Kluyveromyces marxianus strain and its use in the fermentation production of ethanol

By isolating and identifying the Kluyveromyces martensii strain huJ01, the problem of insufficient utilization of xylose components in lignocellulose resources has been solved, and efficient ethanol production under complex environments has been achieved. It has high temperature tolerance, ethanol tolerance and inulinase secretion capacity, and is suitable for the fields of bioenergy and biorefining.

CN122104451APending Publication Date: 2026-05-29SHIJIAZHUANG UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-02
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

In the existing technology, most brewing yeasts in nature lack the ability to metabolize xylose, which makes the effective utilization of xylose components in lignocellulose resources a bottleneck restricting ethanol production. Furthermore, there is a lack of multifunctional yeast strains that can maintain good growth and metabolic activity under complex environments such as high temperature, high ethanol, high salt and low pH.

Method used

A strain of Kluyveromyces marxianus (CGMCC No. 22931) was isolated and identified. This strain is tolerant to high temperatures, ethanol, salt, and low pH, and can secrete inulinase, enabling it to efficiently ferment xylose to produce ethanol under complex conditions.

Benefits of technology

This strain maintains good growth and ethanol synthesis capabilities under conditions of high temperature, high ethanol, high salt, and low pH. The inulinase activity is significantly improved, enhancing the ethanol production potential of lignocellulose resources. It is suitable for special industrial fermentation scenarios with high salt, high acid, and high ethanol.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104451A_ABST
    Figure CN122104451A_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of bioengineering, and particularly relates to a Kluyveromyces marxianus strain and application thereof in fermentation production of ethanol. The present application provides a Kluyveromyces marxianus strain huJ01, and the preservation number of the strain is CGMCC No.22931. The strain can still maintain good growth and ethanol synthesis capacity under stress conditions such as high temperature, high acid, high ethanol and high salt. Under the optimal conditions of inulinase activity, the ethanol yield can reach 2.41%vol after 20% inoculation and static culture at 60 DEG C for 120 h. The strain is inoculated at 4% in a high stress culture medium containing 11.4% ethanol, pH 3.5 and 3.51% NaCl, and is statically cultured at 40 DEG C for 12 h, and the concentration of the bacterial liquid is significantly increased or not significantly decreased. It is shown that the strain still has strong ethanol fermentation performance under extreme environment, and is suitable for special industrial fermentation scenes such as high salt, high acid and high ethanol.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, and in particular to a strain of Kluyveromyces martensii and its application in the fermentation production of ethanol. Background Technology

[0002] Bioethanol, as an important representative of renewable and clean energy, is one of the effective ways to alleviate the fossil fuel crisis and environmental pressure. Traditional ethanol production mainly relies on monosaccharides such as glucose as raw materials, and the conversion of ethanol from non-grain biomass resources such as lignocellulose has become a current research hotspot. In addition to glucose, lignocellulose hydrolysis products also contain a considerable proportion of pentose sugars such as xylose. However, most of the naturally occurring yeasts *Saccharomyces cerevisiae*, which can efficiently ferment glucose to produce ethanol, generally lack the ability to metabolize xylose. This makes the effective utilization of the xylose component in lignocellulose resources one of the technical bottlenecks restricting the efficient conversion of all components into ethanol. Therefore, discovering and constructing microbial strains that can efficiently utilize xylose and have good industrial environmental adaptability is key to achieving large-scale production of lignocellulose ethanol.

[0003] Among the many microorganisms with xylose metabolism potential, *Kluyveromyces martensii* (…) Kluyveromyces marxianus, K. marxianus This yeast has attracted widespread attention in recent years due to its rapid growth, broad substrate spectrum (capable of metabolizing various carbon sources such as glucose, xylose, and cellobiose), heat resistance, and ability to secrete various hydrolytic enzymes. This yeast can not only directly ferment various sugars to produce ethanol, but some strains also possess the ability to produce inulinase. Inulinase can hydrolyze substrates such as inulinose and sucrose to produce fermentable sugars, thus providing more substrates for ethanol fermentation. However, different sources... K. marxianus The strains showed significant differences in xylose utilization efficiency, ethanol tolerance, high temperature adaptability, and inulinase activity. Screening superior strains with high xylose utilization, high environmental tolerance, and high inulinase activity has important theoretical and applied value for developing efficient lignocellulose ethanol co-production processes.

