A SNP molecular marker significantly related to salt tolerance of wheat, kasp primer for amplification thereof and application thereof

Abstract

The application provides a SNP molecular marker significantly related to salt tolerance of wheat, KASP primers for amplification and application, and belongs to the technical field of molecular markers. The application obtains the SNP molecular marker significantly related to salt tolerance of wheat by using a whole genome correlation analysis method, is located in a TraesCS7B02G466300 gene of a wheat 7B chromosome, is located at a position of 723901993 of the 7B chromosome, and C / T polymorphism exists; when a genotype of the wheat to be detected is CC, salt tolerance is significantly enhanced, and when the genotype is TT, salt tolerance is significantly reduced. The application further provides KASP primers for detecting the SNP molecular marker and a detection method, can rapidly screen salt-tolerant genotypic individuals at a wheat seedling stage, greatly shortens a wheat breeding cycle, improves breeding efficiency, and lays a foundation for screening salt-tolerant germplasm resources and cultivating new salt-tolerant wheat varieties.

Description

Technical Field

[0001] This application belongs to the field of molecular marker technology, specifically relating to an SNP molecular marker that is significantly associated with wheat salt tolerance, its KASP primers for amplification, and its applications. Background Technology

[0002] Soil salinization is one of the major abiotic stresses facing agricultural production. Excessive salt in saline soils can lead to osmotic stress, ion toxicity, and nutrient imbalances in plants, inhibiting growth and development, reducing yields, and in severe cases, causing plant death and crop failure. Wheat, as a major global food crop, is sensitive to salt stress. Saline soils hinder water and nutrient absorption by wheat roots, reduce photosynthetic efficiency, and decrease biomass, ultimately leading to reduced yields or even crop failure. Therefore, developing salt-tolerant wheat varieties is an important way to ensure food security.

[0003] Traditional wheat salt tolerance breeding mainly relies on field phenotypic identification, requiring observation of traits such as salt tolerance at the seedling stage and yield at the adult stage under salt stress. This approach suffers from problems such as long cycles, significant environmental influences, and low selection efficiency. Molecular marker-assisted breeding technology can directly screen genotypes through molecular markers closely linked to the target trait, unaffected by environmental interference, significantly shortening the breeding cycle and improving selection efficiency. Single nucleotide polymorphism (SNP) markers, as third-generation molecular markers, have the characteristics of wide distribution, high detection efficiency, and strong stability, and have become a core tool for elucidating the genetic mechanisms of wheat salt tolerance and assisting molecular breeding. Wheat salt tolerance is a complex quantitative trait controlled by multiple genes, and the discovery and localization of SNP markers are key to understanding its genetic basis. Genome-wide association analysis (GWAS) is the mainstream technique for discovering wheat salt tolerance SNP markers, and domestic scholars have made significant breakthroughs using this technique. Currently reported wheat salt tolerance-related SNP markers are mostly linked to salt tolerance QTLs (quantitative trait loci), which have problems such as low detection efficiency, low correlation with target traits, and narrow range of applicable varieties, making it difficult to meet the actual needs of wheat salt tolerance breeding. Summary of the Invention

[0004] The purpose of this application is to provide a SNP molecular marker that is significantly associated with wheat salt tolerance. Based on the CC genotype, individuals with salt-tolerant genotypes can be rapidly screened during the wheat seedling stage, which can significantly shorten the breeding cycle and improve breeding efficiency.

[0005] This invention provides an SNP molecular marker that is significantly associated with wheat salt tolerance. The SNP is a DNA fragment with a nucleotide sequence as shown in SEQ ID NO:1, in which a C / T polymorphism exists at position 101.

[0006] This invention provides KASP primers for amplifying the SNP molecular marker, including KASP-F1, KASP-F2 and the universal primer KASP-R; The nucleotide sequence of the KASP-F1 is shown in SEQ ID NO:2; The nucleotide sequence of the KASP-F2 is shown in SEQ ID NO:3; The nucleotide sequence of the universal primer KASP-R is shown in SEQ ID NO:4.

