Enzymatic modification of polysaccharides in old eagle tea and preparation method and application thereof
By enzymatically modifying eagle tea polysaccharides using papain, mesophilic α-amylase, or cellulase, the technical challenge of enhancing the bioactivity of eagle tea polysaccharides was solved, resulting in the preparation of drugs and foods with anti-cancer, anti-inflammatory, and hypoglycemic functions.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- ZUNYI MEDICAL UNIVERSITY
- Filing Date
- 2026-02-11
- Publication Date
- 2026-05-29
AI Technical Summary
In the existing technology, it is not clear which enzyme can most effectively enhance the specific biological activity of eagle tea polysaccharides, which limits their high-value utilization.
Enzymatic hydrolysis of *Eagle Tea* polysaccharide was performed using papain, medium-temperature α-amylase, or cellulase, followed by deproteinization using the Sevag method and lyophilization via dialysis to prepare enzymatically modified *Eagle Tea* polysaccharide.
The enzymatically modified eagle tea polysaccharide enhances the anti-colon cancer cell proliferation, α-glucosidase inhibition, and anti-inflammatory factor release inhibition effects, making it suitable for the preparation of anti-colon cancer drugs, α-glucosidase inhibitors, and hypoglycemic drugs.
Smart Images

Figure CN122104828A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of enzymatic hydrolysis technology, specifically to an enzymatically modified eagle tea polysaccharide, its preparation method, and its application. Background Technology
[0002] Eagle tea is a beverage made from the dried leaves of *Litsea cubeba*, a plant resource unique to southwestern China. It is not only a traditional folk drink but also possesses medicinal properties such as clearing heat and quenching thirst, reducing swelling and detoxifying, and strengthening the spleen and stomach. Furthermore, it has a good safety profile with no significant toxic side effects. Modern pharmacological research shows that eagle tea is rich in polysaccharides, flavonoids, polyphenols, and other bioactive substances, exhibiting various biological activities including antioxidant, antibacterial, blood sugar regulation, improvement of insulin sensitivity, and enhancement of immunity.
[0003] The bioactivity of polysaccharides is closely related to their structural characteristics, such as monosaccharide composition, molecular weight, and spatial configuration. Enzymatic modification is a mild and efficient polysaccharide modification technique that can alter the structure of polysaccharides through specific enzymatic hydrolysis, thereby affecting their bioactivity. Currently, studies have utilized different enzymes to treat polysaccharides, but it remains unclear which enzyme can most effectively enhance the specific bioactivity of *Euphorbia tirucalli* polysaccharides. Therefore, developing an enzymatic hydrolysis method that can directionally enhance the specific efficacy of *Euphorbia tirucalli* polysaccharides is of great significance for promoting their high-value utilization. Summary of the Invention
[0004] The present invention aims to provide a method for preparing enzymatically modified eagle tea polysaccharide, so as to improve one or more specific effects of eagle tea polysaccharide.
[0005] To achieve the above objectives, the present invention adopts the following technical solution: a method for preparing enzymatically modified eagle tea polysaccharides, comprising the following steps: Step 1: Prepare a solution of eagle tea polysaccharide with a concentration of 10-30 mg / mL; Step 2: Add a biological enzyme to the solution to carry out an enzymatic hydrolysis reaction. The biological enzyme is papain, mesophilic α-amylase, or cellulase. Step 3: After enzymatic hydrolysis, the enzyme is inactivated, the supernatant is collected by centrifugation, the protein is removed by Sevag method, and after dialysis, it is freeze-dried to obtain enzymatically modified eagle tea polysaccharide.
[0006] Preferably, as an improvement, the enzyme-substrate ratio is 1.5% to 2.5%.
[0007] Preferably, as an improvement, when the bioenzyme is cellulase, the enzymatic hydrolysis reaction is carried out under conditions of pH 4-6 and temperature 45-55°C.
[0008] Preferably, as an improvement, when the biological enzyme is papain, the enzymatic hydrolysis reaction is carried out under conditions of pH 5-7 and temperature 55-65°C.
[0009] Preferably, as an improvement, when the biological enzyme is a mesophilic α-amylase, the enzymatic hydrolysis reaction is carried out under conditions of pH 5.5–6.5 and temperature 40–70°C.
[0010] The inventors have discovered that the enzymatically modified eagle tea polysaccharide prepared by the above method has one or more specific effects (such as anti-colon cancer cell proliferation, α-glucosidase inhibition, etc.) enhanced compared with the unmodified eagle tea polysaccharide. Therefore, the present invention also seeks protection for the enzymatically modified eagle tea polysaccharide prepared by the above method.