[0004] Although some studies have reported on this K. marxianusWhile strains have shown potential in xylose fermentation or inulinase production, these studies often focus on optimizing single traits. In actual industrial fermentation processes, strains must simultaneously withstand multiple environmental stresses, including high substrate concentrations, high osmotic pressure (e.g., high salt), high temperature, low pH, and product (e.g., ethanol) inhibition. Therefore, a multifunctional yeast strain capable of maintaining good growth and metabolic activity under these complex stress conditions would be more promising for industrial applications. Currently, domestic research focuses on strains that possess strong environmental tolerance (especially to high ethanol, high salt, low pH, and high temperature) and efficient xylose fermentation for ethanol production, while simultaneously achieving high inulinase production. K. marxianus There are relatively few systematic studies on wild strains.

[0005] The present invention aims to isolate and identify a strain possessing the aforementioned multiple superior characteristics from naturally fermented samples. K. marxianus This study systematically identified the strain's morphological and molecular biological characteristics, focusing on its growth tolerance under high temperature, high ethanol, low pH, and high salt conditions. It also optimized the conditions for xylose-based ethanol fermentation and inulinase secretion to assess its potential application in lignocellulosic ethanol production and inulin resource utilization. The research findings are expected to provide a high-performance microbial resource for developing efficient and robust biorefining processes. Summary of the Invention

[0006] The purpose of this invention is to provide a Max Kluyveromycin ( Kluyveromyces marxianus, K. marxianus ) strains and their application in the fermentation production of ethanol.

[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a Max Kluyveromycin ( Kluyveromyces marxianus, K. marxianus The strain huJ01, whose preservation number is CGMCC No.22931, is used.

[0008] Preferably, the *Kluyveromyces martensii* strain possesses at least one of the following tolerances: (1) The maximum temperature it can withstand is 40℃; (2) The highest tolerance for ethanol volume fraction was 11.4%; (3) The lowest pH value it can tolerate is 3.5; (4) The maximum NaCl mass fraction it can tolerate is 3.51%.

[0009] Preferably, the strain is capable of secreting inulinase and using xylose fermentation to produce ethanol.

[0010] The present invention provides a microbial preparation comprising the aforementioned Kluyveromyces martensii strain.

[0011] The present invention provides a fermentation medium for producing ethanol, comprising the aforementioned Kluyveromyces martensii strain, wherein the medium contains xylose as a carbon source.

[0012] Preferably, the culture medium further contains FeSO4; the pH value of the culture medium is 4-10.

[0013] This invention provides a method for producing ethanol using a strain of Kluyveromyces martensii, wherein the strain is inoculated into a fermentation medium and fermented to produce ethanol.

[0014] Preferably, the fermentation temperature is 30~60℃ and the fermentation time is 24~168 h.

[0015] Preferably, the amount of xylose added to the fermentation medium is 4-6 g / L, and the amount of FeSO4 added is 5-9 g / L; the mass percentage of the Kluyveromyces martensii strain inoculated is 1-25%.

[0016] This invention provides the application of the aforementioned Kluyveromyces martensii strain in the fermentation of xylose or inulin as substrates for ethanol production.

[0017] Compared with the prior art, the present invention has the following beneficial effects: In recent years, K. marxianus This fermentation strain, primarily used abroad for the resource utilization of agricultural by-products and their waste, can produce bioethanol while simultaneously generating single-cell protein (SCP), helping to alleviate protein resource shortages and the energy crisis. This invention isolated a dominant yeast strain, huJ01, from the natural fermentation process of *Asuka*, which was identified as *Kluyveromyces martensii*. Kluyveromyces marxianus, K.marxianus The strain, with accession number CGMCC No. 22931, exhibits outstanding resistance to acid, ethanol, NaCl, and high temperatures. It can also secrete inulinase to achieve xylose fermentation for ethanol production, demonstrating good adaptability and application potential in complex industrial environments.

