Rice gene osusp23 and application of the encoded protein in regulating rice disease resistance

By regulating the expression level of the rice gene OsUSP23, the disease resistance of rice was enhanced, solving the problem of rice blast and sheath blight control, and realizing green prevention and control and sustainable agricultural development.

CN122104736APending Publication Date: 2026-05-29HUNAN AGRI UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
HUNAN AGRI UNIV
Filing Date
2026-03-24
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively control rice blast, resulting in severe losses in rice yield. Furthermore, chemical pesticides are costly to use and pose environmental pollution risks.

Method used

By regulating the expression level of the rice gene OsUSP23, its disease resistance in rice can be enhanced through the SA/JA-mediated signaling pathway. OsUSP23 overexpression vector and CRISPR/Cas9 knockout vector were constructed to cultivate disease-resistant transgenic rice plants.

Benefits of technology

It significantly enhances rice's resistance to rice blast and sheath blight, reduces reliance on chemical pesticides, and achieves green pest control and sustainable agricultural development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104736A_ABST
    Figure CN122104736A_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of genetic engineering, and particularly relates to a rice gene OsUSP23 and application of the encoded protein in regulation of disease resistance of rice. Previous studies have found that OsUSP23, as a protein containing a USP domain, is significantly up-regulated when Magnaporthe oryzae invades, which proves that it may be involved in the interaction between rice and Magnaporthe oryzae; after cultivating overexpression OsUSP23 -OX plants, it is found that the disease is reduced and the fungal biomass is reduced, which indicates that the rice significantly enhances the resistance to Magnaporthe oryzae and Rhizoctonia solani; after cultivating knockout mutants osusp23 of plants, the resistance of rice to Magnaporthe oryzae is reduced, which indicates that the gene OsUSP23 positively regulates the resistance of rice to Magnaporthe oryzae; the application effectively reduces the dependence of rice on pesticides by cultivating OsUSP23 -OX disease-resistant varieties, and provides a potential genetic target point for molecular breeding of rice broad-spectrum disease-resistant varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, and specifically relates to a gene that regulates disease resistance in rice. Background Technology

[0002] Rice blast fungus ( Magnaporthe oryzae Rice blast, caused by [unspecified pathogen], is one of the most prevalent and destructive fungal diseases globally. It can occur in different organs throughout the rice's growth cycle and can be classified into five types based on the stage and location of infection: leaf blast, seedling blast, neck blast, grain blast, and node blast. Neck blast and leaf blast cause the most severe yield losses. Therefore, effective control of rice blast is a crucial prerequisite for ensuring global food security.

[0003] Universal stress proteins (USPs) are a family of proteins encoding a universal stress protein domain. This conserved domain typically consists of 140-160 highly conserved amino acid residues and is the core functional unit of the USP family. As typical stress-response genes, USP genes exhibit significant stress-induced expression characteristics. These proteins are widely found in various organisms, including bacteria, fungi, plants, and mammals, demonstrating their high conservation in living systems. Studies have shown that USP proteins can respond to various abiotic stresses such as salt, drought, cold, heat, and oxidative stress. For example, overexpression of USP proteins in tomatoes... SpUSP It can reduce the size of leaf stomata, minimizing the impact of drought stress; rice OsUSP1 The first USP gene identified in plants is highly homologous to the ATP-binding USP protein of bacterial MJ0577, and may mediate ethylene-driven anaerobic stress adaptation. Differentiated USPs in various crops have evolved mechanisms to perform specialized functions under specific stress conditions, thereby protecting plants from a variety of abiotic adverseities. Therefore, exploring the functions of USPs in different species is of great significance for improving crop stress resistance. Rice blast is a major biological stressor facing stable rice production globally. Investigating the functions of rice USP family genes and elucidating the rice immune regulatory network is crucial for breeding durable disease-resistant rice varieties. Summary of the Invention

[0004] To address the aforementioned technical problems, this invention proposes a rice gene. OsUSP23 The application of its encoded proteins in regulating disease resistance in rice.

[0005] The technical solution of this invention is implemented as follows: In the previous transcriptome analysis of the interaction between the disease-resistant rice variety "Mowanggu" and rice blast fungus, significantly upregulated USP family genes were identified.OsUSP23 . OsUSP23 The significant upregulation of OsUSP23 suggests its potential involvement in the defense mechanism of rice against rice blast fungus. We investigated the function of OsUSP23 in the disease resistance signaling pathway through tissue expression analysis and inoculation phenotypic identification.

