Application of Rosa hybrida RhBEE3 gene in regulating lateral bud development of plant
By regulating the expression of the rose RhBEE3 gene and using RNAi technology to regulate lateral bud germination, the problem of uncontrollable lateral branch growth in rose plants has been solved, achieving efficient management in cut flower and potted flower production.
Patent Information
- Application Number
- CN202610539335.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-22
- Publication Date
- 2026-05-29
AI Technical Summary
In existing technologies, the growth and development of lateral branches of rose plants are difficult to control effectively, resulting in the need for a large amount of manual removal of lateral branches in cut flower production, and the need to manually add lateral branches in potted flower production, which is labor-intensive and inefficient.
By studying the expression regulation of the rose RhBEE3 gene, RNAi technology was used to silence or enhance the expression of the RhBEE3 gene, thereby regulating the germination of lateral buds and controlling lateral branches.
It effectively regulates the development of rose lateral buds, reduces the workload of removing lateral branches in cut flower production, increases the number of lateral branches in potted flower production, and improves production efficiency and quality.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant genetic engineering technology, specifically to the application of the rose RhBEE3 gene in regulating the development of lateral buds in plants. Background Technology
[0002] The rose (Rosa hybrida) is a perennial woody plant belonging to the genus Rosa in the family Rosaceae. Its flowers are diverse in shape and vibrant in color, making it of significant ornamental and economic value worldwide. Plant shape is a crucial trait of the rose, primarily determined by the growth and development of its lateral branches. In cut flower production, to improve the yield and quality of rose blossoms and ensure upright stem growth and a compact plant shape, a significant amount of manpower and resources are required to remove lateral branches, accounting for one-third of the total production workload. Similarly, in the production of potted and climbing roses, to meet landscaping needs and increase the number of flowers, more branching and a fuller plant shape are desired, making the manual removal of terminal buds to encourage lateral branching an essential step. Therefore, studying the growth and development of rose lateral branches is of great significance for rose production and breeding.
[0003] Lateral branches develop from the elongation of axillary buds, which originate from the axillary meristem in the leaf axils of plants. Current research indicates that the initiation of axillary meristem in plants occurs through two different pathways: one pathway suggests that it is directly derived from the apical meristem, whose cells retain their meristematic characteristics (Kundu and Rao, 1952); the other pathway involves the dedifferentiation of cells in the leaf axils after the plant enters the reproductive growth stage, leading to the formation of axillary buds (Snow and Snow, 1942). After axillary bud formation, some continue to grow and develop into lateral branches, while others enter dormancy, only continuing to develop into lateral branches under suitable internal and environmental conditions (Greb et al., 2003). Therefore, the developmental pattern of lateral branches is a key factor influencing the plant shape of roses.
[0004] In their previous work, the applicant screened genes related to rose lateral bud development and discovered that a bHLH transcription factor, RhBEE3 (BR Enhanced Expression 3), was highly expressed during lateral bud outgrowth. qRT-PCR and in situ hybridization results showed that RhBEE3 was specifically expressed in the cambium of rose plants and accumulated significantly in the vascular tissue of lateral bud primordia. Subsequently, using the rose 'Samantha' as experimental material, stable RhBEE3-RNAi transgenic rose plants were created using Agrobacterium-mediated somatic embryo transformation. The RhBEE3-RNAi plants exhibited various growth defects, including the inability of lateral buds to germinate and grow, and the transformation of compound leaves into simple leaves.
[0005] In Arabidopsis, AtBEE3 is a transcriptional activator in the BR signaling pathway and has functional redundancy with AtBEE1 and AtBEE2. Knockout of AtBEE1 / 2 / 3, compared to wild-type, results in shorter hypocotyls, smaller flowers, and shorter pistils in mutant Arabidopsis; while overexpression of AtBEE1 increases flower size and pistil length (Friedrichsen et al., 2002). In Arabidopsis, two B-box transcription factors, AtBBX28 and AtBBX29, interact with AtBEEs, enhancing their ability to bind to downstream gene promoters and increasing their transcriptional activity, thereby participating in the regulation of light and BR signaling pathways during Arabidopsis seedling growth (Cao et al., 2022). During the dark morphogenesis of Arabidopsis seedlings, AtBEE3 is also regulated by AtARF6 in the IAA pathway, while the ethylene response factor ETHYLENE RESPONSE FACTOR1 (AtERF72) in the ethylene regulatory pathway regulates AtBEE3 expression by binding to the promoter region of AtARF6 (Liu et al., 2018). In poplar, studies have shown that overexpression of the PagBEE3 gene can promote the proliferation of poplar xylem cells, thereby thickening the stem and increasing the biomass yield of poplar (Seol et al., 2015).