[0007] This invention provides a wheat salt tolerance detection kit, including the KASP primers.

[0008] Preferably, it also includes 2×Master mix.

[0009] Preferably, it also includes DNA extraction reagents.

[0010] This invention provides the application of the KASP primers or the kit in detecting wheat salt tolerance, screening salt-tolerant wheat materials, or breeding salt-tolerant wheat.

[0011] Preferably, the salt-tolerant wheat variety is determined based on the genotype of the SNP molecular marker: when the genotype of the SNP molecular marker is CC, the sample to be tested is a salt-tolerant wheat material; when the genotype of the SNP molecular marker is TT, the sample to be tested is a salinity-sensitive wheat material.

[0012] This invention provides a method for detecting the salt tolerance of wheat, comprising the following steps: Using the genomic DNA of the wheat material to be tested as a template, PCR amplification was performed using the KASP primers, and the salt tolerance of wheat was determined based on the genotype of the PCR product. When the genotype of the SNP molecular marker is CC, the sample to be tested is a salt-tolerant wheat material; When the genotype of the SNP molecular marker is TT, the sample to be tested is a salinity-sensitive wheat material.

[0013] Preferably, the wheat material to be tested includes material from any of the following stages: wheat seeds, wheat seedlings, wheat tillering stage, wheat overwintering stage, wheat greening stage, wheat tillering stage, wheat jointing stage, wheat booting stage, wheat heading stage, wheat flowering stage, wheat grain filling stage, and wheat maturity stage.

[0014] Preferably, the PCR amplification reaction procedure is as follows: denaturation phase: 95°C, 15 min; Amplification phase: 94℃ for 20s, 61-55℃ for 60s, gradient annealing, decreasing by 0.6℃ per cycle, 10 cycles; Fluorescence signal amplification phase: 94℃ for 20s, 55℃ for 60s, 26 cycles.

[0015] This invention provides a SNP molecular marker significantly associated with wheat salt tolerance, which is a DNA fragment with the nucleotide sequence shown in SEQ ID NO:1, containing a C / T polymorphism at position 101. Experiments show that the SNP molecular marker RAC875_c26057_370 is significantly associated with salt tolerance in wheat. Specifically, this molecular marker is located at position 723901993 on chromosome 07B of the reference genome (IWGSC RefSeq v2.1). This site exhibits a C / T base polymorphism. If the genotype at this site is CC, the wheat being tested has a superior salt-tolerant genotype; if the base at this site is TT, the wheat being tested has a salt-sensitive genotype. This invention, based on the aforementioned SNP molecular marker, can be used for wheat salt tolerance detection or identification. It can be applied to marker-assisted breeding, enabling rapid screening of salt-tolerant genotype individuals during the wheat seedling stage, significantly shortening the breeding cycle and improving breeding efficiency, laying the foundation for screening salt-tolerant germplasm resources and cultivating new salt-tolerant wheat varieties. Attached Figure Description

[0016] Figure 1 The image shows a Manhattan plot of the genome-wide association analysis of wheat salt tolerance. The horizontal axis represents the chromosome location of each SNP, and the vertical axis represents the negative logarithm of the P-value of each SNP in the MLM model, base 10. RAC875_c26057_370 is a significant SNP. Figure 2 The QQ plot represents the genome-wide association analysis of wheat salt tolerance. The horizontal axis represents the negative logarithm of the expected SNP site P-value to base 10, and the vertical axis represents the negative logarithm of the actual SNP site P-value to base 10. Figure 3 The KASP genotyping diagram shows that red dots represent the TT genotype, blue dots represent the CC genotype, and green dots represent the TC genotype. Figure 4 A violin diagram showing the D values ​​of three genotypes in wheat. Detailed Implementation

[0017] This invention provides an SNP molecular marker that is significantly associated with wheat salt tolerance. The SNP is a DNA fragment with a nucleotide sequence as shown in SEQ ID NO:1, in which a C / T polymorphism exists at position 101.

