plate containing hygromycin B. The plate was cultured at 25 °C for 3-5 days.
[0059] (3) Single colonies with a redder color were picked from the transformation plate and fermented in shake-flask fermentation liquid medium. Pigments were extracted, and HPLC analysis revealed that the highest content of astaxanthin reached 18 mg / L. Figure 6 This strain is designated B01.
[0060] This step involved constructing and electroporating a three-gene co-expression vector containing tHMG1, IDI, and ArGPS, which enabled targeted enhancement of the flux of key precursors in astaxanthin synthesis in Schizochytrium. It is important to clarify that this module does not target GGPP alone, but rather achieves a systematic redirection of metabolic flux by synergistically regulating the continuous synthesis of FPP and GGPP.
[0061] Specifically: (1) tHMG1 (a truncated and highly efficient HMG-CoA reductase from yeast) and IDI (an isopentenyl pyrophosphate isomerase from Escherichia coli) work synergistically to significantly enhance the flux of the mevalonate (MVA) pathway and efficiently generate isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP) – which are common precursors of all isoprene-like compounds.
[0062] (2) ArGPS (geranylgeranyl pyrophosphate synthase from archaea) is a bifunctional pre-alkenyltransferase whose catalytic process is continuous: it first uses IPP to condense with DMAPP to generate farnesyl pyrophosphate (FPP, C15), and then uses FPP as a substrate to react with an IPP molecule to finally synthesize geranylgeranyl pyrophosphate (GGPP, C20).
[0063] Therefore, the expression of this three-gene module inevitably increases the biosynthetic flux of FPP and GGPP simultaneously. In Schizochytrium, FPP is a key branch node in the two major synthetic pathways of fatty acids (such as DHA) and carotenoids (such as astaxanthin). In traditional strains, a large amount of FPP is directed to sterol or fatty acid synthesis; however, this module, through the efficient "extraction" effect of ArGPS, forcibly guides the FPP carbon flux that might otherwise flow to the fatty acid pathway to GGPP synthesis, thereby supporting the efficient accumulation of astaxanthin.
[0064] This design achieved a new metabolic flux regulation paradigm in Schizochytrium, shifting from "passive accumulation" to "active guidance." Instead of gene knockout, it actively attracts upstream "sources" (FPPs) by overexpressing downstream "sinks" (ArGPS), thereby precisely cutting off the precursor bottleneck in carotenoid synthesis without interfering with high DHA production. Astaxanthin production thus jumped from 0.5 mg / L in A01 to 18 mg / L, validating the core role of this FPP / GGPP synergistic enhancement module in resolving carbon flux competition.
[0065] 2.2 β-Carotene Synthesis Module (1) The source Sporidiobolus pararoseusThe SpCrtYB and SpCrtI sequences of TBRC-BCC 63403 were synthesized by Beijing Qingke Biotechnology Co., Ltd. The backbone containing the promoter pActin and terminator tActin was amplified using primers gu-F1 / R1, and the SpCrtYB-F / R, SpCrtI-F / R, and neo-F / R primers were used to amplify the SpCrtYB, SpCrtI, and Neo fragments, respectively. The fragments were assembled using the Novizan ClonExpress Ultra One Step Cloning Kit V3 to obtain the vector pWKN-pActin-SpCrtYB-SpCrtI-neo-tActin. Genes were ligated using E2A and P2A. Figure 4 ).
[0066] The sequence of SpCrtYB is:
[0067] The sequence of SpCrtI is:
[0068] The sequence of Neo is: atgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctga, as shown in SEQ ID NO: 20.
[0069] The sequence lists of primers gu-F1 / R1, SpCrtYB-F / R, SpCrtI-F / R and neo-F / R are shown in Table 2.
[0070] Table 2 Primer Sequence List
[0071] (2) Electroporate the vector pWKN-pActin-SpCrtYB-SpCrtI-neo-tActin into the mutant strain B01, add seed culture medium and incubate overnight, then spread it onto a resistant plate containing G418 and culture at 25 ℃ for 3-5 days.
[0072] (3) Single colonies with a redder color were picked from the transformation plate and fermented in shake-flask fermentation liquid medium. Pigments were extracted, and HPLC analysis revealed that the highest content of astaxanthin reached 57 mg / L. Figure 6 This strain is designated B02.
