Application of wheat TaSnRK2.4-B gene in improving resistance to wheat scab
By studying the expression characteristics and function of the wheat TaSnRK2.4-B gene and utilizing gene overexpression technology, the problem of insufficient resistance to wheat Fusarium head blight was solved, and wheat resistance to Fusarium head blight was significantly enhanced, providing a key resource for molecular breeding.
Patent Information
- Application Number
- CN202610524426.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-20
- Publication Date
- 2026-05-29
AI Technical Summary
The function of the wheat TaSnRK2.4-B gene in wheat scab resistance is unknown in current technologies, and there is a lack of effective molecular breeding methods to improve wheat resistance to scab.
Research revealed that the wheat TaSnRK2.4-B gene is expressed under pathogen infection and exogenous hormone induction. Using gene function loss and overexpression technology, a new wheat variety resistant to Fusarium head blight was constructed. The positive regulatory effect of the TaSnRK2.4-B gene was utilized to enhance the wheat's resistance.
Significantly improves wheat resistance to Fusarium head blight, provides key molecular breeding resources and gene marker-assisted selection methods, enhances wheat resistance to Fusarium head blight fungus, and ensures food security.
Smart Images

Figure CN122104790A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to the application of the wheat TaSnRK2.4-B gene in improving wheat resistance to Fusarium head blight. Background Technology
[0002] Wheat is one of the world's most important food crops, and the stability of its yield and quality is crucial to food security. Fusarium head blight (FBB), primarily caused by pathogenic fungi such as *Fusarium graminearum*, is a significant disease affecting wheat growth. This disease not only directly causes severe yield losses, leading to ear rot and shriveled grains, but the pathogens also produce various mycotoxins during infection. These toxins remain in the grains and processed products, seriously threatening human and animal health. Therefore, breeding and developing new wheat varieties resistant to FHB is a vital means of addressing these problems.
[0003] TaSnRK (Sucrose non-ferment-1-related protein kinase) belongs to the Ser / Thr protein kinase family. It primarily regulates target proteins through phosphorylation and coordinates interactions among various physiological signaling pathways in plants, playing an indispensable role in stress responses. The wheat TaSnRK gene family has numerous members, and their functional diversity is gradually being revealed. However, the specific biological functions of most members, especially their roles in responding to major diseases such as Fusarium head blight, still require further analysis. Salicylic acid (SA) and methyl jasmonate (MeJA), as important signaling molecules, play crucial roles in plant defense against live and semi-live, semi-live, and necrotic pathogens, respectively. The applicant's research found that TaSnRK2.4-B in the wheat TaSnRK gene family is strongly upregulated under the induction of exogenous hormones salicylic acid and methyl jasmonate, suggesting that this gene likely plays an important role in the SA and JA-mediated defense signaling pathways. However, to date, there have been no reports on the function of the wheat TaSnRK2.4-B gene, and its specific role and molecular mechanism in wheat resistance to Fusarium head blight remain unknown. Summary of the Invention
[0004] This invention addresses a gap in existing technologies by providing the application of the wheat TaSnRK2.4-B gene in enhancing wheat resistance to Fusarium head blight. The invention reveals that this gene is induced by pathogens and defense signals. Furthermore, through gene loss-of-function and overexpression techniques, the novel function of the wheat TaSnRK2.4-B gene in positively regulating wheat resistance to Fusarium head blight was fully verified. New wheat varieties resistant to Fusarium head blight can be constructed using gene overexpression technology, providing a key target gene and new germplasm resources for molecular breeding of wheat resistant to Fusarium head blight.
[0005] To achieve the above objectives, the present invention adopts the following technical solution: This invention provides a novel function of the serine / threonine protein kinase TaSnRK2.4-B in positively regulating wheat resistance to Fusarium head blight. Studies have found that the transcriptional level of the wheat TaSnRK2.4-B gene is induced by Fusarium graminearum infection; silencing the TaSnRK2.4-B gene significantly reduces wheat resistance to Fusarium graminearum, while overexpression of the TaSnRK2.4-B gene significantly enhances wheat resistance to Fusarium graminearum.
