A specific snp marker for identifying cigar types within nicotiana and uses thereof

Abstract

The application discloses a specific SNP marker for identifying cigar types in the genus Nicotiana and application thereof. A nucleotide sequence of a PCR amplification product of the specific SNP marker comprises a sequence as shown in SEQ ID No. 1. The specific SNP marker for identifying cigar types in the genus Nicotiana has the characteristics of stability, reliability, simplicity and low cost, and the molecular marker can effectively identify and detect whether there is a cigar type variety in the genus Nicotiana.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to a specific SNP marker for identifying cigar types within the Tobacco genus and its application. Background Technology

[0002] Tobacco is a leaf-based economic crop. According to the characteristics of tobacco leaf quality, biological traits, and cultivation and processing methods, it can be divided into five types: flue-cured tobacco, cigar tobacco, aromatic tobacco, burley tobacco, and sun-cured tobacco. Each type of tobacco has a large number of cultivated varieties selected according to production and processing needs.

[0003] It is a widely accepted consensus in the industry that cigars and cigar tobacco originated in the Americas and spread to countries around the world in the 16th century. Cigars can be further classified into three subcategories based on processing methods and intended use: wrapper, filler, and binder. Each of these three types of tobacco must possess its own characteristics: filler tobacco is aromatic and has a coarser texture; binder tobacco has a fine and elastic texture; and wrapper tobacco has good oil content, a fine texture, elasticity, good combustibility, and a lighter color. Cigars have specific cultivation requirements; tobacco grown in conditions of abundant cloud cover and low sunlight produces the best quality leaves. Leaves grown in these conditions are wide, with the lower and middle parts becoming thinner and lighter after drying. The veins are fine, the texture is delicate, and the leaves are highly elastic. The color is a uniform grayish-brown or brown, and the leaves burn well. These leaves are suitable for use as wrappers and are therefore often grown under shade. Major cigar producing countries include Cuba, the Philippines, Indonesia, and the United States. In my country, cigars are mainly produced in Sichuan and Zhejiang provinces, with Sichuan producing the largest quantity, while the quality is considered superior to that produced in Tongxiang, Zhejiang. Currently, research on cigars is relatively limited and mainly focuses on the chemical indicators such as flavor and taste of rolled cigars, while research on the biological aspects of cigars is extremely scarce.

[0004] Numerous studies have been reported on the molecular-level differentiation / identification of tobacco resources (varieties). These studies utilize markers such as RFLP, RAPD, SSR, ISSR, DArT, and SNP, or combinations thereof, to conduct genetic diversity analysis and fingerprinting of specific varieties (resources) within the *Tobacco* genus. A few studies have also been reported on the rapid identification of newly flue-cured tobacco varieties using SSR, SCAR, and RAPD markers, given that the sample is known to be tobacco material. Furthermore, patents have been reported on the use of molecular markers to differentiate / identify a limited number of tobacco varieties. However, these studies and reports all focus on differentiation or identification between varieties (resources) within the *Tobacco* genus, and cannot perform specific identification of different tobacco types within the genus. In other words, to date, there are no reports, domestically or internationally, on the molecular-level identification and detection of cigar tobacco types versus non-cigar tobacco types (flue-cured, aromatic, burley, and sun-cured tobacco) within the *Tobacco* genus.

[0005] Therefore, there is an urgent need to provide a simple, rapid, and stable specific SNP marker for identifying cigar types within the Tobacco genus. Summary of the Invention

[0006] In response to the shortcomings of existing technologies and practical needs, this invention provides a specific SNP marker for identifying cigar types within the Tobacco genus and its application, which enables simple, rapid, and stable identification of cigar types within the Tobacco genus.

[0007] To achieve this objective, the present invention adopts the following technical solution: In a first aspect, the present invention provides a specific SNP marker for identifying cigar types within the genus Tobacco, wherein the nucleotide sequence of the PCR amplification product of the specific SNP marker includes the sequence shown in SEQ ID No. 1.