[0018] In this invention, the SNP molecular marker is located in the CDS region of the TraesCS7B02G466300 gene on the wheat chromosome 7B in the reference genome (IWGSC RefSeq v2.1), at position 723901993 on chromosome 7B.

[0019] This invention provides KASP primers for amplifying the SNP molecular marker, including KASP-F1, KASP-F2 and the universal primer KASP-R; The nucleotide sequence of the KASP-F1 is shown in SEQ ID NO:2; The nucleotide sequence of the KASP-F2 is shown in SEQ ID NO:3; The nucleotide sequence of the universal primer KASP-R is shown in SEQ ID NO:4.

[0020] This invention does not impose any special restrictions on the source of the KASP primers; any source of KASP primers well-known in the art may be used. In this embodiment of the invention, the KASP primers were synthesized by Invitrogen (Shanghai) Trading Co., Ltd.

[0021] This invention provides a wheat salt tolerance detection kit, including the KASP primers.

[0022] In this invention, the kit preferably further includes 2×Master mix. In this embodiment, the 2×Master mix is ​​purchased from Sangon Biotech (Shanghai) Co., Ltd. The kit preferably also includes DNA extraction reagents. This invention does not impose any special limitations on the type of DNA extraction reagents; any plant genomic DNA extraction kit well-known in the art or reagents for CTAB extraction can be used. This invention provides the application of the KASP primers or the kit in detecting wheat salt tolerance, screening salt-tolerant wheat materials, or breeding salt-tolerant wheat.

[0023] In this invention, the method for determining the salt tolerance of wheat, screening salt-tolerant wheat materials, or breeding salt-tolerant wheat is preferably based on the genotype of the SNP molecular marker of wheat to determine the salt-tolerant wheat variety: when the genotype of the SNP molecular marker is CC, the sample to be tested is a salt-tolerant wheat material; when the genotype of the SNP molecular marker is TT, the sample to be tested is a salinity-sensitive wheat material.

[0024] This invention does not impose any special restrictions on the type of wheat used; any wheat variety commonly cultivated in the art can be employed. This invention also provides a salt-tolerant wheat variety whose genome contains the SNP molecular marker with genotype CC.

[0025] This invention provides a method for detecting the salt tolerance of wheat, comprising the following steps: Using the genomic DNA of the wheat material to be tested as a template, PCR amplification was performed using the KASP primers, and the salt tolerance of wheat was determined based on the genotype of the PCR product. When the genotype of the SNP molecular marker is CC, the sample to be tested is a salt-tolerant wheat material; When the genotype of the SNP molecular marker is TT, the sample to be tested is a salinity-sensitive wheat material.

[0026] This invention uses the genomic DNA of the wheat material to be tested as a template, performs PCR amplification using the KASP primers, and determines the salt tolerance of wheat based on the genotype of the PCR product.

[0027] In this invention, the wheat material to be tested preferably includes material from any of the following stages: wheat seed, wheat seedling, wheat tillering stage, wheat overwintering stage, wheat greening stage, wheat tillering stage, wheat jointing stage, wheat booting stage, wheat heading stage, wheat flowering stage, wheat grain filling stage, and wheat maturity stage.

[0028] This invention does not impose any particular limitation on the wheat variety used; any wheat variety well-known in the art can be used. Similarly, this invention does not impose any particular limitation on the method for extracting the genomic DNA from the wheat to be tested; any commercially available kit well-known in the art or the CTAT method can be used.

[0029] In this invention, the preferred PCR amplification reaction program is as follows: denaturation phase: 95℃, 15 min; amplification phase: 94℃ for 20 s, 61~55℃ for 60 s, gradient annealing, decreasing by 0.6℃ per cycle, 10 cycles; fluorescence signal amplification phase: 94℃ for 20 s, 55℃ for 60 s, 26 cycles. The PCR amplification reaction system is not particularly limited and any PCR amplification system well-known in the art can be used.