[0011] Further research by the inventors revealed that the enzymatically modified eagle tea polysaccharide obtained after hydrolysis with papain and mesophilic α-amylase exhibits stronger inhibitory activity against colon cancer cells (HCT-116 cells) and α-glucosidase at high concentrations. The enzymatically modified eagle tea polysaccharide obtained after hydrolysis with papain and cellulase can inhibit the release of inflammatory factors TNF-α, IL-4, and IL-1β.
[0012] Therefore, this invention seeks protection for the use of enzymatically modified eagle tea polysaccharide in the preparation of anti-colon cancer drugs, α-glucosidase inhibitors, hypoglycemic drugs, or functional foods; wherein the enzyme used in the enzymatic modification is papain or mesophilic α-amylase.
[0013] This invention also seeks protection for the use of enzymatically modified eagle tea polysaccharide in the preparation of anti-inflammatory drugs related to TNF-α, IL-1β and / or IL-4; wherein the enzyme used in the enzymatic modification is papain or cellulase. Attached Figure Description
[0014] Figure 1 The experimental process flow diagram for enzymatic hydrolysis of eagle tea polysaccharides.
[0015] Figure 2 The HPLC chromatogram of eagle tea polysaccharides is shown.
[0016] Figure 3 Molecular weight profile of eagle tea polysaccharides.
[0017] Figure 4 Infrared spectrum of the HTP group of tea polysaccharides from Eagle Tea.
[0018] Figure 5 Infrared spectrum of the HTP-S group of tea polysaccharides from Eagle Tea.
[0019] Figure 6 Infrared spectrum of the HTP-C group of tea polysaccharides from Eagle Tea.
[0020] Figure 7 Infrared spectrum of the HTP-Pa group of tea polysaccharides from Eagle Tea.
[0021] Figure 8 Infrared spectrum of the HTP-T group of tea polysaccharides from Eagle Tea.
[0022] Figure 9 Infrared spectrum of the HTP-Pe group of tea polysaccharides from Eagle Tea.
[0023] Figure 10 Infrared spectrum of the HTP-H group of tea polysaccharides from Eagle Tea.
[0024] Figure 11 A comparison of the antioxidant activity of eagle tea polysaccharides.
[0025] Figure 12 The study investigated the effect of enzyme-hydrolyzed eagle tea polysaccharide on the activity of HCT-116 cells; where A was the HTP group, B was the HTP-S group, C was the HTP-C group, D was the HTP-Pa group, E was the HTP-T group, F was the HTP-Pe group, and G was the HTP-H group.
[0026] Figure 13 The image shows a comparison of the effects of eagle tea polysaccharides on the expression of inflammatory genes induced by LPS in RAW264.7 cells. Among them, A is a comparison of the effects of eagle tea polysaccharides on TNF-α in each group, B is a comparison of the effects of eagle tea polysaccharides on IL-1β in each group, and C is a comparison of the effects of eagle tea polysaccharides on IL-4 in each group.
[0027] Figure 14 A comparative diagram showing the effects of eagle tea polysaccharides on α-glucosidase activity. Detailed Implementation
[0028] The following detailed description illustrates the specific implementation method: 1. Materials and Methods 1.1 Materials 1.1.1 Experimental Materials The raw material used in this experiment was the total polysaccharide obtained from the dried leaves of *Litsea cubeba* (Lauraceae family) after water extraction and alcohol precipitation. Its common name is "Eagle Tea," abbreviated as HTP. The HTP treated with the Sevag method without enzyme addition was named HTP-S; the HTP treated with cellulase and then with the Sevag method was named HTP-C; the HTP treated with papain and then with the Sevag method was named HTP-Pa; the HTP treated with mesophilic α-amylase and then with the Sevag method was named HTP-T; the HTP treated with pectinase and then with the Sevag method was named HTP-Pe; and the HTP treated with hemicellulase and then with the Sevag method was named HTP-H.
[0029] In this application, the Sevag method is performed as follows: Sevag reagent and sample solution are mixed in a ratio of 1:4; after shaking thoroughly for 15 minutes, the mixture is centrifuged at 10,000 rpm for 15 minutes, and the supernatant is carefully aspirated into a new tube, while the lower organic reagent and precipitate are discarded; wherein, the Sevag reagent is composed of n-butanol and chloroform in a ratio of 1:4.
