Method for rapidly identifying ganoderma lucidum stem length by gene expression amount

Abstract

The application discloses a method for rapidly identifying Ganoderma lucidum stem length by using gene expression, and belongs to the technical field of Ganoderma lucidum breeding and cultivation. The application detects the relative expression of cytochrome P450 monooxygenase gene (P450 gene) and protein kinase gene (Pkinase gene) in Ganoderma lucidum mycelium, uses specific primers q0054762 and q0088881 to perform qPCR amplification, and establishes a correlation model between gene expression and stem phenotype, so that the length of Ganoderma lucidum stem can be rapidly and accurately predicted in the mycelium stage, traditional mushroom cultivation is not needed, the breeding cycle is significantly shortened, the detection cost is reduced, and the workload is reduced, and the application provides an efficient and simple technical means for molecular assisted breeding of Ganoderma lucidum.

Description

Technical Field

[0001] This invention belongs to the field of Ganoderma lucidum breeding and cultivation technology, specifically relating to a method for rapidly identifying the length of Ganoderma lucidum stipe using gene expression levels. Background Technology

[0002] Reishi mushroom, taxonomically belonging to the order Polyporales, family Ganodermataceae, and genus Ganoderma, has a fruiting body mainly composed of a cap and a stipe. The color, shape, and texture of the cap, as well as the length and thickness of the stipe, are important commercial characteristics. Different parts of the fruiting body also exhibit differences in the types and contents of bioactive components, and variations in the proportions of these components can potentially affect the medicinal efficacy of the reishi. Furthermore, the length of the stipe influences the growth and development cycle and the harvesting cycle of the fruiting body. Different reishi varieties exhibit significant differences in stipe length. Researching the stipe development mechanism can provide guidance for breeding varieties targeting the stipe, optimizing the structure of the artificial cultivation industry, and increasing production and income.

[0003] Studies have shown that the total phenolic and total flavonoid content of the stipe of mature Ganoderma lucidum spores is significantly higher than that of the cap, and it exhibits strong antioxidant activity. The contents of ganoderic acid B, ganoderic acid A, and ganoderic acid B are highest in the stipe of young Ganoderma lucidum fruiting bodies. Therefore, the stipe can be used to extract these highly polar triterpenoids. Furthermore, studies have found that ganoderic acids are mainly distributed in the shell layer and context layer of the stipe. Thus, the Ganoderma lucidum stipe can meet the needs of certain personalized / specialty drugs. Understanding the mechanism of stipe length formation and guiding the breeding of Ganoderma lucidum strains with superior stipe characteristics is of great significance.

[0004] In my country, the average stipe length of artificially cultivated Ganoderma lucidum is 3.75 cm. In previous studies, we obtained a long-stalked Ganoderma lucidum strain, GL0002. This strain, after substrate cultivation, achieved a stipe length of 20-30 cm, and the cap only began to develop after the stipe stopped elongating, exhibiting a "stalk-first, cap-later" trait. We define Ganoderma lucidum strains with stipe lengths of 3-6 cm as short-stalked strains and those with stipe lengths of 12-30 cm as long-stalked strains. Fruiting cultivation is the traditional method for determining stipe length, but this process requires specific site conditions, is labor-intensive, and time-consuming. Therefore, a rapid and accurate method for determining stipe length can be used to assess the length early on, allowing for the selection of only a smaller number of strains for subsequent cultivation, significantly reducing workload and enabling more effective screening of target strains. Summary of the Invention

[0005] This invention addresses the problems of long fruiting cycles and cumbersome, costly processes for determining stipe length in Ganoderma lucidum by providing a method for rapid identification of stipe length using gene expression levels. This method detects the relative expression levels of the cytochrome P450 monooxygenase gene (P450 gene) and the protein kinase gene (Pkinase gene) in Ganoderma lucidum mycelium, and uses specific primer pairs q0054762 and q0088881 for qPCR amplification to establish a correlation model between gene expression levels and stipe phenotype (long stipe / short stipe). This allows for rapid and accurate prediction of Ganoderma lucidum stipe length at the mycelial stage, significantly shortening the breeding cycle and reducing detection costs.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0007] A primer pair for detecting the stipe length of Ganoderma lucidum using gene expression levels, the primer pair comprising q0054762 and q0088881,

[0008] The primer pair q0054762 sequence is as follows:

[0009] q0054762_F: CTSGCRGACGGGACGTATCT (SEQ ID NO.1);

[0010] q0054762_R:CGTGTTGACGAACTGATGGC (SEQ ID NO.2);

[0011] The primer pair q0088881 sequence is as follows:

[0012] q0088881_F: RTGGTTTCGGGGAATMAAGT (SEQ ID NO.3);

[0013] q0088881_R: CCAGTCAGTGGTSGTGTCGT (SEQ ID NO. 4).