[0073] This step introduces SpCrtYB and SpCrtI, which solves the inherent defect of weak β-carotene synthesis in Schizochytrium, further increasing astaxanthin production to 57 mg / L and verifying the synergistic effect of the intermediate module.
[0074] 2.3 Astaxanthin Synthesis Module (1) The source Haematococcus pluvialis The codons of HpCrtW and HpCrtZ were optimized and sent to Beijing Qingke Biotechnology Co., Ltd. for synthesis. The plasmid backbone containing the promoter pEF1 and terminator tCYC1 was amplified using primers gu-F / R. Fragments of HpCrtW, HpCrtZ, and HpCrW1 were amplified using primers HpCrW-F / R, HpCrtZ-F / R, and HpCrW-F1 / R1, respectively, with HpCrtW having two copies. The amplified fragments were assembled in one step using the Novizan ClonExpress Ultra One Step Cloning Kit V3 to obtain the plasmid pWKZ-pEF1-HpCrtW-HpCrtZ-HpCrtW-Zeo-tCYC1. Different genes were ligated using F2A, E2A, and P2A peptide sequences. Figure 5 ).
[0075] The HpCrW sequence is: Atgcacgtagcctcagcactcatggttgaacagaagggctcggaagcagccgcttcttcaccagatgtgctccgagcatgggctactcagtaccacatgcccagcgaatcatcagatgcggctagacctgctttgaagcacgcatataagcctcccgcctctgacgccaaaggaattactatggctctcactatcattggaacatggacagctgtcttcctgcacgcgattttccagattagattgccaacgtctatggaccaactgcattggctgcctgtatctgaagctacagcgcaactcctcggaggtagctcttcgttgctccacattgccgctgtcttcatcgttcttgagtttctgtacactggacttttcatcacaactcatgatgctatgcacggcaccatcgcccttcgtcaccgacaacttaacgacctgttgggcaatatttgtatctccctctatgcttggttcgactactctatgcttcaccgaaaacactgggagcaccacaatcatacgggcgaggttggtaaggaccctgattttcataagggtaaccccggccttgttccatggttcgcgtcctttatgtcctcttacatgtcgttgtggcagtttgcccgtttggcttggtgggctgtcgtaatgcagatgcttggagcacccatggccaacttgctggtctttatggcggcagcgcctattctcagtgcatttcgcctcttctactttggtacatatctcccacataagcctgagcctggaccagcagcgggttcacaagtaatggcctggtttcgagcgaagacatccgaggcttctgatgtgatgtcattccttacgtgctaccacttcgacttgcactgggaacatcaccgatggccatttgcaccgtggtggcagctcccacattgccgacgtctttcgggaagaggcctggtcccagctctcgcg, as shown in SEQ ID NO: 29.
[0076] The sequence of HpCrtZ is as follows: atgttgagcaagttgcaatccatctccgttaaagcccgacgcgtcgaactggcgcgtgacatcacacgccctaaggtatgtctccatgcacagcgctgctcacttgtgcgacttcgagttgctgcgcctcaaacggaagaggcagtaggcacacaacaagcagcaggagctggtgacgagcattctgctgatgttgcgctccagcagctggaccgcgctattgcagagcgccgagccagacgtaagcgcgaacaactctcataccaagcagctgctattgctgcttctattggcgtatccggtatcgcaatcttcgcgacatacctccgatttgccatgcacatgacagtgggcggcgctgttccgtggggagaagtggctgggaccctgttgcttgttgtcggcggcgctcttggaatggagatgtacgcgcgatacgcacataaggcgatttggcacgaatcaccgctcggatggctccttcataagagccatcataccccaagaaccgggccgttcgaagcgaacgatttgttcgctattatcaacggtctcccggctatgctcctgtgcacattcggcttttggttgccgaatgttctcgggaccgcatgctttggcgcaggcctgggtatcacgttgtacgggatggcttacatgttcgtgcacgacggcctggttcatcgaagatttcccactgggccaattgctggcttgccttacatgaagcgactgactgtggctcaccagctccaccactctggtaagtacggcggggcaccatggggtatgttccttggcccgcaggaactccaacacattccaggtgctgccgaggaggtcgagcgccttgtccttgagcttgattggtcaaagaga, as shown in SEQ ID NO: 30.