[0030] 1.1.2 Experimental Reagents All reagents used in this experiment were of analytical grade, and all reagents used in the high-performance liquid chromatography (HPLC) were of chromatographic grade. Cellulase, papain, mesophilic α-amylase, pectinase, and hemicellulase (Shanghai Maclean Biotechnology Co., Ltd.), DMEM high-glucose medium (Beijing Solarbio Science & Technology Co., Ltd.), acetonitrile, trifluoroacetic acid, PMP (1-phenyl-3-methyl-5-pyrazolone), dimethyl sulfoxide (DMSO) (Shanghai Aladdin Biotechnology Co., Ltd.), fetal bovine serum, and MTT (thiazolyl blue) (Beyotime Biotechnology Co., Ltd.).
[0031] 1.1.3 Experimental Apparatus High performance liquid chromatograph (Dalian Elite Analytical Instrument Co., Ltd.), rotary evaporator (Shanghai Yarong Biochemical Instrument Factory), enzyme-linked immunosorbent assay (ELISA) reader (Bio Tek Corporation), Nicolet is20 Fourier transform infrared spectrometer (Thermo Fisher Scientific).
[0032] 1.2 Methods and Procedures 1.2.1 Enzymatic hydrolysis of eagle tea polysaccharides In this study, a polysaccharide solution (20 mg / mL) from *Eagle Tea* was enzymatically hydrolyzed using five enzymes (enzyme-substrate ratio 2%), including cellulase, under optimal conditions. After inactivation, the supernatant was collected by centrifugation. Proteins were removed five times using the Sevag method, and the polysaccharides were obtained by lyophilization after 48 h of dialyzing. A blank control without enzymes was established for simultaneous treatment. The experiment showed that different enzymatic hydrolysis treatments could effectively obtain polysaccharide components with different characteristics. The systematic sample preparation process lays the foundation for subsequent polysaccharide structure analysis and activity studies. The complete experimental steps are detailed below. Figure 1 Table 1 shows the enzymatic hydrolysis conditions used in the experiment.
[0033] Table 1. Conditions for enzymatic hydrolysis Optimal temperature Optimal pH Selected temperature Select pH HTP-C 45-55℃ 4.5-6.0 50℃ 5.06 HTP-Pa 55-65℃ 5.0-7.0 60℃ 6.10 HTP-T 40-70℃ 5.5-6.5 55℃ 6.02 HTP-Pe 50℃ 3.0-3.5 50℃ 3.37 HTP-H 50-60℃ 3.0-5.0 55℃ 4.29 The resulting polysaccharides were named HTP-S (Sevag method treatment group), HTP-C (cellulase hydrolysis group), HTP-Pa (papain hydrolysis group), HTP-T (medium-temperature α-amylase hydrolysis group), HTP-Pe (pectinase hydrolysis group), and HTP-H (hemicellulase hydrolysis group), and the recovery rate was calculated.
[0034] Recovery rate (%, w / w) = (w1 / w) × 100 Where w1 is the dry weight of HTP-S, HTP-C, HTP-Pa, HTP-T, HTP-Pe and HTP-H, and w is the dry weight of HTP (total polysaccharides of Eagle Tea).
[0035] 1.2.2 Monosaccharide Composition Analysis The monosaccharide composition of each group of *Eagle Tea* polysaccharides was determined by high-performance liquid chromatography (HPLC). D-Man (mannose), L-Ara (arabinose), L-Rha (rhamnose), D-GlcA (glucuronic acid), L-Xyl (xylose), D-GalA (galacturonic acid), D-Glc (glucose), D-Gal (galactose), and L-Fuc (fucose) standards were accurately weighed to prepare a 1 mg / mL mixed standard solution. 2 M trifluoroacetic acid (TFA, sample:TFA = 1:2, v / v) was added to the polysaccharide samples, and hydrolysis was performed at 110 °C for 3 h. After cooling, the solution was neutralized with NaOH, the solvent was removed by rotary evaporation, and the residue was reconstituted with pure water. The hydrolysis products and standards were taken, and 0.6 M NaOH and 0.5 MPa MP-methanol solution were added. The solution was derivatized at 70 °C for 100 min, neutralized with 0.3 M HCl, and extracted four times with chloroform. The aqueous phase was filtered through a 0.22 μm filter membrane before injection and analysis. The chromatographic conditions were as follows: column: C10 ... 18 A reversed-phase column (250 mm × 4.6 mm, packing particle size 5 μm) was used. The mobile phase consisted of phosphate buffer and acetonitrile at a volume ratio of 81.6:18.4. The column temperature was maintained at 35 ℃, the flow rate was set to 1 mL / min, the injection volume was 20 μL, and the detection wavelength was 254 nm. Finally, the results were discussed.
