A snp molecular marker related to rapid growth trait of hard clam and application thereof

Abstract

The application discloses a SNP molecular marker related to a fast growth character of hard clam and application thereof, and relates to the technical field of aquatic animal molecular biology. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO. 3, and a SNP site exists at the 142th base, which is an A / C mutation. The application uses GWAS technology to mine the SNP molecular marker related to the fast growth character of hard clam, obtains a SNP molecular marker significantly related to the fast growth character of hard clam, and names the SNP molecular marker as SNP13_14669080. Verification in a hard clam breeding population shows that the fast growth character of the hard clam individual with the AA genotype is more prominent at the SNP13_14669080 site. The SNP molecular marker provided by the application can determine whether the individual has fast growth potential in the early growth stage of the hard clam, and can effectively shorten the hard clam breeding cycle.

Description

Technical Field

[0001] This invention relates to the field of molecular biology technology for aquatic animals, and in particular to a SNP molecular marker associated with the rapid growth trait of blood cockles and its application. Background Technology

[0002] Blood clam ( Scapharca subcrenata Belongs to the class Bivalvia. Bivalvia , cockles Arcoida Clam family Arcidae genus *Ceratophyllum* Scapharca The blood clam is a common burrowing, economically important shellfish. Characterized by its high protein, low fat, and rich hemoglobin content, it possesses significant nutritional value and is highly favored by consumers. Currently, traditional marine shellfish breeding methods often employ population selection, resulting in long breeding cycles and low efficiency. This is particularly true for important economic traits, where selection is ineffective and hinders the development of new varieties. Unlike most marine bivalve mollusks, which have a one-year reproductive cycle, the blood clam requires two years to reach sexual maturity. Furthermore, recent years have seen a significant decline in blood clam population size and genetic resource degradation due to land reclamation and overfishing, making the selection and breeding of superior blood clam varieties imperative.

[0003] Developing fast-growing, high-quality breeds is one of the most important breeding goals in aquatic animal breeding. Traditional selection breeding relies primarily on phenotypic measurements, but aquatic animal growth is highly susceptible to environmental factors, failing to accurately reflect genetic differences and often suffering from inaccurate measurements and time-consuming processes. Single nucleotide polymorphism (SNP) markers, the third generation of molecular markers developed in recent years following RAPD and microsatellite markers, possess advantages over the previous two generations, including wide distribution across the genome, rich genetic diversity, high-throughput detection capabilities, and strong association with important economic traits. They are highly suitable for marker-assisted breeding. Genome-wide association analysis (GWAS) is a crucial technique that utilizes the large number of SNP markers in a species' genome to identify gene variations associated with important traits.

[0004] This invention aims to develop SNP molecular markers related to the rapid growth trait of blood cockles, which will facilitate the accurate selection of fast-growing blood cockle individuals at an early stage, thereby improving the accuracy of early screening of blood cockles, significantly shortening the breeding cycle, and powerfully promoting the breeding process of blood cockles. Summary of the Invention

[0005] The purpose of this invention is to provide a SNP molecular marker associated with the rapid growth trait of blood clams and its application, in order to solve the problems existing in the prior art. This SNP molecular marker is significantly correlated with the rapid growth trait of blood clams, which is beneficial for accurately selecting fast-growing blood clams at an early stage.

[0006] To achieve the above objectives, the present invention provides the following solution: This invention provides an SNP molecular marker associated with the rapid growth trait of blood cockles. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.3, and an SNP site with an A / C mutation is present at the 142nd base.

[0007] The present invention also provides a primer pair for detecting the rapid growth trait of blood cockles, the primer pair comprising an upstream primer with a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.2.

[0008] The present invention also provides the application of the above-mentioned SNP molecular markers in identifying the rapid growth trait of blood cockles, wherein the rapid growth trait is shell length and / or body weight; The shell length of individuals with the AA genotype is greater than that of individuals with the AC and CC genotypes; Individuals with the AA genotype have a greater body weight than individuals with the AC and CC genotypes.

[0009] The present invention also provides the application of the above primer pairs in the preparation of products for identifying rapid growth traits of blood cockles, wherein the rapid growth traits are shell length and / or body weight.

[0010] Furthermore, the product is a reagent kit.

[0011] The present invention also provides a product for identifying the rapid growth trait of blood cockles, comprising the above-mentioned primer pair; The rapid growth trait is shell length and / or body weight.

