Rt-rpa-lfd primer set for detecting allium fistulosum x disease virus, detection method and application thereof
By using RT-RPA-LFD technology, a specific primer set was designed for rapid detection of Rehmannia glutinosa virus X, which solves the problems of complex detection and long detection time in existing technologies, and achieves rapid, sensitive and specific detection results, making it suitable for grassroots units and field applications.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- INST OF PLANT PROTECTION HENAN ACAD OF AGRI SCI
- Filing Date
- 2026-04-17
- Publication Date
- 2026-05-29
AI Technical Summary
Existing methods for detecting Rehmannia glutinosa X virus, such as RT-PCR and RT-LAMP, are complex to operate, rely on sophisticated instruments or have complex primer designs, and have long reaction times, making them difficult to use for rapid detection in resource-limited grassroots units and fields.
Using RT-RPA-LFD technology, a specific RT-RPA primer set was designed, including the forward primer ReAV-RPA-F, the reverse primer ReAV-RPA-R, and the probe ReAV-PE. Isothermal amplification was performed and the results were detected by a side-flow chromatography test strip, simplifying the operation and enabling rapid visualization of the results.
It enables rapid, sensitive, and specific detection of the Rehmannia glutinosa virus X, with a short detection time, no need for complex instruments, and is suitable for use in grassroots units and fields, thus improving detection efficiency and accuracy.
Smart Images

Figure CN122105013A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant virus detection technology, specifically relating to the RT-RPA-LFD detection primer set, detection method and application of Rehmannia glutinosa virus X. Background Technology
[0002] Rehmannia glutinosa L. is a perennial herb belonging to the genus Rehmannia in the family Scrophulariaceae. Its dried tuberous roots are one of the most commonly used traditional Chinese medicinal materials. Rehmannia glutinosa propagates through its tubers, and years of asexual reproduction have led to the continuous accumulation of viral diseases, resulting in a high infection rate in the field. This causes the roots and tubers to become thinner, the quality to decline, and the yield to drop sharply, becoming a significant factor restricting the development of the Rehmannia glutinosa industry.
[0003] Currently, 11 viruses have been reported in Rehmannia glutinosa, including Tobacco Mild Green Mosaic Virus, Cucurbit Chlorosis Virus, and Rehmannia Allexivirus (ReAV). Rehmannia Allexivirus (ReAV) belongs to the genus Allexivirus of the family Alphaflexiviridae and is the first new virus to be reported in China that infects Rehmannia glutinosa.
[0004] The main methods for detecting ReAV virus X in *Allium tuberosum* include reverse transcription polymerase chain reaction (RT-PCR) and reverse transcription loop-mediated isothermal nucleic acid amplification (RT-LAMP). RT-PCR is the most commonly used method for molecular diagnostics of plant viruses, offering high reliability and sensitivity. However, it is complex to operate, relies on sophisticated instruments, and has a long amplification time, making rapid detection difficult in resource-constrained grassroots units and fields. RT-LAMP technology allows for isothermal amplification, but its primer design is complex, the reaction temperature is high, and the amplification time is long, similarly limiting its convenient application.
[0005] Recombinase polymerase amplification (RPA) is a rapid amplification of target nucleic acids under isothermal conditions of 37-42℃, involving recombinases bound to single-stranded oligonucleotide primers, single-stranded DNA-binding proteins, and DNA polymerases. The results are then observed using lateral flow dipsticks (LFD). Compared to other detection methods, RT-RPA-LFD detection technology offers advantages such as ease of operation, lower cost, shorter reaction time, and visualized results, showing promising application prospects in the rapid detection of plant viruses. Therefore, establishing an RT-RPA-LFD detection system for ReAV (Recombinant Virus Amplification) is of great significance in providing technical support for the early rapid detection and precise control of this virus. Summary of the Invention
[0006] The purpose of this invention is to overcome the shortcomings of the existing technology and provide an RT-RPA-LFD primer set and detection method for rapid, sensitive and specific detection of Rehmannia glutinosa virus X.