[0008] This invention is the first to screen and obtain the SNP marker Csnp001, which can specifically identify cigar types, filling the gap in molecular identification technology for cigar types within the Tobacco genus.

[0009] Preferably, the primer nucleotide sequences used to amplify the specific SNP marker include sequences as shown in SEQ ID No. 2-SEQ ID No. 3.

[0010] The sequence SEQ ID No. 1 of the SNP marker Csnp001: ATTATTAATTGTACACGTAATACTCTAACCAATATTTGACTGTAGATGTAGTGGAACCATTAATAGGCAGAAGCCTATCTTTAAAGAATTAAGGTGATGGACCACACAAATGGGATTCATTGATCAATAGACTGATAACTACGTTAGGAGGTGTTATTTGACATTCCTACATAGGCCTTCTCAGTCTGGTGAGGATCTTAGGCTAACAACTTTATTTATAAATTGCTAAA.

[0011] SEQ ID No. 2: ATTATTAATTGTACACGTAATACTC.

[0012] SEQ ID No. 3: TTTAGCAATTTATAAATAAAGTTGTT.

[0013] Secondly, the present invention provides the application of the specific SNP markers described in the first aspect for identifying cigar types within the tobacco genus in the identification of tobacco varieties.

[0014] Thirdly, the present invention provides a method for identifying tobacco varieties, the method comprising: extracting genomic DNA from a tobacco sample to be tested; using the extracted genomic DNA as a template, performing PCR amplification using the primers described in the first aspect; detecting the PCR amplification product; determining the type of the tobacco sample to be tested based on the detection results; if the PCR amplification product contains the sequence shown in SEQ ID NO.1 (PCR amplification product size is 230 bp), it indicates that the tobacco sample to be tested is a cigar type variety; if no PCR amplification product is generated, it indicates that the tobacco sample to be tested is a non-cigar type variety.

[0015] Preferably, the annealing temperature for the PCR amplification is 50℃-55℃, for example, 50℃, 52℃ or 55℃.

[0016] Preferably, the detection includes polyacrylamide gel electrophoresis or capillary electrophoresis.

[0017] Preferably, the non-cigar tobacco types include any one or a combination of at least two of flue-cured tobacco, aromatic tobacco, burley tobacco, and sun-cured tobacco.

[0018] Fourthly, the present invention provides a kit for identifying cigar types within the genus *Tobacco*, the kit comprising the primers described in the first aspect.

[0019] Preferably, the kit further includes dNTPs, Taq DNA polymerase, PCR buffer, and Mg. 2+ Solution.

[0020] Fifthly, the present invention provides the application of the specific SNP markers for identifying cigar types within the genus Tobacco as described in the first aspect or the kit described in the fourth aspect in tobacco breeding.

[0021] Compared with the prior art, the present invention has the following beneficial effects: (1) Existing molecular marker technologies are all aimed at differentiating different varieties within the genus Tobacco, but cannot achieve specific identification of different tobacco types (flue-cured tobacco, cigar tobacco, aromatic tobacco, burley tobacco, sun-cured tobacco) within the genus Tobacco. This invention is the first to screen and obtain the SNP marker Csnp001 that can specifically identify cigar tobacco types, filling the gap in molecular identification technology for cigar tobacco types within the genus Tobacco. (2) Unlike conventional molecular markers that require the difference in the size of amplified products to distinguish different varieties (which requires comparison with multiple standards), the SNP marker Csnp001 of this invention adopts a "present / absent" judgment method: the presence of the 230 bp amplified product shown in SEQ ID NO.1 indicates a cigar type, while the absence of an amplified product indicates a non-cigar type (including flue-cured tobacco, aromatic tobacco, burley tobacco and sun-cured tobacco). This judgment method is simpler and more intuitive, without the need for complex comparison and result interpretation, which greatly reduces the operational threshold and the risk of misjudgment. (3) The present invention was verified by 156 germplasm resources covering all 5 types of tobacco (including 36 flue-cured tobacco, 30 cigar tobacco, 30 aromatic tobacco, 30 burley tobacco and 30 sun-cured tobacco). The marker amplified the target band of 230bp only in 30 cigar tobacco varieties, and no amplification products were found in the remaining 126 non-cigar tobacco varieties, showing 100% specificity and accuracy. (4) Based on whole-genome resequencing data of 2101 large-scale tobacco germplasm resources, this invention uses a self-developed AI algorithm software (pick_snps_for_A.py) to screen specific SNP sites. The screening strategy is scientific and rigorous, and the data foundation is solid and reliable, ensuring the stability and representativeness of the markers. Attached Figure Description