[0006] Based on the above findings, and in response to the industry demand for rose cut flowers with lateral branches removed and potted roses with more lateral branches, this invention aims to explore the role of the RhBEE3 gene in regulating the development of rose lateral buds to control the germination of rose lateral branches, thereby cultivating rose varieties suitable for cut flowers and potted flowers respectively. Summary of the Invention
[0007] The purpose of this invention is to propose the application of the flower RhBEE3 gene in regulating lateral bud development. Through research, a new role and mechanism of RhBEE3 has been discovered, thus providing a method to regulate lateral bud germination by changing the expression of RhBEE3 in plants.
[0008] The technical solution of this invention is implemented as follows: On the one hand, the present invention provides the open reading frame nucleotide sequence of the rose bHLH family transcription factor RhBEE3, i.e., the gene.
[0009] On the other hand, the analysis of the protein structure and expression pattern corresponding to the gene described in the first aspect of the present invention is provided.
[0010] Thirdly, the invention provides the application of the protein described in the first aspect in regulating the development of rose lateral buds.
[0011] In this invention, the gene or protein plays a role in regulating the development of lateral buds in roses. More preferably, the Rosaceae plant is a rose.
[0012] In some embodiments, the application is achieved by altering the expression of the gene or protein in the plant, thereby changing the developmental state of the rose lateral buds, thus achieving the regulation.
[0013] Methods or techniques for altering gene expression in plants are known. Those skilled in the art, based on the disclosure of this application, can select methods capable of altering the expression of known genes in plants as needed. For example, RNA interference gene silencing technology can be used to enhance gene expression in plants. Therefore, in some embodiments, reducing the expression of the gene or protein in plants is achieved through gene silencing technology.
[0014] According to the inventors' findings, silencing the expression of the RhBEE3 gene or the protein can reduce rose lateral buds. Therefore, in some embodiments, the lateral bud germination rate of roses can be reduced by increasing the expression of the gene or the protein in the plant.
[0015] Roses are an important ornamental crop worldwide. Plant shape is a crucial trait of roses, possessing significant economic and horticultural value, and the development of lateral branches is a key factor influencing rose plant shape. The inventors discovered that the bHLH family transcription factor RhBEE3 may be involved in the regulation of lateral bud development. Using this as a starting point, qRT-PCR and in situ hybridization results showed that RhBEE3 is specifically expressed in the cambium of rose plants and accumulates significantly in the vascular tissue of lateral bud primordia. Subsequently, using the rose 'Samantha' as experimental material, stable RhBEE3-RNAi transgenic rose plants were created using Agrobacterium-mediated somatic embryo transformation. RhBEE3-RNAi plants exhibited various growth defects, including the inability of lateral buds to germinate and grow, and the transformation of compound leaves into simple leaves. These conclusions demonstrate that the expression of the RhBEE3 gene can regulate the development of rose lateral buds.
[0016] The present invention has the following beneficial effects: The present invention has discovered a new role and mechanism of RhBEE3 through research, thereby providing a method to regulate lateral bud germination by changing the expression of RhBEE3 in plants. Attached Figure Description
[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0018] Figure 1 RhBEE3 protein characterization. A. Phylogenetic tree construction of rose RhBEE3 protein and Arabidopsis thaliana; B. Alignment of rose RhBEE3 protein sequence with RhBEE3 protein sequences in Arabidopsis thaliana, apple, strawberry and apricot; C. Subcellular localization of RhBEE3.
[0019] Figure 2 Expression patterns of the RhBEE3 gene in roses. qRT-PCR analysis was used to determine the differential expression of RhBEE3 in different tissues of roses. Results were generated from three biological replicates.
[0020] Figure 3 Expression location of the RhBEE3 gene in rose lateral bud primordia. A. Longitudinal section of RhBEE3 mRNA in situ hybridization during rose lateral bud germination. B. Cross section of RhBEE3 mRNA in situ hybridization during rose lateral bud germination. Scale bar 100 μm. Red arrows indicate RhBEE3 expression locations.
[0021] Figure 4 RhBEE3-RNAi plant detection and phenotypic observation. A. Whole plant phenotype of RhBEE3 silent plants and control plants. Scale bar, 1cm. B. Leaf phenotype of RhBEE3 silent plants and control plants. Scale bar, 1cm. C. Phenotype of lateral bud development at 0 and 15 days after stem cutting in RhBEE3 silent plants and control plants. Scale bar, 1cm. D. PCR detection of vector fragment insertion in RhBEE3 silent plants and controls. E. qRT-PCR analysis of RhBEE3 gene expression in silent plants and control plants. Values represent mean ± SD. Results were generated from 3 biological replicates; **** indicates p-value less than 0.001. Detailed Implementation
[0022] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Example 1
[0023] 1. Materials and Methods Plant materials and treatment Rose tissue culture seedlings: Rose stem segments with one bud were vertically inserted into the propagation medium. The medium formula was 4.74 g / L MS + 1 mg / L 6-BA + 1 mg / L GA + 0.05 mg / L NAA + 30 g / L sucrose + 6.8 g / L Agar, pH=5.85-5.95, the photoperiod of the plants was 16 h / 8 h (light / dark), and the temperature was 22±2 ℃.