[0006] On the one hand, this invention provides a rice gene OsUSP23 The application of its encoded proteins in regulating disease resistance in rice.

[0007] Preferably, the above-mentioned genes OsUSP23 The nucleotide sequence is shown in SEQ ID NO.1. The rice genome sequence number encoding the protein is LOC_Os05g28740, and the link to the rice genome database is https: / / www.ricedata.cn / .

[0008] Preferably, the above regulation is achieved through gene overexpression. OsUSP23 To improve the disease resistance of rice.

[0009] Preferably, the above-mentioned disease resistance is resistance to rice blast and / or rice sheath blight, and the rice variety is Nipponbare.

[0010] After exogenous application of salicylic acid (SA) and jasmonic acid (JA), OsUSP23 The transcriptional level was significantly elevated, suggesting that it may be involved in the SA / JA-mediated signaling pathway.

[0011] Secondly, this invention also applies for protection of a method for improving the disease resistance of rice: by enhancing the rice genes OsUSP23 The expression level of this substance can thus improve the disease resistance of rice.

[0012] Preferably, the above-mentioned genes OsUSP23 The nucleotide sequence is shown in SEQ ID NO.1. The disease resistance is against rice blast and / or rice sheath blight. The rice variety is Nipponbare.

[0013] Thirdly, this invention also seeks to protect a method for cultivating disease-resistant transgenic rice, and for constructing genes. OsUSP23 The overexpression vector was transferred into Agrobacterium, and then rice tissues were infected to cultivate disease-resistant transgenic rice plants.

[0014] Constructing genes OsUSP23 The Cas9 gene knockout vector was transferred into Agrobacterium and then used to infect rice tissues to cultivate disease-susceptible transgenic rice plants.

[0015] Preferably, the above-mentioned genes OsUSP23 The nucleotide sequence is shown in SEQ ID NO.1. The disease resistance is against rice blast and / or rice sheath blight. The rice variety is Nipponbare.

[0016] The present invention has the following beneficial effects: 1. Genes containing the USP domain were obtained in the preliminary screening of this application. OsUSP23 Under the induction of rice blast fungus, OsUSP23 The transcriptional level was significantly upregulated, indicating its involvement in and regulatory role in the rice blast defense response. Following exogenous application of SA and JA, OsUSP23 Significantly elevated transcription levels indicate its involvement in the SA / JA-mediated signaling pathway; PTI-related inducers chitin, flg22, and... M. oryzae Inoculated leaves showed chitin, flg22 and M. oryzae Inoculation significantly induced OsUSP23 expression, indicating its involvement in plant immunity; further research was conducted to create... OsUSP23 Overexpression transgenic lines ( OsUSP23 -OX) and knockout mutants ( osusp23 ), vaccination M. oryzae back, OsUSP23 -OX reduced plant symptoms, decreased fungal biomass, increased the expression level of disease resistance-related genes, and significantly enhanced rice resistance to rice blast. osusp23 This leads to decreased resistance. OsUSP23 -Inoculation on OX plants R. solani The phenotype was consistent with the results of inoculation with rice blast fungus, and overexpression was observed. OsUSP23 It also significantly enhances rice's resistance to sheath blight, indicating that it plays a role in rice's resistance to fungal infection.

[0017] 2. This application focuses solely on the precise regulation of rice's own genes, without introducing any exogenous DNA (such as bacterial resistance genes or reporter genes). It amplifies the function of endogenous disease-resistant genes, overcoming the bottlenecks in transgenic regulation and public acceptance: discovering the broad-spectrum antifungal properties of OsUSP23, thus addressing the pain point of overlapping disease damage. OsUSP23 -OX strain not only inoculated M. oryzae After inoculation, the lesions significantly decreased in size. R. solani Afterwards, the lesion area was significantly reduced compared to NPB, and the defense gene... OsPR1b / OsPDR / OsE2F The expression is significantly upregulated; driving the transformation to green prevention and control at low cost, and contributing to the sustainable development of agriculture. Compared with the cost of chemical pesticides for controlling rice blast (the annual cost of pesticides accounts for 15%-20% of the planting cost, and is prone to pesticide residues and environmental pollution), this invention cultivates... OsUSP23 -OX disease-resistant varieties effectively reduce reliance on pesticides. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 pCXUN-HA- OsUSP23 Integration carrier diagram.