[0022] Figure 1 PAGE plot of the cigar type-specific SNP marker Csnp001 in 156 tobacco resources, where lanes 1-36 represent 36 flue-cured tobacco varieties / resources; lanes 37-66 represent 30 cigar tobacco varieties / resources; lanes 67-96 represent 30 aromatic tobacco varieties / resources; lanes 97-126 represent 30 burley tobacco varieties / resources; and lanes 127-156 represent 30 sun-cured tobacco varieties / resources. Note: Each PAGE gel has 48 lanes (48 samples). The rightmost lane of the PAGE gel is the 100 bp marker. From bottom to top, these are 200, 300, 400, 500, 600, 700, 800, 900, 1000 and 1500 bp. The sampling order is from left to right. A total of 156 samples were sampled from 4 PAGE gels (48 samples / pAGE gel × 3 gels + 12 samples / 4th PAGE gel). Detailed Implementation

[0023] To further illustrate the technical means and effects of this invention, the following description, in conjunction with embodiments and accompanying drawings, provides a further explanation of the invention. It is understood that the specific embodiments described herein are merely illustrative of the invention and not intended to limit it.

[0024] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0025] Example 1 This embodiment screens for cigar type-specific SNP markers.

[0026] I. Experimental Materials The 2101 tobacco germplasm resources and their resequencing data were provided by the Yunnan Academy of Tobacco Agricultural Sciences. The 2101 tobacco germplasm resources include 1320 flue-cured tobacco varieties / resources, 321 sun-cured tobacco varieties / resources, 165 cigar tobacco varieties / resources, 129 aromatic tobacco varieties / resources, and 166 burley tobacco varieties / resources.

[0027] II. Processing of Genome Resequencing Data The raw genome resequencing data of the above 2101 tobacco germplasm resources were filtered and processed according to the standard processing method for raw data to remove adapter contamination and low-quality reads, resulting in high-quality Clean Data for subsequent comparative analysis.

[0028] III. Detection of SNP variant information SNP variant detection was performed on the 2101 resource datasets processed above using the GATK (GATK 4.2.0) workflow. First, the "HaplotyperCaller" tool was used to detect individual SNP variants in the alignment results files after quality control processing, obtaining a gVCF file for each chromosome in each sample (specific parameters: gatk HaplotyperCaller --sample-ploidy 2 –emit-ref-confidence GVCF –min-base-quality-score 20). Second, the "GeomicsDBImport" tool was used to merge the gVCF files of all samples (merging parameters: gatkGenomicsDBImport --batch-size 120 –reader-threads 40 --genomicsdb-workspace-path chr01 --intervals). Finally, the "GenotypeGVCFs" tool was used to integrate the variant information for each chromosome of all individuals in the resource population, generating a vcf format file of the population variant (including SNP and Indel variants) results.