[0036] 1.2.3 Molecular weight analysis The molecular weight of polysaccharides was determined by high-performance gel permeation chromatography (HPGPC). A standard curve was established using a series of dextran standards, and linear regression was performed on the logarithm of molecular weight using retention time. Samples and standards were prepared into 10 mg / mL solutions using 0.2 mol / L NaCl solution, filtered through a 0.22 μm microporous membrane, and then injected by HPLC. Molecular weight was calculated from the standard curve. An AdvanceBio SEC 300 A column (4.6 mm × 150 mm, 2.7 μm particle size) was used. 0.2 M NaCl solution was used as the mobile phase, the flow rate was controlled at 0.5 mL / min, the injection volume was 30 μL, the column temperature was maintained at 35 ℃, and a RID-101 differential detector was used for detection.
[0037] 1.2.4 Infrared Spectroscopy Analysis To analyze the structural characteristics of the polysaccharides from *Eagle Tea* after enzymatic hydrolysis, Fourier transform infrared spectroscopy (FTIR) was used to identify its functional groups. A suitable amount of freeze-dried polysaccharide sample was mixed with dry potassium bromide powder, ground evenly, and pressed into transparent sheets approximately 1.0 mm thick. These sheets were then scanned using an infrared spectrometer with a scanning area of 4000 cm⁻¹. -1 -500 cm -1 .
[0038] 1.2.5 Antioxidant Activity Assay (1) Determination of the ability of enzymatically hydrolyzed eagle tea polysaccharide to scavenge DPPH free radicals Prepare a 0.2 mmol / L 1,1-diphenyl-2-trinitrophenylhydrazine (DPPH) radical solution, dissolve the sample overnight, and centrifuge the next day to collect the supernatant. Set up 5 concentration gradients and 3 replicates for each group. Experimental group (A) X ): 100 μL of sample and 100 μL of LDPPH solution were mixed, reacted in the dark for 30 min, and then the absorbance at 517 nm was measured (A). X1 Another 100 μL of sample was mixed with 100 μL of 70% methanol as the sample background and reacted in the dark for 30 min. The absorbance at 517 nm was then measured (A). X2 To eliminate the influence of the polysaccharide's own color on the experiment. Blank control group (A0): 100 μL of 70% methanol and 100 μL of DPPH solution were mixed and reacted in a dark room for 30 min. The absorbance at 517 nm was measured (A0) to serve as a blank control.
[0039] DPPH clearance rate (100%) = (1 - A) X A0) 100% A X =A X1 -A X2 In the formula A X A1 represents the absorbance of the sample after reacting with DPPH solution, and A0 represents the absorbance of 70% methanol after reacting with DPPH solution.
[0040] (2) Determination of the ability of enzymatically hydrolyzed eagle tea polysaccharide to scavenge ASTS free radicals Accurately prepare a 2.45 mmol / L potassium persulfate solution and a 7 mmol / L ABTS (2,2-azino-bis(3-ethyl-benzothiazole-6-sulfonic acid) diammonium salt) solution, mix equal volumes of both, and react in the dark for 16 h to obtain an ABTS free radical stock solution. Adjust the absorbance of the stock solution (734 nm) to 0.7 ± 0.02 with PBS. Set up 5 concentration gradients, with 3 replicates per group. Experimental group (A) X): Take 100 μL of sample and 100 μL of mother liquor, mix well, react in the dark for 6 min, and measure the absorbance at 734 nm (A). X1 Mix 100 μL of the sample with 100 μL of distilled water, react in the dark for 6 min, and measure the absorbance at 734 mm (A). X2 To eliminate the influence of the polysaccharide's own color on the experiment, the blank control group (A0) was prepared by adding 100 μL of distilled water to 100 μL of the mother liquor, mixing well, reacting in the dark for 6 min, and measuring the absorbance at 734 mm.
[0041] ABTS clearance rate (100%) = (1 - A x / A0) 100% A X =A X1 -A X2 In the formula A X A1 represents the absorbance of the sample after reacting with ABTS solution, and A2 represents the absorbance of distilled water after reacting with ABTS solution.