[0024] Tobacco Cultivation: Evenly sow the tobacco seeds of this formula on the surface of moist soil containing nutrient soil and vermiculite in a 1:1 ratio. Transplant the seedlings one week later. The tobacco can be injected when it has grown 4 true leaves. The cultivation temperature for tobacco is the same as that for rose cultivation.
[0025] Gene cloning According to the Arabidopsis website (https: / / www.arabidopsis.org / ) and the monthly pollen database ( https: / / lipm-browsers.toulouse.inra.fr / pub / RchiOBHm-V2 / The full-length coding sequence of the RhBEE3 gene was obtained through homologous cloning. Phylogenetic tree construction of RhBEE3 and BEE3 of other species and protein sequence alignment were performed using MEGA7 and Bio-edit, respectively.
[0026] Real-time quantitative PCR Total RNA was extracted from roses using the Novizon Polysaccharide-Polyphenol Plant RNA Rapid Extraction Kit. Reverse transcription was performed using the Novizon HiScript® II Q RT SuperMix for qPCR (+gDNA wiper) Reverse Transcription Kit, catalog number R223-01. Quantification was performed using Novizon ChamQ SYBR qPCR Master Mix (High ROX Premixed). The rose RhUBI gene (GenBank accession number JK622648) was used as an internal control gene.
[0027] Carrier construction Construction of the RhBEE3-RNAi vector: A 400bp fragment was amplified using two sets of primers with different restriction endonuclease sites. One set contained Asc and swa I sites, which were inserted into the pFGC1008 vector in the sense direction after restriction enzyme digestion; the other set contained Pac and bam HI sites, which were inserted into the pFGC1008 vector in the antisense direction after restriction enzyme digestion.
[0028] Subcellular localization vector construction: The CDS of RhBEE3 without the stop codon was constructed between the XbaI and KpnI restriction sites of the Super1300-GFP vector to obtain Super:RhBEE3-GFP.
[0029] Agrobacterium-mediated somatic embryo transformation of rose After undergoing processes such as somatic embryo induction, Agrobacterium infection, selective proliferation, selective germination, and selective seedling formation, stable silent plants were finally obtained.
[0030] Somatic embryo induction: Select tender leaves from the tips of tissue culture seedlings of the rose 'Samantha' as induction material and quickly place them on rose somatic embryo induction medium to prevent wilting due to water loss. Induce in the dark for about one month, during which time observe irregularly, remove browned callus tissue, and change the medium.
[0031] Agrobacterium infection: The constructed RhBEE3-RNAi vector was transformed into Agrobacterium, and the somatic embryos were infected with Agrobacterium. The somatic embryos were then cultured in the dark for 3 days on a co-culture medium. Subsequently, the somatic embryos were transferred to a selective proliferation medium and cultured under light for 2 months, with the medium being changed every 15 days. After selective proliferation, the embryos were transferred to a selective germination medium, with the medium being changed once a month, until resistant buds appeared. Then, they were transferred to a selective seedling medium. Finally, the resistant seedlings were identified, and the axillary bud development phenotype was observed.
[0032] In situ hybridization Specific regions of the RhBEE3 gene were selected, and sense and antisense probes of approximately 300–500 bp in length were prepared and labeled using a DIG-RNA labeling kit. Axillary buds at different developmental stages were collected, fixed in 4% (w / v) paraformaldehyde, and incubated overnight at 4°C. Samples were dehydrated using a gradient of ethanol (30%–100%), destained with xylene, and then embedded in paraffin. After sectioning the embedded samples, hybridization with the prepared specific RNA probes was performed overnight at 50°C. After antibody incubation, staining was performed using NBT / BCIP substrate solution, and microscopic observation was conducted three days later.