[0018] This invention has discovered that, K. marxianusDespite under stress conditions including high temperature, high acidity, high ethanol, and high salinity, this strain maintains good growth and ethanol synthesis capabilities. Under optimal inulinase activity conditions (temperature 60℃, inoculum size 20%, xylose addition 5 g / L, pH 6, FeSO4 7 g / L), ethanol production reaches 2.41% vol after 48 h of cultivation. Notably, when inoculated at 4% in a high-stress medium containing 11.4% ethanol, pH 3.5, and 3.51% NaCl, and statically cultured at 40℃ for 12 h, the bacterial concentration either increases significantly or decreases insignificantly. This indicates that this strain retains strong ethanol fermentation performance under extreme conditions and is suitable for special industrial fermentation scenarios involving high salt, high acidity, and high ethanol.

[0019] also, K. marxianus The produced inulinase is a microbial inulinase that, in addition to hydrolyzing inulin, can also act on substrates such as sucrose and raffinose, exhibiting a broad substrate spectrum. This enzyme can hydrolyze fructans via exo- or endo-cleavage to produce fructose, glucose, or oligofructose. It can be used not only to prepare high-fructose corn syrup and functional oligosaccharides, but its hydrolysis products can also be further used for ethanol fermentation. After condition optimization, the inulinase yield of this strain was significantly increased under xylose induction, further enhancing its application prospects in the comprehensive utilization of renewable resources such as lignocellulose to produce ethanol. In summary, this strain possesses strong environmental tolerance, high-efficiency inulinase secretion capacity, and good ethanol fermentation performance, making it of significant development value and industrialization potential in the fields of bioenergy and biorefining. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0021] Figure 1 The colony morphology on malt extract agar medium.

[0022] Figure 2 Microscopic images of methylene blue staining.

[0023] Figure 3 The results of the sequencing sequence alignment in GenBank.

[0024] Figure 4 for K. marxianus Tolerable temperature.

[0025] Figure 5 for K. marxianus Tolerable ethanol concentration.

[0026] Figure 6 for K. marxianus Tolerable pH value.

[0027] Different letters indicate significant differences (P<0.05), while the same letters indicate no significant differences (P<0.05).

[0028] Figure 7 for K. marxianus Tolerable NaCl concentration.

[0029] Figure 8 To cultivate temperature K. marxianus The effect of inulinase activity.

[0030] Figure 9 For the amount of inoculation K. marxianus The effect of inulinase activity.

[0031] Figure 10 For different amounts of xylose added, the effect K. marxianus The effect of inulinase activity.

[0032] Figure 11 For different pH values, K. marxianus The effect of inulinase activity.

[0033] Figure 12 For FeSO4 pair K. marxianus The effect of inulinase activity.

[0034] Biological Preservation Instructions This invention provides a strain of Kluyveromyces martensii ( Kluyveromyces marxianus , K. marxianus )huJ01 was deposited on July 18, 2021, at the China General Microbiological Culture Collection Center (CGMCC), at No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing; deposit number: CGMCC No. 22931. Detailed Implementation

[0035] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0036] Example 1 1. Materials and Methods 1.1 Reagents and Culture Media 1.1.1 Basic culture medium: Yeast Extract Peptone Dextrose Medium (YPD or YEPD) liquid medium (g / L): 10 g peptone, 5 g yeast extract, 20 g glucose, natural pH, autoclaved at 121℃ for 15 min, ready for use.

[0037] 1.1.2 Fermentation medium (g / L): Xylose 50 g, yeast extract 2 g, (NH4)2SO4 10 g, KH2PO4 2 g, MgSO4 1 g, natural pH. Autoclave at 121℃ for 15 min, and set aside.

[0038] 1.1.3 Tolerance-enhancing culture medium: YPD liquid culture medium containing ethanol at concentrations of 0.6 g / 10 mL (7.6% vol), 0.7 g / 10 mL (8.9% vol), 0.8 g / 10 mL (10.1% vol), 0.9 g / 10 mL (11.4% vol), 1.0 g / 10 mL (12.7% vol), 1.1 g / 10 mL (13.9% vol), and 1.2 g / 10 mL (15.2% vol).