[0014] The present invention also provides a kit comprising the primer pair q0054762 and q0088881 described above.

[0015] The present invention also provides the application of the above primer pairs or kits in identifying the length of Ganoderma lucidum stipes.

[0016] Furthermore, primer pair q0054762 is derived from the Ganoderma lucidum P450 gene, the sequences of which in Ganoderma lucidum (long-stalked and short-stalked) are shown as P450_chang and P450_duan, as detailed in SEQ ID NO. 5 and SEQ ID NO. 6. Primer pair q0088881 is derived from the Ganoderma lucidum Pkinase gene, the sequences of which in Ganoderma lucidum (long-stalked and short-stalked) are shown as Pkinase_chang and Pkinase_duan, as detailed in SEQ ID NO. 7 and SEQ ID NO. 8.

[0017] The present invention also provides a method for detecting the length of Ganoderma lucidum stipe, comprising the following steps:

[0018] (1) Inoculate Ganoderma lucidum mycelium into potato dextrose medium for culture;

[0019] (2) Collect Ganoderma lucidum mycelium, extract RNA, and reverse transcribe it into cDNA;

[0020] (3) Using cDNA as a template, qPCR amplification was performed using primer pairs q0054762 and q0088881 respectively. Using gapdh as an internal control, the relative expression levels of P450 gene and Pkinase gene in hyphae were calculated.

[0021] Among them, the relative expression level of the P450 gene in the short-stalked strain was twice or more than that in the long-stalked strain; the relative expression level of the Pkinase gene in the long-stalked strain was twice or more than that in the short-stalked strain.

[0022] Furthermore, the qPCR amplification reaction system is as follows: 10 μL of 2 × ChamQ Universal SYBR qPCRMaster Mix, 0.4 μL each of 10 μmol / L forward and reverse primers, 8.2 μL of double-distilled water, and 1 μL of cDNA; the two-step reaction program is as follows: 95 ℃ pre-denaturation for 3 min; 95 ℃ denaturation for 3 s, 60 ℃ annealing for 32 s, 40 cycles; 72 ℃ final extension for 30 s.

[0023] Furthermore, the detection primers for the internal reference gapdh are:

[0024] gapdh_duan_F: GGTGCCAAGAAGGTGGTCAT (SEQ ID NO.9);

[0025] gapdh_duan_R: CGAGAGGAGCCAGACAGTTG (SEQ ID NO.10);

[0026] gapdh_chang_F: CCGTATCGTCCTTCGCAATG (SEQ ID NO.11);

[0027] gapdh_chang_R: CGCCAGACCAGTTGATGTTG (SEQ ID NO. 12).

[0028] The present invention has the following beneficial effects:

[0029] This invention enables rapid and accurate prediction of stipe length during the mycelial stage by detecting the relative expression levels of the P450 gene and the Pkinase gene in Ganoderma lucidum mycelium. This eliminates the need for traditional fruiting cultivation, significantly shortens the breeding cycle, reduces testing costs, and alleviates workload, providing an efficient and convenient technical means for molecular-assisted breeding of Ganoderma lucidum.

[0030] The Ganoderma lucidum strain J-7 has been published in the literature (Ye Liyun, Lu Xin, et al. Study on the differences between monokaryotic and binkaryotic mycelia of Ganoderma lucidum [J]. Food Industry Technology, 2016, 37(20): 211-215). The applicant also holds and guarantees to publicly distribute it within 20 years from the date of application.

[0031] The Ganoderma lucidum strain GL0002 has been published in the literature (Huang Qinghua, Wang Qingfu, et al. Study and component analysis of Ganoderma lucidum cultured from sugarcane bagasse and brewer's lees [J]. Food Industry Technology, 2015, 36(21): 143-147). The applicant also holds and guarantees to publicly distribute it within 20 years from the date of application.

[0032] The Ganoderma lucidum strain 2P2_VS_J-7 has been published in the Global Pharmacopoeia Genome Database (accessible at http: / / www.gpgenome.com / species / 408). The applicant also holds and guarantees to make it publicly available for 20 years from the date of application.