[0077] The sequence of Zeo is: atggccaagttgaccagtgccgttccggtgctcaccgcgcgcgacgtcgccggagcggtcgagttctggaccgaccggctcgggttctcccggga cttcgtggaggacgacttcgccggtgtggtccgggacgacgtgaccctgttcatcagcgcggtccaggaccaggtggtgccggacaacaccctgg cctgggtgtgggtgcgcggcctggacgagctgtacgccgagtggtcggaggtcgtgtccacgaacttccgggacgcctccgggccggccatgacc gagatcggcgagcagccgtgggggcgggagttcgccctgcgcgacccggccggcaactgcgtgcacttcgtggccgaggagcaggactga, as SEQ ID NO:31. The primer sequences of gu-F / R, HpCrW-F / R, HpCrtZ-F / R and HpCrW-F1 / R1 are shown in Table 3.
[0078] Table 3 Primer sequence listing
[0079] (2) The vector pWKZ-pEF1-HpCrtW-HpCrtZ-HpCrtW-Zeo-tCYC1 was electroporated into the mutant strain B02, and after adding seed culture medium, it was incubated overnight. It was then spread onto a resistant plate containing Zeo and cultured at 25 °C for 3-5 days.
[0080] (3) Single colonies with a redder color were picked from the transformation plate and fermented in shake-flask fermentation liquid medium. Pigments were extracted, and HPLC analysis revealed that the highest content of astaxanthin reached 192 mg / L. Figure 6 This strain is designated B03.
[0081] This step employs a two-copy HpCrtW construction strategy, which specifically addresses the rate-limiting step in astaxanthin synthesis, resulting in an explosive increase in astaxanthin yield, reaching 192 mg / L.
[0082] Example 3: β-Ionone domestication β-Ionone is a cyclic β-carotene analog that inhibits carotenoid synthesis. When a certain concentration of β-ionone is present in the environment, it inhibits the activity or expression of key enzymes in carotenoid synthesis (such as phytopenic acid synthase CrtYB) through a feedback inhibition mechanism, causing the colony color to turn yellow or white. If some strains overcome the feedback inhibition of β-ionone, the colony color will turn red or dark red. Through repeated acclimatization, the strains will gradually overcome this feedback inhibition mechanism, leading to a gradual increase in carotenoid content.
[0083] (1) Activate strain B03 onto seed solid medium, culture at 25 ℃ for 3 days, pick a single colony and inoculate it into seed liquid medium, culture at 25 ℃ with shaking overnight.
[0084] (2) Dilute the bacterial solution tenfold to 10. 3 10 4 The diluted solutions were spread onto solid culture media containing different concentrations of β-ionone (50, 100, 200 mg / L) and placed at 25 ℃ for acclimatization culture. After 5-6 days of culture, the colony color was observed.
[0085] (3) Select the reddish colonies and ferment them using shake-flask fermentation liquid medium to extract the pigment and detect the astaxanthin content. The highest astaxanthin yield was 285 mg / L, and this strain was designated as C01.
[0086] (4) Based on strain CO1, a second domestication was carried out, and the contents of β-ionone were 200, 300 and 400 mg / L, respectively. The reddest colonies were selected for shake-flask fermentation, and the pigments were extracted and analyzed by HPLC. The astaxanthin content could reach up to 379 mg / L. This strain was recorded as CO2.
[0087] (5) Based on strain CO2, the β-ionone content was 400, 450 and 500 mg / L, respectively. After shake-flask fermentation, the highest astaxanthin content of the reddish colony reached 502 mg / L, and this strain was recorded as CO3.
[0088] (6) The CO3 strain was deposited at the China Center for Type Culture Collection, under the name Schizochytrium. Aurantiochytrium sp. sdu080 AST-02, accession number CCTCC NO: M20251885.
[0089] Using β-ionone as selection pressure, the metabolically engineered high-yielding strain B03 underwent multiple rounds of directed acclimation with progressively increasing concentrations (50-500 mg / L). This strategy leverages the characteristic of β-ionone as a feedback inhibitor in the carotenoid synthesis pathway. By screening mutants that maintained the red phenotype (i.e., overcoming feedback inhibition) on media containing the inhibitor, a high-yielding strain was successfully obtained, significantly increasing astaxanthin production from 192 mg / L in B03 to 502 mg / L in strain CO3. Figure 6 ).