[0006] Specifically, this invention provides the application of the wheat TaSnRK2.4-B gene in any of the following A1)-A6): A1) Application in improving wheat scab resistance; A2) Application in the preparation of products that enhance resistance to wheat scab; A3) Application in the breeding of wheat varieties resistant to Fusarium head blight; A4) Application in the preparation of products for breeding wheat varieties resistant to Fusarium head blight; A5) Application in identifying or assisting in the identification of wheat varieties resistant to Fusarium head blight; A6) Application in the preparation of products for identifying or assisting in the identification of wheat varieties resistant to Fusarium head blight; The amino acid sequence encoded by the TaSnRK2.4-B gene is shown in SEQ ID NO.2.
[0007] Furthermore, the nucleotide sequence of the TaSnRK2.4-B gene is shown in SEQ ID NO.1.
[0008] Furthermore, by promoting the expression of the TaSnRK2.4-B gene or enhancing the function or activity of its protein, wheat resistance to Fusarium head blight can be improved or Fusarium head blight-resistant wheat varieties can be bred.
[0009] Furthermore, the expression level of the TaSnRK2.4-B gene was detected to identify or assist in the identification of wheat resistant to Fusarium head blight.
[0010] Furthermore, the determination method is as follows: if the gene is detected or the expression level of the gene is significantly increased compared with normal plants, it is considered wheat resistant to Fusarium head blight.
[0011] This invention also provides the use of the overexpression vector containing TaSnRK2.4-B in any of the following A1)-A6): A1) Application in improving wheat scab resistance; A2) Application in the preparation of products that enhance resistance to wheat scab; A3) Application in the breeding of wheat varieties resistant to Fusarium head blight; A4) Application in the preparation of products for breeding wheat varieties resistant to Fusarium head blight; A5) Application in identifying or assisting in the identification of wheat varieties resistant to Fusarium head blight; A6) Application in the preparation of products for identifying or assisting in the identification of wheat varieties resistant to Fusarium head blight; The amino acid sequence encoded by the TaSnRK2.4-B gene is shown in SEQ ID NO.2.
[0012] Furthermore, the backbone vector of the overexpression vector is the expression vector pBWA(V)BU.
[0013] Furthermore, the method for constructing the overexpression vector includes the following steps: using wheat cDNA as a template, amplifying the TaSnRK2.4-B gene fragment with primers shown in SEQ ID NO.8-9, and ligating the gene fragment with the linearized pBWA(V)BU vector through homologous recombination to obtain the TaSnRK2.4-B gene overexpression vector.
[0014] The present invention also provides a method for improving wheat resistance to Fusarium head blight and / or for breeding wheat lines resistant to Fusarium head blight, by promoting the expression of the TaSnRK2.4-B gene or enhancing the function or activity of its protein, thereby improving wheat resistance to Fusarium head blight, wherein the amino acid sequence encoded by the TaSnRK2.4-B gene is shown in SEQ ID NO.2.
[0015] Furthermore, using the expression vector pBWA(V)BU as the backbone vector, an overexpression vector containing the TaSnRK2.4-B gene was constructed and transformed into wheat to obtain wheat lines overexpressing the TaSnRK2.4-B gene, thereby improving wheat resistance to Fusarium head blight and / or cultivating wheat lines resistant to Fusarium head blight.
[0016] Furthermore, an overexpression vector containing the TaSnRK2.4-B gene was transformed into wheat using an Agrobacterium-mediated transformation method. After screening and culture, transgenic plants were obtained, resulting in TaSnRK2.4-B gene overexpression plant lines.
[0017] Beneficial effects: 1. This invention, for the first time through systematic molecular biology and genetic experiments, confirms that the wheat TaSnRK2.4-B gene is a key gene capable of positively regulating wheat resistance to Fusarium head blight, filling a gap in the study of this gene's function and possessing significant theoretical value. Overexpression of this gene in wheat can significantly enhance wheat resistance to Fusarium head blight. Furthermore, this gene can be used for marker-assisted selection to breed wheat lines with high resistance to Fusarium head blight. This gene can serve as an important genetic resource for breeding Fusarium head blight-resistant wheat lines, and has significant application prospects for controlling Fusarium head blight damage and ensuring food security.