[0007] The technical solution adopted in this invention is as follows:
[0008] An RT-RPA-LFD primer set for detecting Rehmannia glutinosa virus X includes a forward primer ReAV-RPA-F, a reverse primer ReAV-RPA-R, and a probe ReAV-PE, the nucleotide sequences of which are as follows:
[0009] (1) The forward primer ReAV-RPA-3F has the following nucleotide sequence:
[0010] ReAV-RPA-F:5´- ACGGGCGACAACCGCTCAGTTCCAGTTCCG-3´;
[0011] (2) The reverse primer ReAV-RPA-3Rp, with biotin labeled at its 5' end, has the following nucleotide sequence:
[0012] ReAV-RPA-Rp:
[0013] 5´-[biotin]-GTAGGGTGCAATGTTGCTCCACTATGTCCTTCA-3´;
[0014] (3) The probe ReAV-PE has a fluorescein group labeled at its 5' end, a tetrahydrofuran site inserted approximately 30 nt from the 5' end in the middle of the sequence, and is closed at the 3' end by a C3 spacer. Its nucleotide sequence is as follows:
[0015] ReAV-PE:
[0016] 5´-FAM-CTCCATCGCCACACAACAGACAGTGCGAG-THF-CGTTCTCGCTATGGCGCAG / C3-spacer / -3´.
[0017] A method for detecting Rehmannia glutinosa virus X involves using the primer set described above, with cDNA from a Rehmannia glutinosa sample as a template, to perform RT-RPA isothermal amplification, and the amplification products are visualized using an LFD lateral flow chromatography test strip.
[0018] The RT-RPA-LFD detection method includes the following steps:
[0019] (1) Extract total RNA from the Rehmannia glutinosa sample to be tested, and reverse transcribe the total RNA into cDNA using the total RNA as a template;
[0020] (2) Prepare 47.5 μL of premixed solution, including: 29.4 μL of AD buffer (the solvent for the RPA kit), 2 μL of 10 μM ReAV-RPA-3F primer, 2 μL of 10 μM ReAV-RPA-3Rp primer, 0.6 μL of 10 μM ReAV-PE probe, 5 μL of cDNA template, and make up to 47.5 μL with double-distilled water; transfer the premixed solution to an amplification tube, vortex to mix and centrifuge briefly, add 2.5 μL of magnesium acetate activator, vortex again to mix and centrifuge quickly;
[0021] (3) Incubate the amplification tube at a constant temperature of 42 ℃ for 10 min to complete RT-RPA amplification;
[0022] (4) Dilute the amplification product with single nucleic acid diluent, insert the lateral flow chromatography test strip into the diluent, let it stand at room temperature for 7-10 min, and interpret the results based on the color development of the control line and the detection line on the test strip.
[0023] The method for interpreting the test strip in step (4) of the method is as follows:
[0024] A positive result is indicated when both the control line and the test line show red bands; a negative result is indicated when the control line shows a red band but the test line shows no band; and a negative result is indicated when neither the control line nor the test line shows a band.
[0025] Application of the RT-RPA-LFD primer set in rapid field detection of Rehmannia glutinosa virus X.
[0026] The application of the RT-RPA-LFD detection method in early rapid field diagnosis and epidemic monitoring of Rehmannia glutinosa virus X.
[0027] The application of the RT-RPA-LFD primer set in the preparation of a rapid detection kit or reagent for Rehmannia glutinosa X virus.
[0028] The beneficial effects of this invention:
[0029] This invention designs a specific RT-RPA-LFD primer set targeting the conserved CP gene sequence of ReAV, and establishes a suitable rapid detection method, overcoming the shortcomings of existing ReAV detection technologies, and has the following advantages:
[0030] (1) High specificity: The primers and probes designed for the conserved sequence of the CP gene of Rehmannia glutinosa virus X virus in this invention only produce positive reactions to ReAV samples, and have no cross-reaction with other common viruses that infect Rehmannia glutinosa (such as TMGMV, CCYV, BBWV2, ReMV, CLVd, etc.), thus exhibiting good specificity.
[0031] (2) High sensitivity: The detection limit of the ReAV RT-RPA-LFD detection method of the present invention for Rehmannia glutinosa virus plasmid is 6.99 × 10⁻⁶. -1 Copies / μL, compared with conventional RT-PCR (detection limit 6.99 × 10⁻⁶). 1 Compared to (copy / μL), its sensitivity is increased by 100 times, which can effectively detect low abundance viruses and provide the possibility for early diagnosis of viruses.
[0032] (3) Fast and simple: The entire detection process (from RT-RPA amplification to result interpretation) can be completed within 20 minutes without the need for complicated instruments and equipment. The operation steps are simple and it is very suitable for rapid on-site detection in grassroots units and fields.