[0033] The open reading frame of the RhBEE3 gene used in the above process is shown in SEQ ID NO.1, as follows: ATGGCTCAGTTCACAGAAGATTTGAAGCCTTCGTTTCCTTTCTTAGACATTGAGCCAAGCAGTATACTTATAAACCAGTATGCAGACCAATTCAATCATCTTGGTGTTTTGGACTACTCAAGCTTGAATCACTTCCAAGGCTACATGCCTTTTTCAAGTGACAATTTCTTTGGCAACAGCCAAGGACCTGAATTCCCAGGAACCTTGGTCGAA AACTTTCCGGCTGGTTTTGTTCAACAGAACAGTAGCAGCGACAACAACTTGCAGAATGATGAGGCCTCAGCTGCTCAGTGCCTTGTCGCAGCTGGAAACCCTGAATTCCAAGAAAGCAAGAAGAGAATAGCAATGGAGATGTCAGAGAGCAGTTCTGGAGTCTCCAATCCCTCAGTTTCGAAAACTGGGATCAAGAGAAAAAATAGCTTGGGAA GAGGAAAGAGGGTGAAAATCAGTAATGAGGAGGAAGACGAGAAACCAAAGGAAGTGGTTCATGTTAGAGCCAGGAGAGGCCAAGCCACTGATAGTCACAGTTTAGCAGAAAGGGTTAGAAGAGGAAAAATCAATGAGAGACTGAGATGCTTGCAAGATATTGTCCCAGGTTGCTCTAAGACTATGGGAATGGCGGTAATGCTAGACGAGATAAT TAACTATGTGCAGTCCTTGCAGAACCAGGTTGAGTTCCTGTCTATGAAGTTAACTGCAGCAAGCTCTTTCCATGACTTCAACACAGAGACAGAAGATGCTATGGAAACAATGCAGAGGGCAAAAGAGTTGGAGAGTGAAGATAGAAGCAGGATATGGAGGAGTAGTTGACAGTAGCTTCCAGTATTCCTCAACTAATTATTGGTCTCTCTGA The primers used in the above process are shown in Table 1.
[0034] Table 1
[0035] 2. Results and Analysis RhBEE3 sequence analysis and phylogenetic tree construction The amino acid sequence of RhBEE3 was analyzed and a phylogenetic tree was constructed. Using MEGA software, a phylogenetic tree was constructed between rose and Arabidopsis thaliana based on the RhBEE3 protein. The results showed that the RhBEE3 protein in rose is most closely related to the AtBEE3 protein in Arabidopsis thaliana. Figure 1 A). Protein sequence alignment revealed that the rose RhBEE3 protein shares certain homology with Arabidopsis thaliana, apple (Malus domestica), strawberry (Fragaria vesca), and apricot (Prunus dulcis), and contains typical bHLH protein domains. Therefore, the RhBEE3 protein belongs to the bHLH transcription factor family. Figure 1 B). Subcellular localization results showed that the RhBEE3 protein was located in the cell nucleus ( Figure 1 C).
[0036] Expression pattern of RhBEE3 gene in rose The expression levels of the RhBEE3 gene in different tissues of rose were detected by qRT-PCR. The results showed that the expression level of the RhBEE3 gene was highest in the lateral buds of rose, followed by the stems and petals. Figure 2 In situ hybridization results further showed that RhBEE3 transcription accumulated in the vascular tissue of lateral bud primordia. Figure 3 ).
[0037] Plants with silenced RhBEE3 genes cannot develop lateral buds. Stable transgenic seedlings with resistance to Agrobacterium tumefaciens were obtained by infecting rose embryos. Figure 4 A). DNA was extracted from the leaves of the obtained RhBEE3-RNAi plants. Using vector-specific primers, insertion of the RNAi vector fragment was detected in all five RhBEE3-RNAi transgenic lines, while no insertion was detected in the wild-type plants. Figure 4 (D) indicates that it has been successfully integrated into the plant genome. The expression level of the RhBEE3 gene was detected by qRT-PCR in the obtained positive plants. Compared with the wild type, the expression level of the RhBEE3 gene in the RhBEE3-RNAi transgenic plants was significantly lower than that in the wild type. Observation of RhBEE3-RNAi and WT plants revealed that after silencing RhBEE3, the compound leaves of the rose tissue culture seedlings all became simple leaves (D). Figure 4 B); After cutting RhBEE3-RNAi and WT tissue culture seedlings into stem segments and growing them on rose propagation medium for 15 days, it was observed that the lateral buds of the RhBEE3-silenced plants did not sprout. Figure 4 C).
[0038] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. Rose RhBEE3 Application of genes in regulating the development of lateral buds in plants.
2. The application according to claim 1, characterized in that, The plant in question is a member of the Rosaceae family.
3. The application according to claim 2, characterized in that, The plant in question is a rose (Rosa chinensis).
4. The application according to claim 1, characterized in that, The regulation of lateral bud development includes preventing lateral buds from sprouting and growing and / or transforming existing compound leaves into single leaves.
5. Rose RhBEE3 Application of gene-encoded proteins in regulating the development of lateral buds in plants.
6. The application according to claim 5, characterized in that, The plant in question is a member of the Rosaceae family.
7. The application according to claim 6, characterized in that, The plant in question is a rose (Rosa chinensis).
8. The application according to claim 5, characterized in that, The regulation of lateral bud development includes preventing lateral buds from sprouting and growing and / or transforming existing compound leaves into single leaves.