[0090] Example 4: Optimization of Fermentation Conditions The selected Schizochytrium strains Aurantiochytrium sp AST-02 was activated in solid culture medium, and after primary and secondary seed culture transfer, fermentation conditions were optimized using different fermentation media and different control strategies.
[0091] Primary seed culture: 10 g / L glucose, 20 g / L yeast extract, 15 g / L sea salt.
[0092] Secondary seed culture: 60 g / L glucose, 20 g / L yeast extract, 15 g / L sea salt.
[0093] (1) Fermentation tank culture medium composition 1: 50 g / L glucose, 9 g / L yeast extract, 30 g / L sodium glutamate, 20 g / L sea salt crystal. The secondary seed liquid was transferred to a 5 L fermenter at an inoculation rate of 10%. The culture temperature was 25 ℃, the culture time was 120 h, the rotation speed was 200-600 rpm, the pH was 5.0-5.5, and the dissolved oxygen was 20-30%. Glucose was added in batches to control the residual sugar at 5-10 g / L.
[0094] The obtained microbial oil and its carotenoids were detected using the aforementioned method. The oil content was 45%, the DHA yield was 34 g / L, the β-carotene yield was 600 mg / L, and the astaxanthin yield was 656 mg / L.
[0095] (2) Fermentation tank culture medium composition 2: 60 g / L glucose, 20 g / L yeast extract, 100 μM ferrous sulfate heptahydrate, 10 g / L sea salt crystals. The secondary seed liquid was transferred to a 5 L fermenter at an inoculation rate of 10%. The culture temperature was 25 ℃, the culture time was 120 h, the rotation speed was 200-600 rpm, the pH was 5.0-5.5, and the dissolved oxygen was 20-30%. Glucose was added in batches to control the residual sugar at 5-10 g / L.
[0096] The microbial oil and its carotenoids were tested, and the oil content was 47%, the DHA yield was 37 g / L, the β-carotene yield was 705 mg / L, and the astaxanthin yield was 712 mg / L.
[0097] (3) Fermentation tank culture medium composition 3: 120 g / L glucose, 4 g / L yeast extract, 5 g / L corn steep liquor powder, 3 g / L ammonium sulfate, 2 g / L magnesium sulfate, 6 g / L sodium glutamate, 4 g / L potassium dihydrogen phosphate, 15 g / L sea salt crystals. The secondary seed liquid was transferred to a 5 L fermenter at an inoculation rate of 10%. The culture temperature was 25 ℃, the culture time was 120 h, the rotation speed was 200-600 rpm, the pH was 6.0-6.5, and the dissolved oxygen was 20-30%. Glucose was added in batches to control the residual sugar at 5-10 g / L.
[0098] Microbial oil and its carotenoids were tested. The oil content was 50%, the DHA yield was 40 g / L, the β-carotene yield was 750 mg / L, and the astaxanthin yield was 923 mg / L.
[0099] (4) Fermentation tank culture medium composition 4: 80 g / L glucose, 8 g / L yeast extract, 1 g / L potassium sulfate, 4 g / L magnesium sulfate heptahydrate, 0.1 g / L potassium dihydrogen phosphate, 0.05 g / L calcium chloride, 15 g / L sea salt crystals. The secondary seed liquid was transferred to a 5 L fermenter at an inoculation rate of 10%. The culture temperature was 25 ℃, the culture time was 120 h, the rotation speed was 200-600 rpm, the pH was 5.0-6.0, and the dissolved oxygen was 20-30%. The glucose concentration in the fermentation broth was controlled at 5 g / L by feeding glucose.
[0100] The results of the microbial oil and its carotenoids showed that the oil content was 52%, the DHA production was 39 g / L, the β-carotene production was 701 mg / L, and the astaxanthin production was 1237 mg / L.
[0101] (5) Fermentation tank culture medium composition 5: 80 g / L glucose, 8 g / L yeast extract, 1 g / L potassium sulfate, 4 g / L magnesium sulfate heptahydrate, 0.1 g / L potassium dihydrogen phosphate, 0.05 g / L calcium chloride, 15 g / L sea salt crystals. The secondary seed liquid was transferred to a 5 L fermenter at an inoculation rate of 10%. The culture temperature was 20 ℃, the culture time was 120 h, the rotation speed was 200-600 rpm, the pH was 5.5, and the dissolved oxygen was 10-15%. The glucose concentration in the fermentation broth was controlled at 2-3 g / L by feeding glucose.