[0020] Figure 2 Image of the CRISPR / Cas9 BGK032 vector plasmid.

[0021] Figure 3 for OsUSP23 Expression pattern analysis; Figure A shows the expression pattern detected by qRT-PCR. OsUSP23 During vaccination Magnaporthe oryzae The expression level after B is the expression level detected by qRT-PCR. OsUSP23 Expression levels of chitin and flg22 after treatment, C represents qRT-PCR detection. OsUSP23 Gene expression levels after treatment with salicylic acid and jasmonic acid. Data are expressed as mean ± standard deviation (mean ± SD) from a one-way ANOVA test, with experiments repeated three times (* indicates...). p <0.05, ** indicates p <0.01).

[0022] Figure 4 for OsUSP23 Overexpression enhances rice resistance to rice blast fungus; Figure A shows... OsUSP23 -The phenotype of OX plants after inoculation with rice blast fungus 110-2, B is... OsUSP23 - OX represents the length (cm) of lesions on plants inoculated with rice blast fungus 110-2, and C represents the detection of rice blast fungus (110-2) by real-time quantitative PCR (qRT-PCR). MOPOT2 Expression level, and rice OsUbq Genes were normalized as internal controls; relative fungal biomass was calculated, with D as... OsUSP23 -The phenotype of OX plants inoculated with rice blast fungus P131, E is... OsUSP23- Length (cm) of lesions (OX) inoculated with rice blast fungus P131, F represents the detection of rice blast fungus (P131) by real-time quantitative PCR (qRT-PCR). MOPOT2 Gene expression levels, and in rice OsUbq Genes were normalized as internal controls; relative fungal biomass was calculated; GJ represents the value after inoculation with rice blast fungus. OsUSP23The qRT-PCR results of the expression levels of disease resistance genes in rice and Nipponbare rice showed that G was... OsNPR1 H is OsNAC4 I is OsPR5 J is OsMAPK6 Error bars represent the standard deviation (SD) of three repeated experiments (* indicates...). p <0.05, ** indicates p <0.01).

[0023] Figure 5 After inoculation with rice blast fungus OsUSP23 Knockout rice ( osusp23 The phenotypes of Nipponbare and Japan; where Figure A is... osusp23 Phenotypic characteristics of mutant plants inoculated with rice blast fungus 110-2, B is osusp23 The length (cm) of lesions after inoculation with rice blast fungus 110-2, where C represents the relative fungal biomass of rice blast fungus 110-2 as detected by real-time quantitative PCR (qRT-PCR) (based on rice). OsUbq (Genes are internal references, standardized), D is... osusp23 Phenotypic characteristics of transgenic plants inoculated with rice blast fungus isolate P131, E is osusp23 The length (cm) of lesions after inoculation with rice blast fungus P131, where F represents the relative fungal biomass of rice blast fungus P131 as detected by real-time quantitative PCR (based on rice). OsUbq Genes are standardized as internal controls); error bars represent the standard deviation (SD) of three replicate experiments (*). p<0.05 ** p <0.01).

[0024] Figure 6 OsUSP23 overexpression enhances rice resistance to sheath blight pathogen ( R. solani Resistance to ) ; where Figure A shows the use of OsUSP23 - The phenotypes of OX and NPB (the latter being the control CK) after in vitro inoculation with sheath blight, B representing the relative lesion area after inoculation with sheath blight pathogen, and CE representing the lesion area after inoculation with sheath blight pathogen detected by real-time quantitative PCR (qRT-PCR). OsUSP23 -Defense-related genes in OX plants OsPR1b , OsPDR , OsE2F The expression; the error bars represent the standard deviation (SD) of three repeated experiments (** p <0.01). Detailed Implementation

[0025] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0026] Unless otherwise specified, the experimental methods used in the following experimental examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.

[0027] This study uses OsUSP23 as the research object and constructs... OsUSP23 Overexpression and gene-edited plants were used to analyze rice blast resistance, clarifying the function of OsUSP23 in the interaction between rice and rice blast fungus. The molecular mechanism by which OsUSP23 regulates the expression of related defense genes and modulates rice resistance to rice blast fungus and sheath blight fungus was elucidated, providing potential genetic targets for molecular breeding of disease-resistant rice varieties.