[0018] 2. This invention has found that overexpression of the TaSnRK2.4-B gene can simultaneously activate defense genes downstream of the salicylic acid (SA) and jasmonic acid (JA) signaling pathways. This suggests that this gene may act as a regulatory node, synergistically mobilizing multiple defense responses in plants to more effectively resist Fusarium wilt infection, providing a new molecular target for cultivating crops with broad-spectrum and durable resistance. Attached Figure Description
[0019] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.
[0020] Figure 1 This is a schematic diagram illustrating the transcriptional level analysis of TaSnRK2.4-B after wheat Yangmai 158 was inoculated with Fusarium graminearum PH-1 in Example 1 of the present invention.
[0021] Figure 2 This is a schematic diagram showing the transcriptional level analysis results of the wheat gene TaSnRK2.4-B under the treatment of exogenous hormones salicylic acid (SA), methyl jasmonate (MeJA), hydrogen peroxide (H2O2), indoleacetic acid (IAA), and abscisic acid (ABA) in Example 2 of the present invention.
[0022] Figure 3 This is a schematic diagram showing the phenotypic observation and lesion area statistics of TaSnRK2.4-B silent leaves after inoculation with Fusarium graminearum PH-1 in Example 3 of the present invention. In this diagram, A is the result of gene silencing efficiency determination based on BSMV virus, B is a schematic diagram showing the lesion area statistics of TaSnRK2.4-B silent leaves and non-silenced leaves after inoculation with Fusarium graminearum PH-1 at 2.5 d, 3.5 d and 4.5 d, and C is a diagram showing the phenotypic observation results of TaSnRK2.4-B silent leaves after inoculation with Fusarium graminearum PH-1.
[0023] Figure 4 This diagram illustrates the expression level detection of the TaSnRK2.4-B gene in T1 generation wheat plants transgenic with the TaSnRK2.4-B gene, the phenotypic observation results of transgenic wheat infected with Fusarium graminearum PH-1, and the detection of expression levels of defense-related genes in Example 4 of this invention. A represents the expression level detection of the TaSnRK2.4-B gene in T1 generation wheat plants transgenic with the TaSnRK2.4-B gene; B represents the phenotypic identification of T1 generation wheat plants transgenic with the TaSnRK2.4-B gene after inoculation with Fusarium graminearum PH-1; C represents the expression level detection of the defense gene TaPR2 in the ETI downstream defense-related SA pathway; and D represents the expression level detection of the defense gene TaPR3 in the MeJA pathway.
[0024] Figure 5 This is a schematic diagram showing the phenotypic observation results and diseased spikelet count of T1 generation wheat plants transgenic with the TaSnRK2.4-B gene infected with Fusarium graminearum PH-1 in Example 4 of the present invention. In this diagram, A represents the phenotypic observation of T1 generation wheat plants transgenic with the TaSnRK2.4-B gene after inoculation with Fusarium graminearum PH-1; B represents the calculated diseased spikelet rate of T1 generation wheat plants transgenic with the TaSnRK2.4-B gene after inoculation. Detailed Implementation
[0025] The following embodiments are only used to more clearly illustrate the technical solutions of the present invention, and are therefore merely examples and should not be used to limit the scope of protection of the present invention. It should be noted that, unless otherwise stated, the technical or scientific terms used in this application should have the ordinary meaning understood by those skilled in the art. Unless specifically stated, the reagents, methods, and equipment used in this invention are conventional reagents, methods, and equipment in this technical field. Unless specifically stated, the reagents and materials used in the following embodiments are commercially available.
[0026] Example 1: Analysis of TaSnRK2.4-B expression after Fusarium graminearum infection This embodiment uses the common hexaploid wheat variety "Yangmai 158" as the experimental material and Fusarium graminearum type strain PH-1 as the pathogen to analyze the expression of the TaSnRK2.4-B gene in wheat ears after Fusarium graminearum infection.
[0027] The cDNA nucleotide sequence of the wheat TaSnRK2.4-B gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein it encodes is shown in SEQ ID NO.2.
[0028] Fusarium graminearum PH-1 was inoculated onto PDA plates for activation and culture, then transferred to mung bean soup medium for further culture to induce conidia production. The spore suspension concentration was adjusted to 1.0 × 10⁻⁶. 51.0 × 10⁶ florets / mL. Wheat plants were inoculated by drip inoculation of 1.0 × 10⁶ florets per floret from the flowering stage. 5 A 10 μL suspension of PH-1 strain conidia per mL was used to inoculate each wheat ear. After inoculation, the plants were placed in a 25°C incubator in the dark and kept moist for 24 hours to facilitate spore germination and invasion. After inoculation, the plants were removed and cultured for 14 days under the following conditions: 25°C, 50%–90% relative humidity, and 16 h light / 8 h dark.