[0012] Furthermore, the product is a reagent kit.

[0013] This invention also provides the application of the above-mentioned product in identifying the rapid growth trait of blood clam, wherein the rapid growth trait is shell length and / or weight; The shell length of individuals with the AA genotype is greater than that of individuals with the AC and CC genotypes; Individuals with the AA genotype have a greater body weight than individuals with the AC and CC genotypes.

[0014] This invention also provides a method for identifying the length of hairy cockle shells, comprising the following steps: Genomic DNA was extracted from the blood clam sample to be tested; Using the genomic DNA as a template, PCR amplification was performed using the primer pairs described above. The genotypes of the SNP sites were obtained by sequencing, and the shell length trait of the blood clam was identified based on the genotype detection results: the shell length of individuals with the AA genotype was greater than that of individuals with the AC and CC genotypes.

[0015] The present invention also provides a method for identifying the weight characteristics of blood clams, comprising the following steps: Genomic DNA was extracted from the blood clam sample to be tested; Using the genomic DNA as a template, PCR amplification was performed using the primer pairs described above. The genotypes of the SNP sites were obtained by sequencing, and the weight traits of blood clam were identified based on the genotype detection results: individuals with the AA genotype had a greater weight than individuals with the AC and CC genotypes.

[0016] The present invention discloses the following technical effects: (1) This invention utilizes GWAS technology to mine SNP molecular markers associated with the rapid growth trait of blood cockles, and obtains an SNP molecular marker significantly associated with the rapid growth trait of blood cockles, named SNP13_14669080. Validation in blood cockle farming populations shows that at the SNP13_14669080 locus, blood cockle individuals with the AA genotype exhibit a more prominent rapid growth trait.

[0017] (2) The SNP molecular markers provided by this invention can be amplified by primer pairs, and have the advantages of stable experimental conditions, simple and quick operation, accurate and reliable results, and low cost.

[0018] (3) The SNP molecular markers provided by this invention are not limited by the age, sex and growth environment of the blood clam. They can determine whether the individual has the potential for rapid growth in the early stage of blood clam growth, optimize the screening conditions, save manpower and resources, effectively shorten the blood clam breeding cycle, and accelerate the breeding process of fast-growing new blood clam varieties (lines). Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0020] Figure 1 Manhattan plot (A) and QQ plot (B) for weight traits in genome-wide association analysis of blood clam; Figure 2 Manhattan plot (A) and QQ plot (B) for shell length traits in genome-wide association analysis of blood clam. Detailed Implementation

[0021] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0022] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0023] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0024] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0025] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0026] Example 1: Development of SNP molecular markers related to the rapid growth trait of blood cockles 1. Blood cockle sample collection and individual phenotypic measurement A total of 520 blood clam samples were collected from five geographical populations along the Chinese coast (including 100 farmed samples from Ninghai, Zhejiang; 100 wild samples from Ninghai, Zhejiang; 60 wild samples from Dalian, Liaoning; 200 wild samples from Jimo, Shandong; and 60 wild samples from Tangshan, Hebei) for muscle tissue DNA extraction. Growth-related traits were measured in all samples, including shell length (SL, mm), shell width (SW, mm), shell height (SH, mm), and body weight (BW, g). Muscle tissue was harvested from each sample, and DNA was extracted using a marine animal tissue genomic DNA extraction kit manufactured by Tiangen Biotech (Beijing) Co., Ltd. DNA quality and concentration were assessed using 1% agarose gel electrophoresis and a micro spectrophotometer. Library construction and high-throughput sequencing were performed by Qingdao Ouyi Biotechnology Co., Ltd. A total of 520 sequencing libraries were constructed, with an average insert size of approximately 300 bp. Sequencing was then performed on the Illumina NovaSeq 6000 platform, generating 150 bp paired-end reads.