[0042] 1.2.6 Antitumor activity assay To evaluate the effect of enzymatic hydrolysis of *Eagle Tea* polysaccharide on the proliferation of colon cancer cells, the MTT assay was used to detect the viability of HCT-116 cells. Logarithmically growing cells were digested with 0.25% trypsin and then seeded at a density of 3-5 × 10³ cells per well in 96-well plates. After cell attachment, the experimental groups were replaced with culture media containing different concentrations of polysaccharide, while the control group used DMEM high-glucose medium. Each group had three replicates, and incubation continued for 48 h. 20 μL of 5 g / L MTT solution was added to each well, and after 4 hours of incubation, the supernatant was discarded. 150 μL of DMSO was added to each well to dissolve the generated formazan crystals, and the mixture was shaken for 20 minutes. The absorbance of each well was then measured at 490 nm using a microplate reader, and cell viability was calculated using the corresponding formula.
[0043] Survival rate (%) = (Experimental group absorbance value / average absorbance value of control group) × 100%.
[0044] All experiments were performed in triplicate for statistical results.
[0045] 1.2.7 In vitro anti-inflammatory activity study Lipopolysaccharide (LPS), a typical inflammatory stimulant, can effectively activate macrophages and induce the release of various inflammatory mediators. Studies have shown that LPS stimulation leads to the production of large amounts of inflammatory factors and reactive oxygen species, such as tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), IL-6, and nitric oxide (NO), thereby regulating immune function. The excessive release of these factors can damage body tissues; meanwhile, molecules with immunosuppressive properties, such as IL-10, transforming growth factor-β (TGF-β), and IL-35, play important anti-inflammatory roles. IL-10, in particular, participates in regulating the activity of various immune cells by binding to its receptor to form a complex. In monocytes / macrophages, IL-10 can inhibit the synthesis of inflammatory mediators and enhance their antigen uptake capacity.
[0046] RAW264.7 cells in the logarithmic growth phase were harvested and cultured at a concentration of 5 × 10⁻⁶ cells / year. 5 Cells were seeded at a density of [number] cells / mL in 24-well plates and cultured for 12 hours. After cell attachment, 0.5 µg / mL lipopolysaccharide (LPS) was added to each well in the control group, while 0.5 µg / mL LPS and 0.5 mg / mL sample solution were added to each well in the drug treatment group. After 20 hours of drug treatment, LPS was added again for another 4 hours. Subsequently, the culture medium was discarded, cells were washed, cell lysis buffer was added, cells were lysed on ice, and after repeated pipetting, they were transferred to EP tubes.
[0047] (1) Total RNA extraction: Add 100 μL of chloroform to each tube of cell culture, vortex to mix, and incubate at 4 °C for 5 minutes, followed by centrifugation. Carefully transfer the colorless aqueous phase to a new enzyme-free EP tube, add an equal volume of isopropanol, gently invert to mix, and incubate at -20 °C for 30 minutes. Then centrifuge and discard the supernatant. Add 1 mL of anhydrous ethanol to the obtained precipitate, wash by inverting, centrifuge, and remove the supernatant. Repeat this step once. Carefully aspirate the remaining liquid and dry the RNA precipitate at room temperature until it becomes translucent. Finally, dissolve the RNA in 10 μL of DEPC water and determine its concentration.
[0048] (2) RNA reverse transcription: The concentration of RNA in the sample was adjusted to 350 µg / mL. The reaction conditions are shown in Table 2.
[0049] Table 2. cDNA First-Strand Synthesis Reaction System
[0050] Mix well, centrifuge, and reverse transcribe using the following program: 42 ℃, 60 min; 80 ℃, 10 min; 4 ℃, ∞.
[0051] (3) DNA concentration was determined and adjusted to 350 µg / mL with enzyme-free water. Real-time quantitative PCR analysis was performed using SYBR Green master mix, with GAPDH as the internal reference gene, to detect the mRNA expression levels of IL-1β, TNF-α, and IL-4. The total qPCR reaction system is shown in Table 3, and the primer sequences are shown in Table 4.
[0052] Table 3 qPCR total reaction system reagents Volume (µL) cDNA 2 upstream primer 0.5 Downstream primer 0.5 SYBR Green master mix 7.5 <![CDATA[dddH2O]]> 4.5 Mix well, centrifuge, and run the qPCR reaction program as follows: 95 ℃, 2 min; 95 ℃, 15 s; 60 ℃, 30 s, repeat 40 times; melt curve analysis: 95 ℃, 15 s; 60 ℃, 15 s; 95 ℃, 15 s Table 4 qPCR primer sequences Primer name Primer sequences (5′–3′) mIL-1β-F ATCTCGCAGCAGCACATCA mIL-1β-R CCAGCAGGTTATCATCATCATCC mTNF-α-F ACTACGACATCCTCTCCTTAGC mTNF-α-R CCACCACCACGACTCTCAA mIL-4-F CGACATCATCCTACCCGAAGTC mIL-4-R CCTCTCTCTCGGTTGTGTTCTTG mGAPDH-F GTCTCCTCTGACTTCAACAGCG mGAPDH-R ACCACCCTGTTGCTGTAGCCAA 1.2.8 Assay for α-glucosidase inhibitory activity The drug concentration gradient was set at 10, 5, 2, 1, 0.5, and 0.25 mg / mL, with three parallel experiments performed for each concentration.