[0029] Samples were collected at 0, 3, 6, 24, 36, 48, 72, 96, 120, 144 and 168 h after inoculation with Fusarium graminearum PH-1. Total RNA was extracted from the inoculated spikelets using the TRIzol method, and the transcription level of TaSnRK2.4-B was analyzed using real-time quantitative PCR.
[0030] Quantitative reverse transcription was performed using the FastKing one-step premixed reagent kit for first-strand genomic cDNA removal (Tiangen), and the instrument used was an Applied Biosystems 7500. Wheat elongation factor (TaEF-1α) was selected as the internal control gene. The expression level of the TaSnRK2.4-B gene at 0 h after inoculation with PH-1 wheat spikes was set as 1. All treatments were performed in triplicate biological replicates, and each quantitative PCR sample contained triplicate technical replicates, calculated according to Ct values. -ΔΔCt The relative expression level is calculated using this method.
[0031] The primers used to amplify the internal reference gene TaEF-1α are: F: TGGTGTCATCAAGCCTGGTATGGT (SEQ ID NO.4); R: ACTCATGGTGCATCTCAACGGACT (SEQ ID NO.5); The quantitative primers for the TaSnRK2.4-B gene are: F: ACCTGGCGATTGTGATGGAG (SEQ ID NO. 6); R: GCAACGACGACTTTGAATAACC (SEQ ID NO. 7).
[0032] The results are as follows Figure 1As shown, different letters indicate significant differences in TaSnRK2.4-B expression levels in wheat ears inoculated with PH-1 at each time point (p≤0.05). The results showed that after inoculation with Fusarium graminearum PH-1, the expression level of the TaSnRK2.4-B gene in wheat ears underwent significant dynamic changes, exhibiting a significant upward trend in expression levels with prolonged inoculation time, reaching its highest level at 144 h of infection, approximately 10-fold higher than at 0 h. These results indicate that the expression of the TaSnRK2.4-B gene is strongly induced by Fusarium graminearum infection, exhibiting a dynamic pattern of rapid early response and sustained high expression in the later stages. This expression characteristic suggests that TaSnRK2.4-B is likely involved in the defense response of wheat against Fusarium head blight pathogen invasion.
[0033] Example 2: Analysis of TaSnRK2.4-B gene expression after exogenous hormone treatment Salicylic acid (SA) and methyl jasmonate (MeJA) are important signaling molecules that play crucial roles in plant defense against live, semi-living, and necrotic pathogens. This study further investigates the response characteristics of the TaSnRK2.4-B gene to various exogenous hormones and signaling molecules to preliminarily elucidate the signal transduction pathways it may be involved in, particularly those related to defense responses.
[0034] Chinese spring wheat seeds were surface-sterilized and inoculated into the substrate, then cultured at 15±1℃ in the dark for 16 / 8 h. When the wheat plants reached the one-leaf-one-heart stage, plants with uniform growth were selected for hormone treatment. Exogenous hormones 1 mM salicylic acid, 0.2 mM methyl jasmonate, 5 mM hydrogen peroxide, 0.2 mM indoleacetic acid, and 0.1 mM abscisic acid were sprayed onto the seedling leaves, with sterile water as a control. Each treatment group contained at least 10 seedlings, with 3 biological replicates.
[0035] Immediately after spraying, the plants were bagged to retain moisture. Samples were collected at 0, 0.5, 2, 6, 12, and 24 h after spraying with the exogenous hormone, flash-frozen in liquid nitrogen, and total RNA was extracted. The transcriptional level of TaSnRK2.4-B was analyzed using real-time quantitative PCR, following the same experimental procedures as in Example 1. Wheat elongation factor was used as an internal reference gene, and the expression level of TaSnRK2.4-B at 0 h of exogenous hormone treatment was set as 1.