[0102] The obtained microbial oil and its carotenoids were tested. The oil content was 46%, the DHA yield was 34 g / L, the β-carotene yield was 841 mg / L, and the astaxanthin yield was 1506 mg / L.
[0103] The results of fermentation formulas 1-5 are summarized in Table 4.
[0104] Table 4 Summary of Results for Different Fermentation Formulas
[0105] In this embodiment, by optimizing fermentation formula 5, the resulting strain AST-02 achieved high yields of both astaxanthin (1506 mg / L) and DHA (34 g / L). The strain of this invention was developed under industrial-scale, light-free, high-density heterotrophic fermentation conditions, and through designable metabolic engineering, achieved synergistic high yields of DHA and astaxanthin.
[0106] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. A Schizochytrium strain for producing DHA and astaxanthin, characterized in that, The strain of Schizochytrium is classified and named Schizochytrium. Aurantiochytrium sp. AST-02 was deposited at the China Center for Type Culture Collection on August 22, 2025, with accession number CCTCC NO: M20251885.
2. The method for preparing the Schizochytrium strain as described in claim 1, characterized in that, The steps include: (1) Basic mutagenesis: using ARTP mutagenesis technology, wild-type Schizochytrium strains were initially screened to obtain the basic mutant strain A01 with increased astaxanthin production. (2) Simultaneous expression of three key genes: tHMG1 from yeast, IDI from Escherichia coli, and ArGPS from archaea; enhanced biosynthetic flux of farnesyl pyrophosphate and geraniol geraniol pyrophosphate, resulting in B01; (3) Introducing from Sporidiobolus pararoseus The SpCrtYB and SpCrtI genes efficiently and stably convert geraniol pyrophosphate into β-carotene to obtain B02; (4) The HpCrtW and HpCrtZ genes from Haematococcus pluvialis were introduced using the double-copy HpCrtW construction strategy to obtain B03; (5) Based on the above genetic engineering modification, β-ionone was used as the selection pressure, and through multiple rounds of targeted domestication with gradient increasing concentrations, the Schizochytrium strain was successfully screened. Aurantiochytrium sp. AST-02.
3. The preparation method according to claim 2, characterized in that, In step (1), multiple ARTP mutagenesis treatments are performed. The specific operation of ARTP mutagenesis treatment is as follows: First, prepare a bacterial suspension, then transfer the bacterial suspension to the ARTP operating chamber, adjust the distance between it and the plasma generator jet to 2-3 mm, set the gas flow rate to 8-12 SLM, set the power to 100-200 W, control the time to 10-60 s, then wash it to the seed culture medium, revive it overnight at 25 ℃, dilute the bacterial solution and spread it on a solid culture medium for culture, and then screen it.
4. The preparation method according to claim 2, characterized in that, In step (2), specifically: the plasmid backbone containing the promoter pEF1 and the terminator tCYC1 is amplified using primer gu-F / R; tHMG1, IDI, ArGPS and HygB fragments are amplified using primers tHMG1-F / R, IDI-F / R, ArGPS-F / R and hygB-F / R, respectively; the amplified fragments are assembled in one step to obtain the vector pWKH-pEF1-tHMG1-IDI-ArGPS-HygB-tCYC1; different genes are linked using F2A, E2A and P2A peptide sequences; the vector pWKH-pEF1-tHMG1-IDI-ArGPS-HygB-tCYC1 is electroporated into the mutagenized strain A01, incubated, and screened to obtain B01; Alternatively, in step (3), specifically: the backbone containing the promoter pActin and the terminator tActin is amplified using primer gu-F1 / R1, and the SpCrtYB, SpCrtI, and neo fragments are amplified using primers SpCrtYB-F / R, SpCrtI-F / R, and neo-F / R, respectively. The above fragments are assembled to obtain the vector pWKN-pActin-SpCrtYB-SpCrtI-neo-tActin. The genes are ligated using E2A and P2A, incubated, and screened to obtain B02. Alternatively, in step (4), specifically: the plasmid backbone containing promoter pEF1 and terminator tCYC1 is amplified using primer gu-F / R, and the fragments HpCrtW, HpCrtZ and HpCrW1 are amplified using primers HpCrW-F / R, HpCrtZ-F / R and HpCrW-F1 / R1, respectively. HpCrtW has two copies. The amplified fragments are assembled in one step, and the plasmid pWKZ-pEF1-HpCrtW-HpCrtZ-HpCrtW-Zeo-tCYC1 is cloned. Different genes are linked using F2A, E2A and P2A peptide sequences, incubated, screened, and B03 is obtained.