[0039] YPD liquid culture medium containing malic acid at concentrations of 0.03 g / 10 mL, 0.04 g / 10 mL, 0.05 g / 10 mL, and 0.06 g / 10 mL, respectively, was prepared by adjusting the pH of the medium to 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, and 7.0 with HCl.

[0040] YPD liquid culture medium containing NaCl at concentrations of 0.85 g / 100 mL, 1.17 g / 100 mL, 2.34 g / 100 mL, 3.51 g / 100 mL, 4.68 g / 100 mL and 5.85 g / 100 mL respectively.

[0041] 1.3 Methods 1.3.1 Morphological observation YPD liquid culture medium was incubated at 30°C for 12 hours. K. marxianus The bacterial suspension was streaked onto malt extract agar medium and incubated at 30°C for 72 h. The colony morphology was observed, and the cells were stained with methylene blue and observed under an optical microscope.

[0042] 1.3.2 Molecular Identification The culture was activated by incubating in YPD liquid medium at 30°C for 12 h and then transferred once. K. marxianus Two mL of bacterial suspension was sent to Shanghai Paisenno Biotechnology Co., Ltd. for ITS amplification and sequencing identification. The primer sequences (ITS1: 5'TCCGTAGGTGAACCTGCGG'3, ITS4: 5'TCCTCCGCTTATTGATATGC'3) (as shown in SEQ ID NO: 1 and 2).

[0043] 1.3.3 Tolerance Test (1) Temperature tolerance Will K. marxianus A 2% inoculum was inoculated into YPD liquid medium, and then statically cultured for 12 h at different temperatures (20℃, 25℃, 30℃, 35℃, 40℃, 45℃, 50℃, and 55℃). The absorbance (OD) value at a wavelength of 560 nm was measured. A graph was plotted with different temperatures on the x-axis and the measured OD values ​​on the y-axis to determine the absorbance. K. marxianus Maximum tolerable temperature.

[0044] (2) Tolerance to ethanol Will K. marxianus 2% inoculum was added to YPD liquid medium containing ethanol at concentrations of 0.6 g / 10 mL (7.6% vol), 0.7 g / 10 mL (8.9% vol), 0.8 g / 10 mL (10.1% vol), 0.9 g / 10 mL (11.4% vol), 1.0 g / 10 mL (12.7% vol), 1.1 g / 10 mL (13.9% vol), and 1.2 g / 10 mL (15.2% vol). The medium was incubated at 40°C for 12 h. The absorbance (OD) value at 560 nm was measured. A graph was plotted with different ethanol volume fractions on the x-axis and OD values ​​on the y-axis to determine the... K. marxianus Maximum tolerable ethanol volume fraction.

[0045] (3) Tolerance to acid Will K. marxianus 2% inoculum was inoculated into YPD liquid medium at pH values ​​of 7.0, 6.5, 6.0, 5.5, 5.0, 4.0, 3.5, and 3.0, respectively. The medium was incubated at 40℃ for 12 h, and the absorbance (OD) value at 560 nm was measured. A graph was plotted with different pH values ​​on the x-axis and OD values ​​on the y-axis to determine the absorbance. K. marxianus Maximum pH value tolerable.

[0046] (4) Tolerance to NaCl Will K. marxianus 2% inoculum was inoculated into YPD liquid medium containing NaCl concentrations of 0.85 g / 100 mL, 1.17 g / 100 mL, 2.34 g / 100 mL, 3.51 g / 100 mL, 4.68 g / 100 mL, and 5.85 g / 100 mL, respectively. The medium was incubated at 40℃ for 12 h, and the absorbance (OD) at 560 nm was measured. A graph was plotted with different NaCl concentrations on the x-axis and OD values ​​on the y-axis to determine... K. marxianus Maximum tolerance amount of NaCl.

[0047] 1.3.4 Optimization of conditions for optimal inulinase activity (1) Effect of inoculum size on inulinase activity The bacterial suspension in the logarithmic growth phase was inoculated into the fermentation enzyme production medium at different inoculation amounts (volume fractions, 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, 10.0%, 15.0%, 20.0%, 25.0%, and 30.0%) and cultured at 30°C for 48 h. The effect of inoculation amount on inulinase activity was then determined.