[0036] The results are as follows Figure 2As shown in the figure, different letters indicate significant differences in TaSnRK2.4-B gene expression levels after exogenous hormone treatment (p≤0.05). The results show that TaSnRK2.4-B gene expression exhibits a differentiated dynamic response pattern to different exogenous hormones and signaling molecules. Specifically, after exogenous application of SA and MeJA, the transcriptional level of the TaSnRK2.4-B gene was rapidly and strongly induced. The upregulation level of TaSnRK2.4-B reached its highest point 12 h after exogenous application of SA, approximately 8.8 times that of the initial 0 h. The highest upregulation level of TaSnRK2.4-B was observed 0.5 h after exogenous application of MeJA, approximately 6 times that of the initial 0 h. These results suggest that TaSnRK2.4-B may participate in the adaptive response of wheat to biotic stresses such as Fusarium head blight by integrating defense signaling pathways such as SA and JA, providing important signal response evidence for its function in improving Fusarium head blight resistance.
[0037] Example 3: Statistics on lesion area of TaSnRK2.4-B silent leaves This embodiment employs virus-induced gene silencing (VIGS) technology to analyze the effect of TaSnRK2.4-B gene loss on wheat's resistance to Fusarium graminearum infection by inhibiting the expression of the TaSnRK2.4-B gene. The specific experimental procedure is as follows: 1. Carrier Construction Through database comparison (http: / / plants.ensembl.org / index.html) and specificity analysis, a sequence in the coding region of the TaSnRK2.4-B gene was found to be highly specific (nucleotide sequence as shown in SEQ ID NO. 3). Therefore, a TaSnRK2.4-B gene silencing vector was constructed based on this specific gene fragment.
[0038] 2. Gene silencing based on BSMV virus The barley mosaic virus vector in vitro transcription products BSMV-α and BSMV-β were mixed in equal proportions with 3 μL each of the BSMV:γ (blank control), BSMV:γ-PDS (positive), or BSMV-:γ-TaSnRK2.4-B (experimental group) transcription products. Then, 9 μL of FES inoculation buffer (2.613 g K2HPO4, 1.877 g Glycine, 0.5 g Na4P2O7, 0.5 g diatomaceous earth, 0.5 g bentonite, adjusted to 50 mL, and autoclaved for 20 min) was added. Wheat seedlings of uniform growth (two leaves and one bud) were selected for virus inoculation. 15 μL of the above virus mixture was used to manually rub the second leaf of the wheat seedling three times. After inoculation, DEPC water was sprayed to maintain humidity, and the seedlings were wrapped in plastic wrap and placed in a 25℃, high-humidity, dark culture for 24 h, followed by a 16 h light / 8 h dark culture.
[0039] 3. Verification of Silent Efficiency The expression levels of the TaSnRK2.4-B gene were detected at 12, 24, 48, 72, and 96 h after PH-1 inoculation. The results showed that the silencing efficiency ranged from 37.50% to 69.31%. Figure 3 A).
[0040] 4. Inoculation with Fusarium graminearum and observation of lesions Prepare a conidial suspension of Fusarium graminearum PH-1 and adjust the concentration to 1.0 × 10⁻⁶. 4 Species / mL. After confirming the effectiveness of gene silencing, leaves with uniform silencing phenotypes were selected and inoculated using the needle prick method. A small wound was created on the leaf using a sterile needle, and then 2 μL of the above spore suspension was added to the wound. A wound treated with an equal volume of sterile 1 / 4 PD medium was used as a control. After inoculation, the plants were placed in high humidity (relative humidity >90%), 25℃, and dark conditions to promote disease development.
[0041] Disease incidence was observed and recorded at inoculation sites at 2.5, 3.5, and 4.5 days after pathogen inoculation. Leaf lesions were photographed under fixed conditions using a camera. The lesion area (unit: mm) at each inoculation site was manually delineated and calculated using ImageJ image analysis software. 2 Each treatment group contained at least 30 plants. Independent samples t-tests were performed using SPSS software to compare the significance level of lesion area differences between the silent group and the control group at the same time point (p≤0.05).