[0027] 2. Whole-genome resequencing and single nucleotide polymorphism (SNP) identification After genome resequencing, optimization measures including quality control, read alignment, variant detection, and screening were implemented on the raw data to obtain high-quality sequences. High-quality reads were then aligned to the *Ceratophyllum demersum* reference genome (version number: GCA_021292105.1). The alignment results were converted to an appropriate format, PCR repetitive sequences were removed, and subsequent analysis was performed. Based on the alignment results between the resequencing sequences of the samples and the reference genome, SNP detection was performed. The SNP selection criteria were: Quality Value (QUAL) < 40, Quality of Variation (QD) < 2.0, Fisher strand skewness (FS) > 60.0, Mapping Quality (MQ) < 40.0, Strand Skewness Ratio (SOR) > 3.0, and Mapping Quality Rank Sum (MQRankSum) < -12.5. Further additional screening was performed using Read Position Rank Sum (ReadPosRankSum) < -8.0, with the following specific criteria: Minimum Allele Frequency (--maf) 0.05, Maximum Missing Rate (--max-missing) 0.8, Minimum Number of Alleles (--min-alleles) 2, and Maximum Number of Alleles (--max-alleles) 2. Finally, all SNP mutation sites in the blood clam population were obtained.

[0028] 3. SNP loci associated with growth traits of blood cockles were obtained based on genome-wide association analysis (GWAS). To obtain SNPs associated with growth traits in blood clams from the aforementioned mutation sites, a GWAS analysis was performed using a mixed linear model (MLM). The MLM statistical model is shown below: y = Xα + Zβ + Wμ + e; Where y represents the phenotypic trait vector; X represents the indicator matrix of fixed effects, α represents the estimated coefficients of fixed effects; Z represents the indicator matrix of SNPs, β represents the estimated effect of SNPs; W represents the indicator matrix of random genetic effects, μ represents the predicted random effect, and e represents the random residual, assumed to follow a normal distribution e^(0, σ²). e The Bonferroni correction method was used to analyze the SNPs. P The value is corrected, and the significance threshold is set to 0.05 / total number of SNPs. P When the value is greater than the significance threshold, the SNP is considered to be significantly associated with the growth trait.

[0029] Figure 1 Manhattan plot and QQ plot for body weight trait in genome-wide association analysis of blood clam. Figure 2 Manhattan plot and QQ plot for shell length trait in genome-wide association analysis of blood clam.

[0030] As shown in Table 1, there are four SNP loci significantly associated with growth traits (including shell length and body weight). Among these SNP loci, this invention found that only the SNP located at position 14,669,080 on chromosome 13 and position 17,855,598 on chromosome 1 could be annotated with candidate genes related to growth within a base window of ±50K upstream and downstream. Specifically, SNP13_14669080 at position 14,669,080 on chromosome 13 was significantly associated with both shell length and body weight traits; its mutation type is C / A, and individuals carrying the AA genotype at this locus exhibited more prominent growth traits. However, the SNP at position 17,855,598 on chromosome 1, after population validation, did not reveal a preferred genotype significantly different from other genotypes. Ultimately, this invention determined SNP13_14669080 as a molecular marker significantly associated with the rapid growth trait of blood clams.

[0031] Table 1. Information on significant SNP sites associated with growth traits of blood cockles. 4. SNP primer design Primers for amplification of SNP13_14669080 were designed using the Primer online primer design software (https: / / www.primer3plus.com), and primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The primer pairs for amplification of SNP13_14669080 are as follows: Upstream primer: 5'-ACACATCGATATAATGTCCCCG-3' (SEQ ID NO.1); Downstream primer: 5'-ATGACAAATAAAGCAACCCTGA-3' (SEQ ID NO.2).

[0032] Example 2: Validation of SNP molecular markers related to the rapid growth trait of blood cockles A population of blood clams from the same breeding batch in Jimo, Shandong Province, was selected, and 198 individuals were randomly chosen. The growth traits (shell length and weight) of each blood clam were measured and recorded. DNA was extracted and detected from the muscle tissue of each sample using the method described in Example 1. Subsequently, using the extracted DNA as a template, PCR amplification was performed using the primer pairs designed in Example 1 to obtain a gene fragment containing the SNP13_14669080 locus.

[0033] The PCR reaction system was as follows: the total volume was 25 μL, including 12.5 μL of 2×Taq MasterMix, 0.5 μL each of upstream and downstream primers, 1 μL of template DNA, and ddH2O added to a final volume of 25 μL.

[0034] The PCR reaction program was as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; and finally 72℃ extension for 7 min.

[0035] The PCR products were analyzed by 1.0% agarose gel electrophoresis and then sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The nucleotide sequence of the PCR product is shown in SEQ ID NO.3, in which SNP13_14669080 is located at position 142 of the sequence, and the mutation type is C / A.