[0030] In this invention, the method for determining the genotype of the wheat material to be tested is based on the following: when the polymorphic site of the SNP molecular marker in the sequencing data of the PCR product is only C, the genotype is CC; when it is only T, the genotype is TT; and when both C and T detection peaks are present, the genotype is CT.

[0031] In this invention, the efficiency of KASP markers was validated using 94 germplasm resources. Of these, 47 accessions had the TT genotype (D value range 0.22-0.40), 11 accessions had the TC genotype (D value range 0.44-0.52), and 36 accessions had the CC genotype (D value range 0.55-0.69). The D value represents the comprehensive evaluation of salt tolerance of wheat varieties under salt stress, and wheat salt tolerance is directly proportional to the D value. The results showed that when the polymorphic site of the SNP marker was C, wheat exhibited significantly enhanced salt tolerance, while when the polymorphic site was T, wheat salt tolerance was significantly reduced.

[0032] The following detailed description, in conjunction with embodiments, illustrates an SNP molecular marker significantly associated with wheat salt tolerance, its KASP primers for amplification, and its applications. However, these descriptions should not be construed as limiting the scope of protection of this invention.

[0033] The wheat material used in this invention was provided by the Hebei Provincial Key Laboratory of Drought-Alkali Wheat (Cangzhou Academy of Agricultural and Forestry Sciences, Institute of Crop Genetics and Breeding). All biochemical reagents used in this invention are commercially available.

[0034] Example 1 Genome-wide association study of wheat salt tolerance (1) Test materials A natural genetic population was constructed using 275 wheat germplasm resources from different regions with significant differences in genetic background (see Table 1). This population showed significant differences in salt tolerance and was suitable for genome-wide association analysis of salt tolerance-related traits.

[0035] Table 1 275 wheat germplasm resources

[0036] (2) Material planting 275 natural population materials and 94 validation materials were planted at the Xihuayuan Experimental Station of Cangzhou Academy of Agricultural and Forestry Sciences in 2023-2024. The field experiment adopted a randomized block design with 3 replicates, with a row length of 2 m, a row spacing of 25 cm, and a plant spacing of 10 cm. Other management was the same as in a general field.

[0037] (3) Determination of salt tolerance After spring wheat greening and soil salinization, fresh leaves from three randomly selected plants of each variety were measured for physiological indicators such as SOD, POD, MDA, and soluble sugar content. Related traits throughout the wheat's growth period were also measured, including emergence rate, tillering rate, plant height, length of the internode below the ear, ear length, single ear weight, number of grains per ear, thousand-grain weight, and yield. Salt tolerance coefficients for each indicator were then calculated. The D-value for each variety was calculated using the membership function method: salt tolerance coefficients were calculated using Formula I, membership function values ​​using Formula II, and D-values ​​using Formula III. Finally, the D-values ​​were used as phenotypic data for GWAS analysis.

[0038] Salt tolerance coefficient = (treated value / control value) × 100% (Formula I) U(X) j ) = X j -X min / X max -X min Formula II; Where X j Let X represent the j-th comprehensive index, where j = 1, 2, ..., n; min X represents the minimum score of each trait on the principal component. max U(X) represents the maximum score of each trait on the principal component; j ) represents the membership function value.

[0039] D= Formula III; The D value represents the comprehensive evaluation value of the salt tolerance of wheat varieties under salt stress. The salt tolerance of wheat is directly proportional to the size of the D value. The salt tolerance of wheat varieties is classified according to the D value. U(Xj) represents the membership function value of each trait. Wj represents the weight value of the j-th principal component.