[0042] The results are as follows Figure 3As shown in Figures BC, after inoculation with Fusarium graminearum PH-1, water-soaked lesions gradually appeared at the inoculation sites in all treatment groups, and these lesions expanded over time. Lesion area statistics showed that at 2.5 days post-inoculation, the average lesion area in the TaSnRK2.4-B gene-silenced group was significantly larger than that in the control group (p < 0.05). At 3.5 and 4.5 days post-inoculation, the lesion area in the silenced group significantly increased, being 1.5 times and 1.1 times that of the control group, respectively, with highly significant differences (*p < 0.01). These results demonstrate that normal expression of the TaSnRK2.4-B gene is crucial for wheat resistance to Fusarium graminearum infection, and its loss of function leads to a significant reduction in wheat resistance to Fusarium head blight.
[0043] Example 4: Preparation of TaSnRK2.4-B gene overexpression transgenic wheat and phenotypic observation of its resistance to Fusarium graminearum infection. Based on the above experiments, it was found that the TaSnRK2.4-B gene is crucial for wheat resistance to Fusarium head blight. This embodiment further constructs transgenic wheat plants overexpressing the TaSnRK2.4-B gene. The effect of TaSnRK2.4-B overexpression on improving wheat resistance to Fusarium head blight was systematically evaluated, and its regulatory role in the expression of downstream genes in the disease defense signaling pathway was analyzed.
[0044] 1. Experimental Materials Recipient material: The wheat variety "Fielder" has good tissue culture regeneration ability and is widely used in genetic transformation.
[0045] Expression vector: The plant binary expression vector pBWA(V)BU-3xflag was selected. The full-length coding sequence (CDS) of the wheat TaSnRK2.4-B gene was cloned into the multiple cloning site of this vector to construct an overexpression vector pBWA(V)BU-3xflag-TaSnRK2.4-B driven by the maize ubiquitin strong promoter.
[0046] Agrobacterium strain: Agrobacterium tumefaciens strain EHA105.
[0047] Pathogen: Fusarium graminearum strain PH-1.
[0048] 2. Construction of the expression carrier The TaSnRK2.4-B fragment was ligated into the pBWA(V)BU-3xflag vector using homologous recombination and golden gate seamless cloning.
[0049] (1) Based on the nucleotide sequence of the wheat TaSnRK2.4-B gene as shown in SEQ ID NO.1, the following target gene amplification primers were designed and synthesized: OE-SnRK2.4B-F: ATAAAGATGATGATGATAAAatggagaggtacgagctgctcaag (SEQ IDNO.8); OE-SnRK2.4B-R: TGAAGACAGAGCTAGTTACActagctgatgtggaactcgccg (SEQ ID NO. 9).
[0050] The PCR amplification system consisted of 1 μL of cDNA from the wheat variety Fielder as a template, 2 μL each of 100 μM forward and reverse primers, 25 μL of Biorun Pfu PCR Mix, and ddH2O to a final volume of 50 μL. The PCR amplification program was as follows: pre-denaturation at 94℃ for 5 min; followed by denaturation at 94℃ for 30 sec, annealing at 56℃ for 30 sec, and extension at 72℃ for 30 sec, for 30 cycles; and finally, a final extension at 72℃ for 5 min, followed by storage at 16℃.
[0051] (2) The above PCR products were subjected to agarose gel electrophoresis. The target fragment OE-TaSnRK2.4-B was excised under a UV lamp and then recovered using an agarose gel DNA recovery kit (Novazan DC301).
[0052] (3) Vector digestion: The vector was digested with BsaI and Eco31I. The reaction system and reaction conditions were as follows: 1 μL each of BsaI and Eco31I, 4 μL of vector pBWA(V)BU-3xflag-ccdB, 2 μL of 10*Buffer, and then ddH2O was added to make up to 20 μL; the digestion reaction was carried out at 37℃ for 15 min.
[0053] (4) Homologous recombination: The linearized pBWA(V)BU-3xflag-ccdB(D) vector from step (3) and the OE-TaSnRK2.4-B fragment recovered from gel in step (2) were subjected to homologous recombination reaction. The reaction system was as follows: 5 μL of linearized pBWA(V)BU-3xflag-ccdB(D) vector, 2 μL of OE-TaSnRK2.4-B fragment, 10 μL of 2*EasyClone Mix, and ddH2O was added to make up to 20 μL; the reaction was carried out at 37℃ for 30 min.
[0054] (5) Transform the ligation product from step (4) into competent E. coli cells, select single clones and sequence them to obtain positive clones.