[0029] IV. SNP Locus Statistics and Preliminary Quality Control First, the "Select Variants" and "Variant Filtration" functions in the GATK workflow were used to extract and filter SNP variants, obtaining highly reliable population variant information. Second, based on the requirements of allotetraploid tobacco mating types, PLINK2 was used to filter population SNP variants, selecting high-quality variants that met the requirements. Then, PLINK2 was used to filter samples with a genotype deletion rate greater than 0.2, resulting in the rejection of 59 samples and leaving 2042 samples. Finally, quality control was performed based on a minimum allele frequency (MAF) greater than 0.01 and an SNP deletion rate less than 0.2, yielding a total of 5,810,283 SNP loci from the 2042 samples (the number of variant loci before quality control was 59,922,554). Statistical analysis of the SNP distribution on each chromosome revealed that chromosome 4 had the most SNPs, totaling 1,431,101; followed by chromosome 23 with 518,263 SNPs; chromosome 3 had 411,986 SNPs; and the remaining chromosomes had fewer SNPs, all below 210,000.

[0030] V. Screening of Cigar Type-Specific SNP Sites 1. Screening of homogeneous SNP sites within cigar types Using the SNP locus information obtained after quality control of the resequencing data of the above 2042 tobacco germplasm resources, cigar type-specific SNP loci were screened. The specific method is as follows: Within each cigar type, all samples (varieties / resources) were screened for SNPs at which the genotypes were completely identical. Specifically, to screen for cigar type-specific SNPs, firstly, 165 cigar varieties / resources were screened for identical SNPs. Secondly, resequencing data from the remaining 1877 non-cigar resource materials (2042-165) were compared to the identical SNPs found in the 165 cigar varieties / resources. This further allowed for the identification of SNPs present in the cigar resource materials but absent in the remaining 1877 non-cigar resource materials (i.e., ensuring that all 165 cigar resource materials possess the same SNP while the remaining 1877 non-cigar resource materials do not). To ensure the stability and interpretability of the screened sites, this invention only considers homozygous reference genotypes (0 / 0) and homozygous non-reference genotypes (1 / 1), excluding heterozygous genotypes (0 / 1 or 1 / 0) from the analysis. For example, when the genotype of the 301st base site on Chr07 is 0 / 0 or 1 / 1 in all 165 cigar type samples, the site is defined as a cigar type consistent SNP site and is preserved.

[0031] After the above screening process, a VCF subset file of consistent SNPs within a cigar type was finally obtained, which contains 4179 consistent SNP sites of cigar type, as the basis data for subsequent screening of cigar type-specific SNPs.

[0032] 2. Redundancy removal processing for cigar type samples Since the SNP loci obtained from the above screening are genotypes completely identical in the corresponding 165 cigar type samples (variety / resource), to avoid sample redundancy affecting subsequent comparative analysis, it is necessary to perform sample deduplication on the VCF subset of consistent SNPs within the cigar type. Specifically, in the cigar type consistent SNP subset, 4179 SNP loci are genotypes completely identical in the 165 cigar samples, and only one sample is retained as the representative of the cigar type.

[0033] 3. Screening of cigar type-specific SNP sites After completing the screening of consistent sites within cigar types and the sample redundancy removal process, the AI ​​algorithm-based software (pick_snps_for_A.py) developed in this invention was further run on the obtained VCF data. This software can systematically compare all SNP sites in all 2042 tobacco samples (variety / resource) to screen out cigar type-specific SNP sites.

[0034] The pick_snps_for_A.py program is described in detail below: (1) Method name: A greedy algorithm for identifying the minimum SNP combination to distinguish target samples.

[0035] (2) Overview of the method's functions: This method is used to screen a set of minimal SNP loci combinations for a specified target sample (Sample A) in population genotyping data, ensuring that its genotyping pattern is distinguishable from all other samples. This method can identify a single SNP that uniquely distinguishes a sample, or it can achieve distinction through combinations of multiple SNPs when no single SNP exists.

[0036] (3) Input file: a. gt.tsv A genotype matrix file exported from a VCF file, generated using bcftools query, has the following format: ; Genotypes are in VCF standard format (e.g., 0 / 0, 0 / 1, 1 / 1, 0|1), and missing genotypes are represented by ., . / ., or .|. No header is required.

[0037] b. samples.list The sample name list file contains one sample name per line, and the order must match the order of the sample columns in gt.tsv.