[0048] (2) Effect of temperature on inulinase activity The bacterial suspension in the logarithmic growth phase was inoculated at a 4.0% inoculum and reacted under different temperature conditions (30℃, 40℃, 50℃, 60℃, 70℃ and 80℃) to determine the effect of temperature on inulinase activity.

[0049] (3) Effect of xylose addition on inulinase activity The bacterial suspension in the logarithmic growth phase was inoculated at a 4.0% inoculum into fermentation enzyme-producing media with different xylose additions (0 g / L, 2 g / L, 3 g / L, 4 g / L, 5 g / L, 10 g / L, 20 g / L and 30 g / L), and cultured at 30℃ for 48 h. The effect of xylose addition on inulinase activity and ethanol production was then determined.

[0050] (4) Effect of pH on inulinase activity.

[0051] The bacterial suspension in the logarithmic growth phase was inoculated at a rate of 4.0% into fermentation enzyme-producing media at different pH conditions (4, 5, 6, 7, 8, 9 and 10), and cultured at 30℃ for 48 h. The effect of pH on inulinase activity was then determined.

[0052] (5) Effect of FeSO4 on inulinase activity.

[0053] The bacterial suspension in the logarithmic growth phase was inoculated into the fermentation enzyme-producing medium at an inoculum volume of 4.0% and cultured at 30℃ for 48 h. The FeSO4 content gradients of 5 g / L, 7 g / L, 10 g / L, 15 g / L and 20 g / L were measured to investigate the effects of different metal ions and their addition amounts on inulinase activity and to determine the optimal metal ions and addition amounts.

[0054] 1.3.5 Ethanol volume fraction (alcohol content) under optimal inulinase activity conditions The bacterial suspension in the logarithmic growth phase was inoculated into the optimal fermentation enzyme-producing medium at the optimal inoculation amount and cultured at the optimal temperature for 168 h. The ethanol volume fraction was measured every 24 h to determine the optimal ethanol volume fraction.

[0055] 2 Results and Analysis 2.1 Observation of colony morphology Will K. marxianus Incubate at 30℃ for 3 days, if Figure 1 As shown, the colonies were observed to be oval in shape, approximately 0.3-2.0 mm in diameter and 0.2-5.0 mm in size. They were milky white in color, viscous and moist in texture, with a smooth, flat surface, and were round and opaque with neat, smooth edges. Upon opening the petri dish, a strong aroma of alcohol was detected.

[0056] 2.2 Cell morphology observation After methylene blue staining, such as Figure 2 As shown, yeast cells observed under a 40× optical microscope appear colorless, indicating they are alive, and are arranged in a short, irregular oval shape, indicating budding.

[0057] After PCR amplification and sequencing, the sequence of strain huJ01 is as follows: (As shown in SEQ ID NO: 3) and Kluyveromyces martensii in genbank ( Kluyveromyces marxianus , K. marxianus The sequence showed 99.42% homology, making it the most homologous sequence. Therefore, strain huJ01 was identified as *Kluyveromyces martensii*. Kluyveromyces marxianus , K. marxianus ). Figure 3 Alignment results of sequencing sequences in GenBank 2.3 K. marxianus Tolerance 2.3.1 K. marxianus Temperature tolerance Will K. marxianusA 2% inoculum was inoculated into YPD liquid medium and incubated statically for 12 h at different temperatures of 20℃, 25℃, 30℃, 35℃, 40℃, 45℃, 50℃, and 55℃. The OD values ​​were then measured. Figure 4 As shown, the OD value (bacterial concentration) gradually increases from 20℃ to 35℃, reaching a maximum at 35℃. K. marxianus The optimal growth temperature is 40℃. The difference in OD value (bacterial concentration) between 40℃ and 20℃ is not significant, so 40℃ is the highest temperature that it can tolerate.