[0055] 3. Wheat genetic transformation Wheat seedlings treated with vernalization were transplanted into planting pots and placed in a plant growth chamber. 10–14 days after flowering, immature wheat grains were collected, sterilized with mercuric chloride, and the embryos were extracted using a scalpel as explants. Using Agrobacterium-mediated transformation of wheat embryos, the constructed recombinant plasmid was electroporated into Agrobacterium EHA105, spread on solid LB medium for initial activation, and cultured for 48 h. The cells were then collected and activated again on a fresh medium. After 24 h of culture, the cells were collected, vortexed, and the OD of the bacterial solution was adjusted to 0.1–0.2 using a spectrophotometer. The cells were then used to infect wheat embryo callus tissue. The expression vector pBWA(V)BU-3xflag-TaSnRK2.4-B was transformed into the wheat variety Fielder. After co-culture, selection, regeneration, and rooting, T0 generation transgenic plants were obtained.
[0056] 4. Determination of TaSnRK2.4-B gene expression in transgenic wheat Seeds from self-pollinated T0 generation plants were collected and planted to obtain the T1 generation population. Positive transgenic plants were screened, and the relative expression level of the TaSnRK2.4-B gene was detected by qRT-PCR (method as in Example 1). Normalization was performed using the internal reference gene TaEF-1α, with the expression level of wild-type Fielder (WT) as the baseline (set as 1). Figure 4 As shown in Figure A, compared with wild-type Fielder wheat, the gene expression levels of positive transgenic TaSnRK2.4-B wheat plants were significantly upregulated.
[0057] 5. Phenotypic observation of leaves infected by Fusarium graminearum Two strains, OESnRK2.4-B-2 and OESnRK2.4-B-5, with relatively high expression levels, were selected for Fusarium graminearum PH-1 infection experiments, with wild-type Fielder wheat as a negative control. Inoculation was performed at the three-leaf stage of seedlings using the leaf pricking method at a concentration of 1.0 × 10⁻⁶. 4 PH-1 spore suspension was prepared at 1 / mL. Phenotypic observation and sampling were performed at 24 and 48 h post-inoculation, with Fielder as a negative control. Quantitative detection of genes related to the ETI downstream defense pathway TaPR2 and the MeJA pathway TaPR3 was conducted. The qRT-PCR method was the same as above, with the expression level of the wild-type Fielder negative control at 0 h as 1, and the relative expression level was calculated.
[0058] The results are as follows Figure 4As shown in Figure BD, the results indicated that, compared to wild-type plants, transgenic wheat overexpressing the TaSnRK2.4-B gene showed significantly reduced leaf lesion length after Fusarium graminearum PH-1 infection. Specifically, 24 h after PH-1 inoculation, the average length of leaf lesions was approximately 0.92 cm for wild-type plants, approximately 0.63 cm for OETaSnRK-1 plants, and approximately 0.77 cm for OETaSnRK-2 plants. 48 h after PH-1 inoculation, the average length of leaf lesions was approximately 1.6 cm for wild-type plants, approximately 1.1 cm for OETaSnRK-1 plants, and approximately 1.3 cm for OETaSnRK-2 plants. Figure 4 B), and the expression levels of defense-related genes TaPR2 and TaPR3 in the transgenic lines were significantly upregulated compared to the control Fielder. Figure 4 (C, D) indicates that overexpression of TaSnRK2.4-B can synergistically activate SA and JA-mediated defense response signaling pathways.
[0059] 6. Phenotypic observation of Fusarium graminearum infection in wheat ears During the wheat flowering stage, 10 main spikelets from each of the two lines, OE-SnRK2.4-B-2 and OE-SnRK2.4-B-5 (each line derived from 10 independent positive plants), were inoculated with PH-1 spore suspension using the single floret injection method, with a wild-type line serving as a negative control. After inoculation, the wheat spikelets were sprayed with sterile water and kept moist with a moisture-retaining bag. The moisture-retaining bag was removed after 2 days, and the number of diseased spikelets on each inoculated spikelet was investigated 14 days later, calculating the diseased spikelet rate for each line.