[0028] Example: Rice OsUSP23 Overexpression vector and CRISPR / Cas9 knockout mutant construction Previous multi-omics analysis of the highly resistant rice blast variety "Mowanggu" in this application showed that the genes OsUSP23 The gene was significantly upregulated 24 hours after infection with rice blast fungus. This application used the susceptible japonica rice variety Nipponbare (NPB) as material to investigate the gene. OsUSP23 In rice - M. oryzae Functions in the interaction. For further analysis... OsUSP23 To investigate the temporal expression characteristics of rice blast fungus after infection, we used real-time quantitative PCR (RT-qPCR) to analyze the expression of rice blast fungus in leaves at 0, 24, 48, and 72 h post-infection. OsUSP23 Transcripts were quantitatively analyzed. Further research revealed that genes OsUSP23 OsUSP23 is significantly induced by PAMP molecules flg22 and chitin, and participates in the signaling network regulation of salicylic acid (SA) and jasmonic acid (JA) in rice. To elucidate the function of OsUSP23 in the rice defense response, we constructed... OsUSP23 Overexpression transgenic lines ( OsUSP23 -OX) and CRISPR / Cas9 knockout mutants ( osusp23 The specific steps are as follows: Overexpression lines: OsUSP23 The CDS sequence was constructed into the pCXUN-HA plant overexpression vector via homologous recombination. OsUSP23 See the diagram of the fusion carrier. Figure 1The restriction enzyme site is XcmI. Positive clones were transformed into Agrobacterium EH105, and single colonies were picked for expansion culture. Appropriately sized callus tissue was selected for Agrobacterium infection and transformation. After 3 days of co-culture, selection was performed on hygromycin selection medium. Bright yellow positive callus was selected for differentiation and regeneration. When obvious roots appeared, the seedlings were transferred to rooting medium. PCR detection of T0 generation plants yielded positive seedlings. Subsequent analysis of T0 generation positive seedlings was performed using qRT-PCR. OsUSP23 Expression levels were detected, and high-expression lines were selected for propagation and subsequent experiments.

[0029] CRISPR / Cas9 knockout mutants: According to OsUSP23 The gene sequence was used to design a gRNA knockout target (GTCGTGGTGCCTCTCCAACG) and constructed into the CRISPR Cas9 BGK032 vector. The CRISPR / Cas9 BGK032 vector plasmid map can be found here. Figure 2 Positive clones were selected and T0 generation plants were obtained through Agrobacterium-mediated genetic transformation. PCR detection primers (CR-F: GCAGCCATGGAGAACGTCAC, CR-R: ATGTAGCGGTCCATGCTGTC) were designed based on the target. The PCR products were analyzed for mutation types using first-generation sequencing. Positive seedlings with different editing types were selected for propagation and subsequent experiments.

[0030] Example of implementation effect: Gene OsUSP23 Functional analysis of regulating rice blast resistance The rice blast fungus, cultivated in the example, was inoculated by scrambling with physiological races P131 and Guy11. OsUSP23 Overexpression transgenic lines ( OsUSP23 -OX), CRISPR / Cas9 knockout mutants ( osusp23 The resistance of the strains and NPB to rice blast was evaluated.

[0031] The inoculation steps for rice blast fungus and rice sheath blight fungus are as follows: 1. Preparation of rice materials and rice blast fungus strains (1) Rice materials and growing conditions: OsUSP23 Overexpression line (LOC_Os05g28740 (https: / / www.ricedata.cn / ); OsUSP23 -OX) and CRISPR / Cas9 knockout mutants ( osusp23 Stable genetically inherited T3 generation seedlings. Rice plants were cultured in a greenhouse at 26-28℃ under photoperiod conditions of 16 hours light / 8 hours dark.

[0032] (2) Different physiological races of rice blast fungus, Guy11 and P131, were activated and spores were induced to form on potato dextrose agar (PDA) and tomato-oatmeal agar (TOA) plates, respectively, under constant temperature incubation at 28℃.

[0033] 2. OsUSP2 3. Induced Expression Analysis Preparation of rice blast fungus from sporulating plate cultures ( M. oryzae Conidial suspension (1×10) 6 Conidia ( / mL) were sprayed onto 4-week-old NPB seedlings for inoculation. After 24 hours of inoculation under 26°C in darkness and high humidity, the inoculated plants were transferred to a growth chamber (16 hours light / 8 hours dark). Leaves were collected at 0, 24, 48, and 72 hours post-inoculation (hpi), and total RNA was extracted using TRIzol reagent and analyzed by qRT-PCR. OsUSP23 Level of expression.