[0040] Using Origin2024, a hierarchical cluster analysis was performed on the D-values, classifying 275 wheat varieties into 5 categories: strongly salt-tolerant, moderately salt-tolerant, salt-tolerant, salt-sensitive, and extremely salt-sensitive. Among them, there were 2 strongly salt-tolerant varieties, 17 moderately salt-tolerant varieties, 86 salt-tolerant varieties, 159 salt-sensitive varieties, and 11 extremely salt-sensitive varieties.

[0041] Table 2. D values ​​of 275 wheat germplasm resources

[0042] (4) Genome-wide association analysis and identification of SNP molecular markers Based on the above-measured wheat salt tolerance indices, and using the wheat comprehensive salt tolerance assessment index D value as phenotypic data, genome-wide association analysis was performed using the mixed linear model (PCA+K) in the GAPIT package. The P-value threshold was calculated according to the method described by Li et al. (P=1 / n, n=total number of SNPs used), and the criterion for identifying significant SNPs was -log10P>3. Manhattan plots and QQ plots were constructed using TASSEL software to visualize the loci. The results showed that a SNP molecular marker RAC875_c26057_370 located on chromosome 7B was significantly associated with wheat salt tolerance. This marker is located at position 723901993 of the TraesCS7B02G466300 gene, and the SNP site represents a difference in the C / T base ratio.

[0043] The SNP molecular marker sequence is shown in SEQ ID NO:1: TGAAACTGAGGTATTCTTGCTTTGGTCATTACCTCGGAAGTCAGTGTTTGGTAGCTTCACAAACATCTCCTGCCCATCACAACTAGGATTGAATTTCGGC [C / T] TGCAACCTTGGCTCCTATCATTTGGGTCGATGATCTCATATCCAGGGGCACATGCACAAGAAGGCCTAGGTGTATACACACATATTCCATTCATACCACA. Note: The underlined positions are polymorphic sites.

[0044] Example 2 (1) KASP marker development and primer design KASP marker primers were designed based on the flanking sequence of the SNP molecular marker RAC875_c26057_370. Specific primer ZYJ-KASP-F1: 5'-GAAGGTGACCAAGTTCATGCTAACTAGGATTGAATTTCGGCC-3' (SEQ ID NO: 2); Specific primer ZYJ-KASP-F2: 5'-GAAGGTCGGAGTCAACGGATTACAACTAGGATTGAATTTCGGCT-3' (SEQ ID NO:3); Universal primer ZYJ-KASP-R: 5'-GACCCAAATGATAGGAGCCAAG-3' (SEQ ID NO:4).

[0045] (2) KASP detection DNA was extracted from 1g of wheat leaves using the Ezup column-based super plant genomic DNA extraction kit, and its purity was tested. Samples that met the standards were diluted to a concentration range of 5-50ng, and then subjected to PCR reaction. The reaction system is shown in Table 3. After the DNA was aliquoted into the PCR reaction container, it needed to be dried. The drying method varied depending on the system used. On the LGC platform, the aliquoted DNA was placed in an oven at 65℃ for 30 minutes until the DNA was completely dry. On the Dougas system, the DNA was dried by the two drying modules built into the Nexar.

[0046] Table 3 KASP detection PCR reaction system

[0047] PCR reaction program: 94℃, 15 min; 94℃, 20 s, 61-55℃, 60 s, gradient annealing (decreasing by 0.6℃ per cycle), 10 cycles; fluorescence signal amplification stage: 94℃, 20 s, 55℃, 60 s; 26 cycles. If the genotyping is not obvious, 3-5 more cycles can be added for amplification.

[0048] After the KASP PCR reaction procedure was completed, the 96-well plate was placed on an Omega fluorescence signal reader and Araya to convert the fluorescence signal into analyzable values. Genotyping analysis was then performed using Kraken™ software provided by LGC. After the reaction, the reaction products were sequenced for genotyping identification. The results showed SNP site variations such as… Figure 3 As shown, this marker can accurately and clearly cluster experimental materials with the same genotype, while the negative control NTC does not produce a signal and always clusters together. This marker is effective in distinguishing different genotypes.