[0058] 2.3.2 K. marxianus Tolerable ethanol concentration Will K. marxianus 2% inoculum was added to YPD liquid medium containing 0.6 g / 10 mL (7.6% vol), 0.7 g / 10 mL (8.9% vol), 0.8 g / 10 mL (10.1% vol), 0.9 g / 10 mL (11.4% vol), 1.0 g / 10 mL (12.7% vol), 1.1 g / 10 mL (13.9% vol), and 1.2 g / 10 mL (15.2% vol) ethanol, respectively. The medium was incubated at 30°C for 12 h. The OD values ​​were as follows: Figure 5 As shown, the OD values ​​(bacterial concentration) of ethanol volume fractions from 7.6% vol to 11.4% vol did not differ significantly (p>0.05). K. marxianus It can tolerate an ethanol concentration of 0.9 g / 10 mL (11.4%).

[0059] 2.3.3 K. marxianus Tolerable pH value Will K. marxianus 2% inoculum was inoculated into YPD liquid medium at pH 7.0, 6.5, 6.0, 5.5, 5.0, 4.0, 3.5, and 3.0, respectively, and incubated at 30℃ for 12 h. The OD values ​​were as follows: Figure 6 As shown, the OD values ​​of the bacterial culture did not differ significantly between pH 3.5 and 5.5 (p>0.05). K. marxianus It can tolerate a pH value of 3.5.

[0060] 2.3.4 K. marxianus Tolerable NaCl concentration Will K. marxianus2% inoculum was inoculated into YPD liquid medium containing NaCl concentrations of 0.085 g / 10 mL (0.85%), 0.117 g / 10 mL (1.17%), 0.234 g / 10 mL (2.34%), 0.351 g / 10 mL (3.51%), 0.468 g / 10 mL (4.68%), and 0.585 g / 10 mL (5.85%), respectively. After incubation at 30℃ for 12 h, the OD values ​​were as follows: Figure 7 As shown, the OD values ​​of the bacterial culture did not differ significantly when NaCl concentration increased from 0.85% to 3.51% (p > 0.05), therefore... K. marxianus It can tolerate up to 3.51% NaCl.

[0061] 2.4 Optimization of conditions for optimal inulinase activity and ethanol production 2.4.1 Incubation temperature on K. marxianus Effects of inulinase production Determining the inulinase activity at different culture temperatures, such as Figure 8 As shown: There was no significant difference in inulinase activity between 60℃ and 70℃ (p>0.05), but the inulinase activity decreased significantly after 70℃ (p<0.05). The inulinase activity reached its highest value of 348.29 U / mL at 60℃.

[0062] 2.4.2 Inoculation dosage K. marxianus Effects of inulinase activity The inulinase activity was determined at different inoculum amounts, such as... Figure 9 As shown.

[0063] K. marxianus The enzyme activity of the suspension was at its minimum at 5%, which was 215.79 U / mL; there was no significant difference between 20% and 25% (p>0.05), and the inulinase activity reached its maximum of 343.19 U / mL when the inoculum was 20%.

[0064] 2.4.3 Effects of different amounts of xylose added on K. marxianus Effects of inulinase activity Determining inulinase activity under different xylose addition levels, such as Figure 10 As shown: The inulinase activity at a xylose addition of 5 g / L was significantly higher than that at xylose additions of 4 g / L and 10 g / L (p<0.05), with the inulinase activity at its maximum value of 480.57 U / mL.

[0065] 2.4.4 Different pH values K. marxianus Effects of inulinase activity Determining inulinase activity at different pH values, such as Figure 11 As shown: As pH increases, inulinase activity shows a trend of first increasing and then decreasing. In the bacterial suspension, inulinase activity fluctuates little and is not significant from pH 4 to 6 (p>0.05). At pH 6, inulinase activity reaches its maximum value of 264.73 U / mL.

[0066] 2.4.5 FeSO4 to K. marxianus Effects of inulinase activity The amount of FeSO4 added has a significant impact on inulinase activity. The inulinase activity was measured under different FeSO4 addition amounts. Figure 12 As shown.

[0067] The inulinase activity reached its maximum value of 454.27 U / mL at a FeSO4 addition of 7 g / L, and its minimum value of 358.36 U / mL at a FeSO4 addition of 10 g / L.