[0034] 3. Phenotypic analysis of rice blast fungus inoculation The 8-week-old infant was vaccinated using the laceration method. OsUSP23 OX and osusp23 Inoculate detached leaves of the plant with a suspension of rice blast fungus conidia (1×10⁻⁶). 5 (Conidia / mL), cultured in the dark at 28°C for 36 hours, followed by a 16-hour light / 8-hour dark cycle for 5 days. Pathogen length was measured with a ruler, and fungal biomass was assessed by qRT-PCR.

[0035] 4. Subculture and inoculation of *Rhizoctonia solani* After punching out the mycelium with a punch, place it in the center of a PDA medium with tweezers (mycelium facing down). Incubate at 28°C in the dark for 2-3 days. When the mycelium has covered the entire petri dish, it can be inoculated. Cut rice leaves that have grown for about 3-4 weeks, place filter paper in a petri dish, and moisten with sterile water. Place 2-4 leaves in each petri dish, and place the mycelium containing the sheath blight pathogen in the center of the leaf. Incubate at 26°C for 12 hours of light and 12 hours of darkness for 3-5 days. During this period, keep the leaves moist and take photos to record the disease development.

[0036] 5. Detection of genes related to the course of sheath blight and determination of relative lesion area. RNA was extracted from leaves of NPB and overexpression mutant plants, using rice OsUBQ As an internal reference gene, it was used to detect the expression levels of genes related to the course of sheath blight.

[0037] To calculate the relative lesion area, diseased leaves were photographed, and ImageJ software was used to statistically analyze the lesion area of ​​the leaves. Three leaves were selected for each sample, the average value was taken, and three biological and technical replicates were performed.

[0038] 6. Experiments on rice treated with SA and JA When the rice plants reached the three-leaf stage, the leaves were sprayed with 100 mM jasmonic acid (JA), 2 mM salicylic acid (SA), and water, respectively, and then placed in a 26℃ greenhouse. Samples were taken at 0 h, 0.5 h, 2 h, and 6 h. The effects of the two hormone treatments were detected by quantitative real-time fluorescence detection. OsUSP23 Gene expression levels.

[0039] 7. Experiments on rice treatment with chitin and flg22 For wild-type rice plants with 4-6 leaves, cut a 1 cm section from the second-to-last leaf. 2 Leaflets were treated overnight with sterile water. They were treated with 100 nM flg22, 8 nM chitin, and sterile water, respectively, with three biological replicates per group. Samples were taken at 0 h, 1 h, 3 h, and 6 h. RNA was extracted from each sample, reverse transcribed into cDNA, and analyzed by quantitative real-time fluorescence. OsUSP23 The expression levels of genes at different time points were detected.

[0040] To investigate whether OsUSP23 participates in plant defense, the concentration of OsUSP23 in rice leaves was measured at 0, 24, 48, and 72 hours after infection with rice blast fungus. OsUSP23 Transcript quantification results showed that OsUSP23 Expression levels gradually increased within 0 to 24 hours after infection, reaching a peak (approximately 2.5 times the initial level), and then gradually decreased. Figure 3 A). Furthermore, OsUSP23 expression was induced by chitin and flg22, with expression levels increasing approximately 30-fold and 21-fold, respectively, after 6 hours of treatment. Figure 3 B). In rice treated with exogenous plant defense hormones salicylic acid (SA) and methyl jasmonate (MeJA), the transcriptional level of OsUSP23 was upregulated by approximately 17-fold at 2 hours; after 6 hours, the expression level of OsUSP23 remained largely unchanged after SA treatment, but after 6 hours of MeJA treatment, its transcriptional level was further upregulated to a peak level of 51-fold. Figure 3 C). These results indicate that OsUSP23 is involved in the immune response in rice.

[0041] To elucidate the role of OsUSP23 in plant disease resistance, we constructed a gene sequence in the NPB genetic background. OsUSP23 Overexpression plants. In transgenic plants... OsUSP23 The expression level of [the substance] was significantly higher than that of the control plants. Two independent [samples] were selected. OsUSP23 Overexpression lines ( OsUSP23-OX (numbers 6 and 7) were used for subsequent experiments. When inoculating with rice blast fungus isolate 110-2 via a scalding technique... OsUSP23 -The leaf lesion length of the OX strain was significantly smaller than that of the NPB control plant, and the fungal biomass was also lower. Figure 4 AC). Similarly, after inoculation with another rice blast fungus isolate (P131), OsUSP23 -OX plants show milder symptoms than NPB plants. Figure 4 DF), indicating OsUSP23 Overexpression enhanced rice's resistance to M. oryzae Resistance.