[0049] (3) KASP tag verification The efficiency of KASP markers was validated using 94 germplasm resources. Among them, 47 materials had the TT genotype with D values ​​ranging from 0.22 to 0.40; 11 materials had the TC genotype with D values ​​ranging from 0.44 to 0.52; and 36 materials had the CC genotype with D values ​​ranging from 0.55 to 0.69.

[0050] Table 4. D-values ​​and genotypes of 94 wheat germplasm resources

[0051] In summary, this invention, through genome-wide association analysis, identified the SNP molecular marker RAC875_c26057_370, which is significantly associated with wheat salt tolerance. This SNP marker is located in the TraesCS7B02G466300 gene on wheat chromosome 7B, at nucleotide position 723901993, where a C / T polymorphism exists. When the base at this site is C, wheat exhibits significantly enhanced salt tolerance; when it is T, wheat exhibits significantly reduced salt tolerance. This invention also provides specific primer pairs and detection methods for this SNP molecular marker. Applying these methods to wheat salt tolerance identification and marker-assisted breeding allows for rapid screening of salt-tolerant genotypes during the wheat seedling stage, improving the accuracy of target material selection.

[0052] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A SNP molecular marker significantly associated with salt tolerance in wheat, characterized in that, The DNA fragment has a nucleotide sequence as shown in SEQ ID NO:1, and a C / T polymorphism exists at position 101 of the DNA fragment.

2. A KASP primer for amplifying the SNP molecular marker of claim 1, characterized in that, Including KASP-F1, KASP-F2, and the universal primer KASP-R; The nucleotide sequence of the KASP-F1 is shown in SEQ ID NO:2; The nucleotide sequence of the KASP-F2 is shown in SEQ ID NO:3; The nucleotide sequence of the universal primer KASP-R is shown in SEQ ID NO:

4.

3. A wheat salt tolerance test kit, characterized in that, Includes the KASP primers as described in claim 2.

4. The wheat salt tolerance test kit according to claim 3, characterized in that, It also includes 2×Master mix.

5. The wheat salt tolerance test kit according to claim 3, characterized in that, It also includes DNA extraction reagents.

6. The application of the KASP primers of claim 2 or the kit of any one of claims 3 to 5 in detecting wheat salt tolerance, screening salt-tolerant wheat materials, or breeding salt-tolerant wheat.

7. The application according to claim 6, characterized in that, Salt-tolerant wheat varieties can be identified based on the genotype of the SNP molecular marker: when the genotype of the SNP molecular marker is CC, the sample to be tested is a salt-tolerant wheat material; when the genotype of the SNP molecular marker is TT, the sample to be tested is a salt-sensitive wheat material.

8. A method for detecting the salt tolerance of wheat, characterized in that, Includes the following steps: Using the genomic DNA of the wheat material to be tested as a template, PCR amplification was performed using the KASP primers described in claim 2. The salt tolerance of wheat was determined based on the genotype of the PCR product. When the genotype of the SNP molecular marker is CC, the sample to be tested is a salt-tolerant wheat material; When the genotype of the SNP molecular marker is TT, the sample to be tested is a salinity-sensitive wheat material.

9. The detection method according to claim 8, characterized in that, The wheat materials to be tested include materials from any of the following stages: wheat seeds, wheat seedlings, wheat tillering stage, wheat overwintering stage, wheat greening stage, wheat tillering stage, wheat jointing stage, wheat booting stage, wheat heading stage, wheat flowering stage, wheat grain filling stage, and wheat maturity stage.

10. The detection method according to claim 8 or 9, characterized in that, The PCR amplification reaction procedure was as follows: denaturation phase: 95℃, 15min; Amplification phase: 94℃ for 20s, 61-55℃ for 60s, gradient annealing, decreasing by 0.6℃ per cycle, 10 cycles; Fluorescence signal amplification phase: 94℃ for 20s, 55℃ for 60s, 26 cycles.

Images