[0033] The Ganoderma lucidum strain 2P2_VS_5.26 has been published in Chinese patent application (application number 202310335280.0, invention title: A Ganoderma lucidum monokaryotic strain and its application), corresponding to the strain "2P2_vs_5.0026" described in the patent. The applicant also holds and guarantees to publicly disclose it within 20 years from the application date. Attached Figure Description

[0034] Figure 1 This study validated the qPCR amplification primers in six Ganoderma lucidum strains.

[0035] Figure 2Analysis of P450 and Pkinase gene expression in Ganoderma lucidum stipe.

[0036] Figure 3 Analysis of P450 and Pkinase gene expression in Ganoderma lucidum mycelium. Detailed Implementation

[0037] The following embodiments are further illustrations of the present invention, but not limitations thereof. Specific experimental conditions and methods are not specified in the following embodiments, and the techniques used are generally conventional methods well known to those skilled in the art.

[0038] Example 1: Screening for differentially expressed genes in long and short stalks using transcriptome data from Ganoderma lucidum stipes and designing primers.

[0039] The six Ganoderma strains involved in this experiment were GL0102 (the Ganoderma cultivar 'Zhi 102' recognized by the Fujian Provincial Crop Variety Approval Committee), CGMCC5.26, J-7, GL0002 (a Ganoderma strain with a relatively long stipe previously preserved in the laboratory), 2P2_VS_J-7 (a hybrid strain of GL0002_P2 (GDMCC No: 63286) and J-7), and 2P2_VS_5.26 (a hybrid strain of GL0002_P2 (GDMCC No: 63286) and CGMCC5.26). Among them, GL0102, CGMCC5.26, and J-7 are short-stalked Ganoderma strains; GL0002, 2P2_VS_J-7, and 2P2_VS_5.26 are long-stalked Ganoderma strains.

[0040] Follow these steps:

[0041] (1) Cultivation medium formula: 10 wt% oak sawdust, 70 wt% sugarcane bagasse, 19 wt% wheat bran, 1 wt% lime, mixed and adjusted to a moisture content of 60 wt%. Take 0.5 kg of the mixed culture medium and put it into a cultivation bag, sterilize at 121 ℃ for 120 min.

[0042] (2) Inoculation and mycelium growth: Take 5 mycelium blocks with a diameter of 1 cm and inoculate them into the cultivation bag, with 10 bags of each type as a duplicate. Incubate at 28 ℃ in the dark until the mycelium fills the bag.

[0043] (3) Mushroom management: Transfer the mushroom bags to the mushroom growing room, control the temperature at 25~28 ℃, the relative humidity of the air at 70~90%, provide 300 Lux light treatment during the day, and keep it dark at night.

[0044] (4) Stipe collection and transcriptome sequencing: The stipes of GL0102, CGMCC5.26, J-7, GL0002, 2P2_VS_J-7 and 2P2_VS_5.26 were collected and their transcriptomes were sequenced.

[0045] (5) Target gene screening: In the transcriptome data above, the genes with the largest up- or down-regulation in the long-stalked and short-stalked varieties were selected as candidate genes.

[0046] (6) Primer design: Primers were designed based on the relatively conserved regions of the long-stalk and short-stalk gene sequences, and degenerate bases were used at SNP sites. qPCR amplification was performed using cDNA from the above six Ganoderma lucidum strains at 2-fold serial dilutions, and the agarose gel electrophoresis results were used as the basis for the amplification. Figure 1 The optimal primers were selected based on the results of normal amplification in all strains and the amplification efficiency (Table 1).

[0047] The above analysis yielded two target genes, and their qPCR amplification primers are shown in Table 1 below.

[0048] Table 1

[0049] Example 2: Verification of P450 and Pkinase expression levels in Ganoderma lucidum stipes

[0050] (1) The RNA of each Ganoderma lucidum stipe was reverse transcribed into cDNA.

[0051] (2) The above samples were subjected to qPCR using the primers of the present invention and the primers of the internal reference gene gapdh in Table 1.

[0052] (3) The reaction system was: 10 μL of 2 × ChamQ Universal SYBR qPCR Master Mix, 0.4 μL each of 10 μmol / L forward and reverse primers, 8.2 μL of double-distilled water, and 1 μL of cDNA; the two-step reaction program was: 95 ℃ pre-denaturation for 3 min; 95 ℃ denaturation for 3 s, 60 ℃ annealing for 32 s, 40 cycles; and 72 ℃ final extension for 30 s.