[0042] We further explored the regulatory mechanism of OsUSP23 in the disease resistance signaling pathway. [This was followed by an unrelated sentence about vaccination.] M. oryzae After NPB and OsUSP23 Changes in the expression of disease resistance-related genes in OX plants were observed, with changes found in both materials 24 hours after inoculation. OsPR5 , OsNPR1 , OsNAC4 and OsMARP6 The expression levels of all of them were significantly increased ( Figure 4 (GJ). The expression of disease resistance genes was consistent with the previous inoculation phenotype, indicating that OsUSP23 increased the relative expression level of disease resistance-related genes. Therefore, OsUSP23 may participate in rice resistance to disease. M. oryzae Interacting regulatory networks enhance resistance.

[0043] To further clarify OsUSP23 To investigate its role in rice defense against rice blast fungus, we constructed a gene using CRISPR / Cas9 technology in an NPB genetic background. OsUSP23 Knockout ( osusp23 Transgenic lines. (and) OsUSP23 The enhanced resistance phenotype observed in overexpressed plants was different. osusp23 After inoculation with rice blast fungus 110-2, the strains showed significantly larger lesions and greater fungal biomass compared to the NPB control. Figure 5 AC). A similar phenotype was observed when inoculated with another small race, P131: after scratch inoculation. osusp23 The length of lesions, fungal biomass, and severity of disease in the strain were all significantly higher than those in the NPB control. Figure 5 DF). In summary, these results indicate that OsUSP23 It plays a positive regulatory role in rice blast resistance.

[0044] This study also explored OsUSP23 In rice, the pathogen of sheath blight ( R. solani The function of resistance. The results showed that... OsUSP23 -OX vaccination R. solaniAfterwards, the leaf lesions were significantly smaller than those of the NPB control plants ( Figure 6 AB). The above inoculation results indicate that... OsUSP23 Overexpression of NPB enhanced resistance to Rhizoctonia solani. We compared NPB and... OsUSP23 The expression of disease resistance-related genes in -OX plants was analyzed by real-time quantitative PCR (qRT-PCR), and the results showed that... OsPR1b , OsPDR and OsE2F The expression level in OsUSP23 The -OX lines were significantly higher than NPB plants ( Figure 6 CE). These results are consistent with the inoculation phenotype of *Rhizoctonia solani*, indicating that... OsUSP23 It is possible that rice's resistance to fungal infection can be enhanced by increasing the transcription level of disease-resistant genes.

[0045] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Rice genes OsUSP23 The application of its encoded proteins in regulating disease resistance in rice.

2. The application according to claim 1, characterized in that: The gene OsUSP23 The nucleotide sequence is shown in SEQ ID NO.1, and the rice genome sequence number encoding the protein is LOC_Os05g28740.

3. The application according to claim 2, characterized in that: The regulation is achieved through gene overexpression. OsUSP23 To improve the disease resistance of rice.

4. The application according to claim 3, characterized in that: The disease resistance refers to resistance to rice blast and / or rice sheath blight, and the rice variety is Nipponbare.

5. A method for improving the disease resistance of rice, characterized in that: By improving rice genes OsUSP23 The expression level of this substance can thus improve the disease resistance of rice.

6. The method according to claim 5, characterized in that: The gene OsUSP23 The nucleotide sequence is shown in SEQ ID NO.

1.

7. The method according to claim 6, characterized in that: The disease resistance refers to resistance to rice blast and / or rice sheath blight, and the rice variety is Nipponbare.

8. A method for cultivating disease-resistant transgenic rice, characterized in that: Constructing genes OsUSP23 The overexpression vector was transferred into Agrobacterium, and then rice tissues were infected to cultivate disease-resistant transgenic rice plants.

9. The method according to claim 8, characterized in that: The gene OsUSP23 The nucleotide sequence is shown in SEQ ID NO.

1.

10. The method according to claim 9, characterized in that: The disease resistance refers to resistance to rice blast and / or rice sheath blight, and the rice variety is Nipponbare.