[0038] c. Target sample name (SampleA) Specify the target samples that need to be distinguished. In this invention, the target samples are the representative samples of cigar types retained after redundancy removal in each VCF subset.

[0039] (4) Operating mode: ; Parameter description: gt.tsv: Genotype matrix file; samples.list: Sample list; SampleA: Target sample; 100 (optional): Maximum number of SNPs to select (default 100).

[0040] (5) Output results (example): # Greedy SNP panel to distinguish A from all others # A = C1593 # panel_size = 3 # unresolved_samples = 0 # SNP_panel_for_A (CHROM POS REF ALT): chr2 127086134 CT chr14 40123703 CT chr11 28771852 AT This result indicates that the three SNPs output are the smallest combination that distinguishes sample C1593 from all other samples.

[0041] When no SNP combination exists that can completely and specifically distinguish the target sample (Sample A), the program will further filter and output the SNP combination that can best differentiate the target sample from other samples. Simultaneously, the program will explicitly list the names of samples that still cannot be distinguished from Sample A under this combination condition, as shown below: # Greedy SNP panel to distunguish A from all others # A = C1154 # panel_size = 8 # unresolved_samples = 3 # SNP_panel_for_A (CHROM POS REF ALT): chr20 100753228 TG chr24 118262985 TC chr2 140985572 GA chr1 127865724 CT chr6 109728181 CT chr4 69907409 TC chr10 21107328 GT chr24 110031763 GC # WARNING: could not fully distinguish A using current candidates. # unresolved_sample_names: # C1702 # C1890 # C1971 4. Sequence extraction flanking cigar type-specific SNP marker sites For the cigar type-specific SNP sites obtained in the final screening, 300 bp sequences upstream and downstream of the site were extracted from the NtaSR1 reference genome to form a 601 bp sequence fragment containing the SNP site, which was used for the design of primers for cigar type-specific SNPs.

[0042] VI. Experimental Verification of Cigar Type-Specific SNP Markers 1. Materials A total of 156 tobacco materials were used for the verification of type-specific SNP markers for cigars, including 36 flue-cured tobacco materials (numbered 1-36), 30 cigar tobacco materials (numbered 37-66), 30 aromatic tobacco materials (numbered 67-96), 30 burley tobacco materials (numbered 97-126), and 30 sun-cured tobacco materials (numbered 127-156). Detailed information is shown in Table 1.

[0043] Table 1 2. SNP marker analysis Tobacco genomic DNA extraction: The plant tissue DNA extraction kit (TaKaRa MiniBEST Universal Genomic DNA Extraction Kit Ver.5.0; Takara Bio Engineering (Dalian) Co., Ltd.) was used, and the method was in accordance with the instructions in the kit.

[0044] PCR amplification and electrophoresis detection: The PCR amplification system was based on the published literature (Tong Zhijun, Jiao Fangchan, Xiao Bingguang. SSR locus analysis of common tobacco and its ancestral species genome. Chinese Journal of Agricultural Science, 2015, 48(11): 2108-2117.); In the PCR amplification program, the annealing temperature of the primers (SEQ ID NO.2-SEQ ID NO.3) was 52℃, and the PCR amplification program was based on the literature (Tong Zhijun, Jiao Fangchan, Xiao Bingguang. SSR locus analysis of common tobacco and its ancestral species genome. Chinese Journal of Agricultural Science, 2015, 48(11): 2108-2117.); Electrophoresis detection was based on the literature (Sanguinetti CJ, Dias NE, Simpson AJ. Rapid silver staining and recovery of PCR products separated on polyacrylamide gels). Biotechniques , 1994, 17: 915-919.).

[0045] 3. Detection of cigar type-specific SNP markers in 156 tobacco samples for cigar type identification. Using the primer sequences (SEQ ID NO.2-SEQ ID NO.3) of the cigar type-specific SNP marker Csnp001 of this invention, genomic DNA of 156 tobacco materials were amplified by PCR, and the size and presence of the PCR amplification products were analyzed. If the PCR amplification product contained the sequence shown in SEQ ID NO.1 (the size of the PCR amplification product was 230 bp), it indicated that the tested tobacco was a cigar type variety; if no PCR amplification product was generated, it indicated that the tested tobacco was a non-cigar type variety.