[0053] Experimental group (A) X Add 60 μL of 0.1 M phosphate buffer (pH 6.8), 100 μL of the sample solution, and 20 μL of 0.8% α-glucosidase solution sequentially to a 96-well plate. Mix well and incubate at 37°C for 10 min. Then, add 20 μL of 0.01 M PNPG solution under dark conditions and incubate at 37°C for another 30 min. Measure the absorbance (A) at 405 nm using a microplate reader. X1 Add 80 μL of PBS and 100 μL of sample solution sequentially to a 96-well plate, mix well, and react at 37°C for 10 min. Then add 20 μL of PNPG solution in the dark and continue reacting at 37°C for 30 min. Measure the absorbance at 405 nm using a microplate reader (A). X2 ).
[0054] Blank control group (A0): 160 μL of PBS was added to a 96-well plate, followed by 20 μL of α-glucosidase solution. The mixture was stirred and reacted at 37 °C for 10 min. Then, 20 μL of PNPG solution was added in the dark, and the reaction was continued at 37 °C for 30 min. The absorbance at 405 nm was measured using an ELISA reader (A0).
[0055] α-glucosidase inhibition rate (100%) = (1 - A) X A0) 100% A X =A X1 -A X2 In the formula A X A0 is the absorbance value after the sample reacts with the substrate, and A0 is the absorbance value after the α-glucosidase reacts with the substrate.
[0056] 1.3 Statistical Analysis All experiments were performed in triplicate. Data are expressed as mean ± standard deviation and statistical analysis was performed using SPSS 29.0 software. One-way ANOVA was used in the MTT assay to study antitumor activity, employing Dunnett's and Duncan's comparison methods to analyze statistical differences and discuss and assess intergroup differences. P < 0.05 indicates that the difference is statistically significant; where, P Values less than 0.05 are indicated by "*". P < 0.01 is represented by "**".
[0057] 2 Results 2.1 Recovery rate of eagle tea polysaccharides after enzymatic hydrolysis The experimental results are shown in Table 5. The highest recovery rate of eagle tea polysaccharide after different treatment methods was found in the HTP-S group, with a recovery rate of 60.5%; the highest recovery rate of eagle tea polysaccharide after enzymatic hydrolysis was found in the HTP-H group, with a recovery rate of 56.8%.
[0058] Table 5 Recovery rate of eagle tea polysaccharides Group Recovery rate HTP-S 60.5% HTP-C 44.3% HTP-Pa 56.5% HTP-T 48.9% HTP-Pe 39.7% HTP-H 56.8% 2.2 Monosaccharide composition analysis of eagle tea polysaccharides after enzymatic hydrolysis The polysaccharide sample of *Eagle Tea* was prepared by PMP derivatization and analyzed by high-performance liquid chromatography (HPLC). The chromatogram is shown below. Figure 2 As shown in the figure, comparison and analysis with the standard chromatograms determined that the main components of the eagle tea polysaccharide are six monosaccharides: Man, Rha, Glc, Gal, Xyl, and Ara. The experimental results are shown in Table 6. Ara was the most abundant monosaccharide in the HTP, HTP-S, HTP-C, HTP-T, HTP-Pe, and HTP-H groups, while Glc was the most abundant monosaccharide in the HTP-Pa group.
[0059] In summary, both the enzymatic hydrolysis group and the untreated group consisted of six monosaccharides: Man, Rha, Glc, Gal, Xyl, and Ara. However, the proportions of each monosaccharide varied within each group, with Glc and Ara exhibiting the highest and most significant differences. The highest Man content was found in the HTP-C group (6.24%); the highest Rha content was found in both the HTP and HTP-S groups (1.08%); the highest Glc content was found in the HTP-Pa group (44.87%); the highest Gal content was found in the HTP group (7.23%); the highest Xyl content was found in the HTP-S group (11.93%); and the highest Ara content was found in the HTP-S group (68.56%).