[0036] SEQ ID NO.3: ACACATCGATATAATGTCCCCG ATGACTTTATCACCTCATTTATCCCAGCATAATTTTTGCCCCAAAATCTTTTTATTTAATAATTTGTCTTTACAAGACTCCTTTGTCAATTTTCTTTCACAACGCCAAAATTTGACAGAMCTAACGTGACAATGA ATCCAATTTTACTATACAGCGTATATGTAAAATAGGTGTATAATGCATATATACTAATTATACATGTATATCAATATGTTATTTTCTTTATACCTATATAGACATATATATACGTGCTGTTATAATAAAATGTATG TCA GGGTTGCTTTATTTGTCAT Where M is either A or C.

[0037] Tables 2-3 show the results of validation of the SNP locus SNP13_14669080 in the blood clam farming population. Table 2 shows the shell length, weight, and corresponding genotypes of 198 blood clam individuals. Table 4 shows the association analysis between shell length, weight, and genotype of the 198 blood clam individuals. The results indicate that in the validated blood clam farming population, the shell length and weight of individuals with the AA genotype at this SNP locus were significantly higher than those with the CC and AC genotypes. P <0.01), where the average shell length of the AA genotype was 7.74 mm and 6.79 mm longer than that of the CC and AC genotypes, respectively; the average body weight of the AA genotype was 15.68 g and 14.19 g longer than that of the CC and AC genotypes, respectively, indicating that the AA genotype is the preferred genotype.

[0038] Table 2. Shell length, weight, and corresponding genotype of 198 blood clam species. Table 3. Association analysis between 198 growth traits (shell length and body weight) and genotypes in blood clam. Note: The numbers in parentheses represent the genotype combinations used in the differential test.

[0039] In conclusion, the SNP locus SNP13_14669080 is significantly associated with the rapid growth trait of blood clams. The genotype of this locus can be obtained through sequencing, a simple and rapid experimental method. Determining the genotype at this locus allows for early assessment of whether blood clams possess the rapid growth trait, which is of great significance for accelerating the breeding of superior fast-growing varieties (strains) of blood clams and promoting the development of the blood clam industry.

[0040] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A SNP molecular marker associated with the rapid growth trait of blood cockles, characterized in that, The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.3, and an SNP site is present at the 142nd base, which is an A / C mutation.

2. A primer pair for detecting the rapid growth trait of blood cockles, characterized in that, The primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.

2.

3. The application of the SNP molecular marker as described in claim 1 in identifying the rapid growth trait of blood cockles, characterized in that, The rapid growth trait is shell length and / or body weight; The shell length of individuals with the AA genotype is greater than that of individuals with the AC and CC genotypes; Individuals with the AA genotype have a greater body weight than individuals with the AC and CC genotypes.

4. The application of the primer pair as described in claim 2 in the preparation of products for identifying the rapid growth trait of blood cockles, characterized in that, The rapid growth trait is shell length and / or body weight.

5. The application according to claim 4, characterized in that, The product in question is a reagent kit.

6. A product for identifying the rapid growth trait of blood clams, characterized in that, Includes the primer pair as described in claim 2; The rapid growth trait is shell length and / or body weight.

7. The product according to claim 6, characterized in that, The product in question is a reagent kit.

8. The application of the product as described in claim 6 or 7 in identifying the rapid growth trait of blood cockles, characterized in that, The rapid growth trait is shell length and / or body weight; The shell length of individuals with the AA genotype is greater than that of individuals with the AC and CC genotypes; Individuals with the AA genotype have a greater body weight than individuals with the AC and CC genotypes.

9. A method for identifying the morphological characteristics of hairy cockle shells, characterized in that, Includes the following steps: Genomic DNA was extracted from the blood clam sample to be tested; Using the genomic DNA as a template, PCR amplification was performed using the primer pair described in claim 2. The genotypes of the SNP sites were obtained by sequencing, and the shell length trait of the blood clam was identified based on the genotype detection results: the shell length of individuals with the AA genotype was greater than that of individuals with the AC and CC genotypes.

10. A method for identifying the weight characteristics of blood cockles, characterized in that, Includes the following steps: Genomic DNA was extracted from the blood clam sample to be tested; Using the genomic DNA as a template, PCR amplification was performed using the primer pair described in claim 2. The genotypes of the SNP sites were obtained by sequencing, and the weight traits of blood clam were identified based on the genotype detection results: the weight of individuals with the AA genotype was greater than that of individuals with the AC and CC genotypes.

Images