5. The preparation method according to claim 2, characterized in that, In step (5), the process involves three rounds of acclimatization; the concentration is increased in a gradient of 50-500 mg / L, preferably 50 mg / L, 100 mg / L, and 200 mg / L.
6. The application of the Schizochytrium strain as described in claim 1 in the synergistic high production of DHA and astaxanthin.
7. The application as described in claim 6, characterized in that, The DHA yield is ≥34 g / L, and the astaxanthin yield is ≥650 mg / L.
8. A method for synergistically high-yield production of DHA and astaxanthin, characterized in that, This includes the fermentation preparation of DHA and astaxanthin using the Schizochytrium strain described in claim 1.
9. The method as described in claim 8, characterized in that, The specific steps of the method are as follows: after activating the Schizochytrium strain on a solid culture medium, transferring it to a primary seed culture medium and then to a secondary seed culture medium, DHA and astaxanthin are prepared by fermentation on a fermentation culture medium. Alternatively, the primary seed solution comprises: 5-15 g / L glucose, 15-25 g / L yeast extract, and 10-20 g / L sea salt; the secondary seed solution comprises: 55-65 g / L glucose, 15-25 g / L yeast extract, and 10-20 g / L sea salt.
10. The method as described in claim 9, characterized in that, The fermentation medium comprises: 45-55 g / L glucose, 8-10 g / L yeast extract, 25-35 g / L monosodium glutamate, and 15-25 g / L sea salt; the culture conditions are: culture temperature 25 ℃, culture time 100-140 h, rotation speed 200-600 rpm, pH 5.0-5.5, dissolved oxygen 20-30%, and glucose is added in batches. Alternatively, use 55-65 g / L glucose, 15-25 g / L yeast extract, 90-110 μM ferrous sulfate heptahydrate, and 5-15 g / L sea salt. Transfer the secondary seed culture to the fermenter at an inoculum rate of 8-12%. Incubate at 25℃ for 100-140 h at a rotation speed of 200-600 rpm, pH 5.0-5.5, and dissolved oxygen 20-30%. Add glucose in batches. Alternatively, use 110-130 g / L glucose, 3-5 g / L yeast extract, 3-7 g / L corn steep liquor powder, 2-5 g / L ammonium sulfate, 1-3 g / L magnesium sulfate, 5-7 g / L sodium glutamate, 3-5 g / L potassium dihydrogen phosphate, and 10-20 g / L sea salt. Transfer the secondary seed culture to the fermenter at an inoculum rate of 8-12%. Incubate at 25 ℃ for 100-140 h, 200-600 rpm, pH 6.0-6.5, and dissolved oxygen 20-30%. Add glucose in batches. Alternatively, use 70-90 g / L glucose, 7-9 g / L yeast extract, 1-2 g / L potassium sulfate, 3-5 g / L magnesium sulfate heptahydrate, 0.1-0.2 g / L potassium dihydrogen phosphate, 0.05-0.1 g / L calcium chloride, and 10-20 g / L sea salt. Transfer the secondary seed culture to the fermenter at an inoculum rate of 8-12%. Cultivate at 25 ℃ for 100-140 h at a rotation speed of 200-600 rpm, pH 5.0-6.0, and dissolved oxygen 20-30%. Control the glucose concentration in the fermentation broth to 4-6 g / L by feeding glucose. Alternatively, use 70-90 g / L glucose, 7-9 g / L yeast extract, 1-2 g / L potassium sulfate, 3-5 g / L magnesium sulfate heptahydrate, 0.1-0.2 g / L potassium dihydrogen phosphate, 0.05-0.1 g / L calcium chloride, and 10-20 g / L sea salt. Transfer the secondary seed culture to the fermenter at an inoculum rate of 8-12%. Cultivate at 20 ℃ for 100-140 h at a rotation speed of 200-600 rpm, pH 5.0-6.0, and dissolved oxygen 10-15%. Control the glucose concentration in the fermentation broth to 2-3 g / L by feeding glucose.