[0068] 2.5 Ethanol production volume fraction under optimal enzyme activity conditions Based on the results of single-factor experiments, and considering the combined effects of various factors on the activity of inulinase, the following parameters were selected for the preparation of the liquid basal medium YPD: xylose concentration of 5 g / L, FeSO4 concentration of 7 g / L, and pH of 6. K. marxianus The inoculum size was 20%, and the culture was carried out at 60℃ for 168 h. Inulinase activity was measured every 24 h and compared with that under normal conditions (liquid basal medium YPD). K. marxianus The enzyme activities of the inoculum (2% and cultured at 30℃) were compared, and the results are shown in Table 1.

[0069] Table 1. Inulinase activity under normal and optimal conditions. As can be seen from Table 1, K. marxianus The inulinase activity after 48 h of cultivation under optimal conditions was significantly different from that at other times (p<0.05), reaching a maximum of 573.58 U / mL, which was 2.09 times higher than before optimization.

[0070] In the liquid basal medium YPD, the xylose concentration was 5 g / L, the FeSO4 concentration was 7 g / L, and the pH was 6. K. marxianus The inoculum size was 20%, and the culture was carried out at 60℃ for 168 h. The alcohol content (ethanol content) was measured every 24 h, and compared with that under normal conditions (liquid basal medium YPD). K. marxianus The alcohol content (ethanol content) of the inoculum (2%) was compared at a temperature of 30℃, and the results are shown in Table 2.

[0071] Table 2 Ethanol content under normal and optimal conditions Note: Different letters indicate significant differences (P<0.05), while the same letter indicates no significant differences (P<0.05).

[0072] As shown in Table 2, K. marxianus The alcohol content did not differ significantly between 120 h and 24 h of inulinase culture under optimal enzyme activity conditions, reaching a maximum of 2.41% vol, which is 2.5 times higher than before optimization.

[0073] 4. Conclusion K. marxianus It has the characteristics of being able to withstand a maximum temperature of 40℃, a maximum ethanol volume fraction of 11.4%, a minimum pH value of 3.5, and a maximum NaCl content of 3.51%.

[0074] K. marxianus In liquid basal medium YPD, with xylose added at 5 g / L, FeSO4 added at 7 g / L, pH at 6, and inoculum size at 20%, the inulinase activity was 573.58 U / mL after culturing at 60℃ for 48 h, which was 2.09 times higher than before optimization; the alcohol content reached a maximum of 2.41% vol after 120 h of culture, which was 2.5 times higher than before optimization.

[0075] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A type of Kluyveromyces maculae ( Kluyveromyces marxianus strain huJ01, characterized in that, The strain has the accession number CGMCC No. 22931.

2. The Kluyveromyces martensii strain according to claim 1, characterized in that, The strain possesses at least one of the following tolerances: (1) The maximum temperature it can withstand is 40℃; (2) The highest tolerance for ethanol volume fraction was 11.4%; (3) The lowest pH value it can tolerate is 3.5; (4) The maximum NaCl mass fraction it can tolerate is 3.51%.

3. The *Kluyveromyces martensii* strain according to claim 1 or 2, characterized in that, The strain is able to secrete inulinase and use xylose to ferment and produce ethanol.

4. A microbial preparation, characterized in that, It includes the *Kluyveromyces martensii* strain as described in any one of claims 1 to 3.

5. A fermentation medium for producing ethanol, characterized in that, The medium comprises the *Kluyveromyces martensii* strain according to any one of claims 1 to 3, and the medium contains xylose as a carbon source.

6. The fermentation medium according to claim 5, characterized in that, The culture medium also contains FeSO4; the pH value of the culture medium is 4-10.

7. A method for producing ethanol using Kluyveromyces martensii strain, characterized in that, The *Kluyveromyces martensii* strain of any one of claims 1 to 3 is inoculated into the fermentation medium of claim 5 or 6 to produce ethanol by fermentation.

8. The method according to claim 7, characterized in that, The fermentation temperature is 30~60℃, and the fermentation time is 24~168 h.

9. The method according to claim 8, characterized in that, The fermentation medium contains 4-6 g / L xylose and 5-9 g / L FeSO4; the inoculation percentage of the Kluyveromyces martensii strain is 1-25%.

10. The use of the *Kluyveromyces martensii* strain according to any one of claims 1 to 3 in the fermentation production of ethanol using xylose or inulin as substrates.