[0046] Because the 156 tobacco samples tested included all five tobacco types—flue-cured, cigar, aromatic, burley, and sun-cured—only 30 samples of the cigar type were detected by PCR amplification using the cigar type-specific SNP marker Csnp001. Figure 1The PCR amplification products (lanes 37-66) obtained the sequence shown in SEQ ID NO.1 (PCR amplification product size is 230 bp), as shown in SEQ ID NO.1. Figure 1 As shown; while the remaining 126 samples of other types of tobacco varieties ( Figure 1 Lanes 1-36 and 67-156 in the sample showed no PCR amplification products. No products were observed during PCR amplification. Figure 1 As shown.

[0047] Analysis of the PCR amplification products of 156 different types of tobacco materials by the above-mentioned cigar type-specific SNP marker Csnp001 shows that the cigar type-specific SNP marker provided by the present invention has the specificity to distinguish cigar types within the Tobacco genus. It can not only scientifically and accurately identify and detect cigar types within the Tobacco genus from other tobacco types, but also has the characteristics of being stable, reliable, simple, fast and low cost.

[0048] In summary, the specific SNP marker for identifying cigar types within the Tobacco genus described in this invention is stable, reliable, simple, and low-cost. This molecular marker can effectively identify and detect the presence of cigar types within the Tobacco genus.

[0049] The applicant declares that the detailed method of the present invention is illustrated by the above embodiments, but the present invention is not limited to the above detailed method, that is, it does not mean that the present invention must rely on the above detailed method to be implemented. Those skilled in the art should understand that any improvements to the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific methods, etc., all fall within the protection scope and disclosure scope of the present invention.

Claims

1. A specific SNP marker for identifying cigar types within the Tobacco genus, characterized in that, The nucleotide sequence of the PCR amplification product of the specific SNP marker includes the sequence shown in SEQ ID No.

1.

2. The specific SNP marker according to claim 1, characterized in that, The primer nucleotide sequences used to amplify the specific SNP marker include those shown in SEQ ID No. 2-SEQ ID No.

3.

3. The application of the specific SNP marker for identifying cigar types within the tobacco genus as described in claim 1 or 2 in the identification of tobacco varieties.

4. A method for identifying tobacco varieties, characterized in that, The method for identifying tobacco varieties includes: extracting genomic DNA from the tobacco sample to be tested; using the extracted genomic DNA as a template, performing PCR amplification using the primers described in claim 2; detecting the PCR amplification product; determining the type of the tobacco sample to be tested based on the detection results; if the PCR amplification product contains the sequence shown in SEQ ID NO.1, it indicates that the tobacco sample to be tested is a cigar type variety; if no PCR amplification product is generated, it indicates that the tobacco sample to be tested is a non-cigar type variety.

5. The method for identifying tobacco varieties according to claim 4, characterized in that, The annealing temperature for the PCR amplification is 50℃-55℃.

6. The method for identifying tobacco varieties according to claim 4 or 5, characterized in that, The detection includes polyacrylamide gel electrophoresis or capillary electrophoresis.

7. The method for identifying tobacco varieties according to any one of claims 4-6, characterized in that, The non-cigar tobacco types include any one or a combination of at least two of the following: flue-cured tobacco, aromatic tobacco, burley tobacco, and sun-cured tobacco.

8. A reagent kit for identifying cigar types within the genus *Tobacco*, characterized in that, The kit includes the primers described in claim 2.

9. The reagent kit according to claim 8, characterized in that, The kit also includes dNTPs, Taq DNA polymerase, PCR buffer, and Mg. 2+ Solution.

10. The application of the specific SNP marker for identifying cigar types within the Tobacco genus as described in claim 1 or 2, or the kit as described in claim 8 or 9, in tobacco breeding.

Images