[0060] Table 6. Monosaccharide composition and proportion of *Eagle Tea* polysaccharides name Mannose Rhamnose Glucose Glc Galactose Xyl Xyl Arabic sugar HTP 0.86% 1.08% 22.73% 7.23% 4.33% 63.78% HTP-S 0.82% 1.08% 13.01% 4.60% 11.93% 68.56% HTP-C 6.24% 0.71% 28.06% 7.10% 5.64% 52.26% HTP-Pa 1.00% 0.62% 44.87% 3.55% 6.05% 43.91% HTP-T 1.20% 0.73% 38.07% 3.91% 6.48% 49.61% HTP-Pe 1.26% 0.58% 40.45% 3.09% 7.03% 47.60% HTP-H 1.84% 0.86% 18.57% 4.41% 8.41% 65.91% 2.3 Molecular weight analysis of eagle tea polysaccharides after enzymatic hydrolysis The molecular weight of each group of *Eagle Tea* polysaccharides was determined using high-performance gel permeation chromatography (HPLC). Linear regression was performed using retention time against the logarithm of molecular weight. The molecular weight was calculated based on the elution time of each group, and the results are shown in Table 7. The molecular weight chromatograms are shown below. Figure 3 As shown, the experimental results indicate that the molecular weight spectra of Eagle Tea polysaccharides treated by different methods all show two peaks. The peak area of Peak 1 of the enzymatically hydrolyzed Eagle Tea polysaccharides decreased, while the peak area of Peak 2 increased. The most significant change was observed in the HTP-H group, where the peak area of Peak 2 was 67.64%.
[0061] Table 7. Relative molecular weight of eagle tea polysaccharides determined by HPGPC method
[0062] 2.4 Infrared spectral analysis of eagle tea polysaccharides after enzymatic hydrolysis Infrared analysis of eagle tea polysaccharides was performed using the KBr tablet compression method. The infrared spectra are as follows: Figures 4-10 As shown, at 3400 cm -1 The nearby area has a strong, broad peak, which is the result of the OH stretching vibration, at 2940 cm⁻¹. -1 The presence of a narrow and weak absorption peak near the CH stretching vibration suggests the possible presence of a -CH2 or -CH3 group, at 1620 cm⁻¹. -1 The nearby absorption peak is due to the stretching vibration of C=O, at 1400 cm⁻¹. -1 The nearby absorption peak is the CH angle vibration absorption peak, at 1040 cm⁻¹. -1 The nearby absorption peak is the stretching vibration peak of COC, indicating that the eagle tea polysaccharide contains a pyranose ring.
[0063] 2.5 Analysis of the antioxidant activity of eagle tea polysaccharides after enzymatic hydrolysis (1) Ability to scavenge DPPH free radicals DPPH radical scavenging capacity is a classic indicator for assessing antioxidant activity, and its mechanism is based on the hydrogen-donating capacity of antioxidants. For example... Figure 11 As shown in Figure A, the HTP-S group exhibited better DPPH radical scavenging activity compared to the HTP group. Notably, the HTP-Pa group showed a concentration-dependent decrease in activity after reaching 0.2 mg / mL. The scavenging rates of each experimental group reached a plateau at specific concentrations: the HTP, HTP-S, HTP-C, HTP-T, and HTP-H groups showed the highest scavenging rates at 0.8 mg / mL, while the HTP-Pe group reached its maximum scavenging efficiency at 0.4 mg / mL.
[0064] (2) Ability to scavenge ABTS free radicals ABTS radical scavenging is widely recognized as a tool for measuring the total antioxidant capacity of natural products. To evaluate the total antioxidant capacity of *Eagle Tea* polysaccharide, we measured its ability to scavenge ABTS radicals. Experimental results showed that, as... Figure 11 As shown in Figure B, compared with the HTP group, the HTP-Pe group exhibited stronger scavenging ability against ABTS free radicals, and this ability showed a concentration-dependent effect, with the scavenging ability gradually increasing with increasing polysaccharide concentration. When the concentration of eagle tea polysaccharide exceeded 0.1 mg / mL, the scavenging rate of each group exceeded 95%, demonstrating strong scavenging ability.
[0065] 2.6 Activity analysis of enzymatically hydrolyzed Eagle Tea polysaccharide on HCT-116 cells like Figure 12 As shown, compared with the HTP group, the HTP-S group and the HTP-Pa group showed stronger inhibitory activity against HCT-116 cells. Among them, the HTP-Pa group showed concentration-dependent inhibition, and its inhibitory activity increased with the increase of polysaccharide sample concentration. The HTP-T group had good inhibitory activity against HCT-116 cells at high concentrations, while the HTP-H group had good inhibitory activity against HCT-116 cells at low concentrations.