[0053] (4) Utilize 2 −△△Ct The relative expression levels of P450 and Pkinase genes in each stipe were calculated using the method, and the results are as follows: Figure 2 As shown, the expression level of the P450 gene in the stipe of Ganoderma lucidum with short stalk is significantly higher than that in the stipe of Ganoderma lucidum with long stalk, while the expression level of the Pkinase gene in the stipe of Ganoderma lucidum with long stalk is significantly higher than that in the stipe of Ganoderma lucidum with short stalk.

[0054] Example 3: Verification of P450 and Pkinase expression levels in Ganoderma lucidum mycelia

[0055] (1) Inoculate each Ganoderma lucidum mycelium into potato glucose medium and culture at 28 ℃ for 5 days.

[0056] (2) Collect Ganoderma lucidum mycelium, extract RNA, and reverse transcribe it into cDNA.

[0057] (3) The above cDNA was amplified by qPCR using primer pairs q0054762 and q0088881 in Table 1, with gapdh as an internal control, and the relative expression levels of P450 and Pkinase in each hyphae were calculated. The expression levels of P450 and Pkinase in short-stalked and long-stalked Ganoderma lucidum hyphae were significantly different: the expression level of P450 gene in short-stalked Ganoderma lucidum hyphae was 2 times or more than that in long-stalked Ganoderma lucidum hyphae; the expression level of Pkinase gene in long-stalked Ganoderma lucidum hyphae was 2 times or more than that in short-stalked Ganoderma lucidum hyphae. Figure 3 ).

[0058] P450_chang (SEQ ID NO.5)

[0059] >P450_duan(SEQ ID NO.6)

[0060] >Pkinase_chang(SEQ ID NO.7)

[0061] >Pkinase_duan(SEQ ID NO.8)

[0062] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be considered as limitations on the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. For those skilled in the art, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A primer pair for detecting the length of Ganoderma lucidum stipe using gene expression levels, characterized in that, The primer pair includes q0054762 and q0088881; The primer pair q0054762 sequence is as follows: q0054762_F: CTSGCRGACGGGACGTATCT; q0054762_R:CGTGTTGACGAACTGATGGC; The primer pair q0088881 sequence is as follows: q0088881_F: RTGGTTTCGGGGAATMAAGT; q0088881_R:CCAGTCAGTGGTSGTGTCGT.

2. The primer pair according to claim 1, characterized in that, The primer pair q0054762 is derived from the Ganoderma lucidum P450 gene, and the primer pair q0088881 is derived from the Ganoderma lucidum Pkinase gene.

3. A reagent kit, characterized in that, It contains the primer pair as described in claim 1 or 2.

4. The application of the primer pair of claim 1 or the kit of claim 3 in the identification of Ganoderma lucidum stipe length.

5. A method for detecting the length of Ganoderma lucidum stipe, characterized in that, Includes the following steps: (1) Inoculate Ganoderma lucidum mycelium into potato dextrose medium for culture; (2) Collect Ganoderma lucidum mycelium, extract RNA, and reverse transcribe it into cDNA; (3) Using cDNA as a template, qPCR amplification was performed on q0054762 and q0088881 using the primer pairs described in claim 1, with gapdh as an internal reference, and the relative expression levels of P450 gene and Pkinase gene in the hyphae were calculated. Among them, the relative expression level of the P450 gene in the short-stalked strain was twice or more than that in the long-stalked strain; the relative expression level of the Pkinase gene in the long-stalked strain was twice or more than that in the short-stalked strain.

6. The method according to claim 5, characterized in that, The qPCR amplification reaction system was as follows: 10 μL of 2 × ChamQ Universal SYBR qPCR Master Mix, 0.4 μL each of 10 μmol / L forward and reverse primers, 8.2 μL of double-distilled water, and 1 μL of cDNA. The two-step reaction program was as follows: 95 ℃ pre-denaturation for 3 min; 95 ℃ denaturation for 3 s, 60 ℃ annealing for 32 s, 40 cycles; and 72 ℃ final extension for 30 s.

7. The method according to claim 5, characterized in that, The detection primers for the internal reference gapdh are: gapdh_duan_F: GGTGCCAAGAAGGTGGTCAT; gapdh_duan_R: CGAGAGGAGCCAGACAGTTG; gapdh_chang_F: CCGTATCGTCCTTCGCAATG; gapdh_chang_R: CGCCAGACCAGTTGATGTTG.

Images