[0060] The results of the wheat ear inoculation experiment showed that on wild-type Fielder wheat ears, infection spots spread from the inoculated spikelet to the entire ear, while on transgenic lines OE-SnRK2.4-B-2 and OE-SnRK2.4-B-5 wheat ears, infection spots only appeared on the spikelets around the infection point. Figure 5 A). Data on the incidence of diseased spikelets showed that the incidence of diseased spikelets in wild-type Fielder wheat reached 78%, while the incidence of diseased spikelets in transgenic lines OE-SnRK2.4-B-2 and OE-SnRK2.4-B-5 decreased to 43% and 40%, respectively. Figure 5 B). Compared with wild-type Fielder wheat, wheat plants transgenic with the TaSnRK2.4-B gene showed a significant reduction in the number of diseased spikelets after inoculation with PH-1, and a marked increase in wheat resistance to Fusarium head blight. These results indicate that TaSnRK2.4-B is a functional gene that positively regulates wheat resistance to Fusarium head blight, and overexpression of this gene can effectively improve the disease-resistant phenotype of wheat.
[0061] In summary, this invention, through systematic molecular biology and genetic experiments, has for the first time demonstrated that the wheat TaSnRK2.4-B gene is a key gene that positively regulates wheat resistance to Fusarium head blight, filling a gap in the study of this gene's function. Overexpression of this gene can significantly improve wheat resistance to Fusarium head blight, providing a key target gene and new germplasm resources for molecular breeding of wheat resistant to Fusarium head blight.
[0062] The above detailed embodiments describe the implementation of the present invention; however, the present invention is not limited to the specific details described in the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.
Claims
1. Application of the wheat TaSnRK2.4-B gene in any of the following A1)-A6): A1) Application in improving wheat scab resistance; A2) Application in the preparation of products that enhance resistance to wheat scab; A3) Application in the breeding of wheat varieties resistant to Fusarium head blight; A4) Application in the preparation of products for breeding wheat varieties resistant to Fusarium head blight; A5) Application in identifying or assisting in the identification of wheat varieties resistant to Fusarium head blight; A6) Application in the preparation of products for identifying or assisting in the identification of wheat varieties resistant to Fusarium head blight; The amino acid sequence encoded by the TaSnRK2.4-B gene is shown in SEQ ID NO.
2.
2. The application according to claim 1, characterized in that, The nucleotide sequence of the TaSnRK2.4-B gene is shown in SEQ ID NO.
1.
3. The application according to claim 1, characterized in that, By promoting the expression of the TaSnRK2.4-B gene or enhancing the function or activity of its protein, wheat resistance to Fusarium head blight can be improved or Fusarium head blight-resistant wheat varieties can be bred.
4. Application of overexpression vectors containing TaSnRK2.4-B in any of the following A1)-A6): A1) Application in improving wheat scab resistance; A2) Application in the preparation of products that enhance resistance to wheat scab; A3) Application in the breeding of wheat varieties resistant to Fusarium head blight; A4) Application in the preparation of products for breeding wheat varieties resistant to Fusarium head blight; A5) Application in identifying or assisting in the identification of wheat varieties resistant to Fusarium head blight; A6) Application in the preparation of products for identifying or assisting in the identification of wheat varieties resistant to Fusarium head blight; The amino acid sequence encoded by the TaSnRK2.4-B gene is shown in SEQ ID NO.
2.
5. The application according to claim 4, characterized in that, The backbone vector of the overexpression vector is the expression vector pBWA(V)BU.
6. A method for improving wheat resistance to Fusarium head blight and / or breeding wheat varieties resistant to Fusarium head blight, characterized in that, By promoting the expression of the TaSnRK2.4-B gene or enhancing the function or activity of its protein, wheat scab resistance can be improved, wherein the amino acid sequence encoded by the TaSnRK2.4-B gene is shown in SEQ ID NO.
2.
7. The method according to claim 6, characterized in that, Using the expression vector pBWA(V)BU as the backbone vector, an overexpression vector containing the TaSnRK2.4-B gene was constructed and transformed into wheat to obtain wheat lines overexpressing the TaSnRK2.4-B gene, thereby improving wheat resistance to Fusarium head blight and / or breeding wheat lines resistant to Fusarium head blight.
8. The method according to claim 7, characterized in that, The overexpression vector containing the TaSnRK2.4-B gene was transformed into wheat using Agrobacterium-mediated transformation. After screening and culture, transgenic plants were obtained, resulting in TaSnRK2.4-B gene overexpression plant lines.