[0066] Compared with the control group, the effects of different concentrations and different enzymes on the viability of *Eagle Tea Polysaccharide* on HCT-116 cell viability were statistically significant (mean ± SD, n = 3); compared with the 0 mg / mL group, * P < 0.05, ** P < 0.01.
[0067] 2.7 In vitro anti-inflammatory activity of enzymatically hydrolyzed eagle tea polysaccharides The expression levels of mRNA related to inflammatory factors in RAW264.7 cells were detected by qPCR, and the results are as follows: Figure 13As shown, 0.5 µg / mL LPS promoted the release of inflammatory cytokines TNF-α, IL-4, and IL-1β from RAW264.7 cells. The addition of enzymatically hydrolyzed *Eagle Tea Polysaccharide* inhibited the release of inflammatory cytokines from RAW264.7 cells. Among the cytokines, HTP-Pa showed the best effect on TNF-α and IL-1β, while HTP-C showed the best effect on IL-4. Mean ± SD, n=3; compared with the LPS group, * P < 0.05, ** P < 0.01.
[0068] 2.8 Analysis of α-glucosidase inhibitory activity of enzymatically hydrolyzed Eagle Tea polysaccharides Alpha-glucosidase is an essential enzyme in carbohydrate metabolism and has been identified as a clinical therapeutic target for regulating postprandial hyperglycemia. Therefore, by reducing alpha-glucosidase activity to slow down the rate of glucose production, postprandial blood glucose levels can be effectively regulated. Based on this principle, we planned to test the ability of *Eagle Tea Polysaccharide* to inhibit alpha-glucosidase. Experimental results showed that, as... Figure 14 As shown, compared with the HTP group, the HTP-C group, HTP-Pa group and HTP-T group showed stronger inhibitory effects on α-glucosidase, and the HTP-Pa group and HTP-T group showed better inhibitory activity than the positive control drug acarbose group at high concentration (10 mg / mL).
[0069] The above descriptions are merely embodiments of the present invention, and common knowledge such as specific technical solutions and / or characteristics are not described in detail here. It should be noted that those skilled in the art can make various modifications and improvements without departing from the technical solutions of the present invention, and these should also be considered within the scope of protection of the present invention. These modifications and improvements will not affect the effectiveness of the implementation of the present invention or the practicality of the patent. The scope of protection claimed in this application should be determined by the content of its claims, and the specific embodiments described in the specification can be used to interpret the content of the claims.
Claims
1. A method for preparing enzymatically modified eagle tea polysaccharide, characterized in that: Includes the following steps: Step 1: Prepare a solution of eagle tea polysaccharide with a concentration of 10-30 mg / mL; Step 2: Add a biological enzyme to the solution to carry out an enzymatic hydrolysis reaction. The biological enzyme is papain, mesophilic α-amylase, or cellulase. Step 3: After enzymatic hydrolysis, the enzyme is inactivated, the supernatant is collected by centrifugation, the protein is removed by Sevag method, and after dialysis, it is freeze-dried to obtain enzymatically modified eagle tea polysaccharide.
2. The method for preparing enzymatically modified eagle tea polysaccharide according to claim 1, characterized in that: The enzyme-substrate ratio is 1.5%–2.5%.
3. The method for preparing enzymatically modified eagle tea polysaccharide according to claim 2, characterized in that: When the bioenzyme is cellulase, the enzymatic hydrolysis reaction is carried out under conditions of pH 4-6 and temperature 45-55℃.
4. The method for preparing enzymatically modified eagle tea polysaccharide according to claim 2, characterized in that: When the bioenzyme is papain, the enzymatic hydrolysis reaction is carried out under conditions of pH 5-7 and temperature 55-65℃.
5. The method for preparing enzymatically modified eagle tea polysaccharide according to claim 2, characterized in that: When the bioenzyme is mesophilic α-amylase, the enzymatic hydrolysis reaction is carried out under conditions of pH 5.5–6.5 and temperature 40–70°C.
6. The enzymatically modified eagle tea polysaccharide prepared by the preparation method according to any one of claims 1 to 5.
7. The application of the enzymatically modified eagle tea polysaccharide according to claim 6 in the preparation of anti-colon cancer drugs, α-glucosidase inhibitors, hypoglycemic drugs, or functional foods; wherein the biological enzyme used in the enzymatic modification is papain or mesophilic α-amylase.
8. The application of the enzymatically modified eagle tea polysaccharide according to claim 6 in the preparation of anti-inflammatory factor TNF-α, IL-1β and / or IL-4 related drugs; wherein the biological enzyme used in the enzymatic modification is papain or cellulase.