[0033] (4) Results visualization: The test results can be displayed intuitively through the side flow chromatography test strip and can be interpreted by the naked eye, avoiding the cumbersome process of traditional gel electrophoresis and the potential risk of dye contamination.
[0034] (5) The results are accurate and reliable: The test results of 16 suspected viral disease samples from Rehmannia glutinosa field showed that the RT-RPA-LFD detection method of the present invention (14 positive samples) showed a higher positive detection rate than the conventional RT-PCR (10 positive samples), indicating that it has higher accuracy and reliability in practical application, and provides strong technical support for early warning and precise control of ReAV in the field.
[0035] (6) Good resistance to contamination: The RT-RPA amplification reaction is a single-tube closed reaction, and the core reagent is in the form of lyophilized powder, which can effectively reduce the risk of cross-contamination of nucleic acids and improve detection efficiency;
[0036] (7) Wide application prospects: The method of this invention can realize rapid and accurate detection of ReAV in Rehmannia glutinosa field, providing key technical support for early warning of ReAV, epidemic monitoring and comprehensive prevention and control of Rehmannia glutinosa virus disease, which is of great significance to the healthy development of Rehmannia glutinosa industry. Attached Figure Description
[0037] Figure 1 The image shows the electrophoresis and detection results of the ReAV RT-RPA-LFD primers of this invention.
[0038] The left image shows the electrophoresis results of conventional PCR products using different RT-RPA primer sets, where M: DL2000 DNA marker; 1: primer set 1; 2: primer set 2; 3: primer set 3; 4: primer set 4; 5: primer set 5. The right image shows the LFD visualization results of primer set 3. + indicates positive template, and - indicates negative control.
[0039] Figure 2This is a comparison of the ReAV RT-RPA-LFD detection results at different temperatures and reaction times according to the present invention.
[0040] A: Reaction temperature results graph, numbers 1-5 correspond to temperatures of 38, 40, 42, 44 and 46 ℃ respectively.
[0041] B: Reaction time results graph, numbered 1-8 correspond to: 5 min, 5 min negative control (CK), 10 min, 10 min negative control (CK), 15 min, 15 min negative control (CK), 20 min, 20 min negative control (CK).
[0042] Figure 3 This serves as a verification of the specificity of the RT-RPA-LFD detection method of the present invention.
[0043] The virus templates corresponding to numbers 1-6 are as follows: 1. Rehmannia glutinosa X virus (ReAV), 2. Broad bean wilt virus 2 (BBWV-2), 3. Cucurbit chlorosis virus (CCYV), 4. Tobacco mild green mosaic virus (TMGMV), 5. Rehmannia glutinosa mosaic virus (ReMV), and 6. Goldfish flower latent virus-like virus (CLVd).
[0044] Figure 4 This is a comparison of the sensitivity of the RT-RPA-LFD detection method of the present invention with that of conventional RT-PCR detection.
[0045] Where A: Electrophoresis diagram of conventional RT-PCR detection, and B: RT-RPA-LFD detection result diagram of the present invention.
[0046] In the figure, M represents the DL2000 DNA Marker; the plasmid concentrations corresponding to numbers 1-8 are 6.99 × 10⁸. 3 6.99×10 2 6.99×10 1 6.99×10 0 6.99×10 -1 6.99×10 -2 6.99×10 -3 6.99×10 -4 Copy / μL.
[0047] Figure 5 This invention provides a comparison of the results of RT-RPA-LFD detection of ReAV field samples and conventional RT-PCR detection.
[0048] In the figure, A: Electrophoresis diagram of conventional RT-PCR detection, M: DL2000 DNA Marker, 1-16: 16 field samples of Rehmannia glutinosa, 17: negative control. B: RT-RPA-LFD detection diagram of the present invention, 1-16: corresponding to 16 field samples of Rehmannia glutinosa, 17: negative control. Detailed Implementation
[0049] The present invention will be further described in detail below with reference to specific experimental examples. The embodiments are only used to explain the present invention and are not intended to limit the scope of protection of the present invention.
[0050] Experimental materials
[0051] 1. Rehmannia glutinosa samples: Sixteen leaf samples of Rehmannia glutinosa suspected of being infected with viral diseases were collected from the main Rehmannia glutinosa producing areas in Henan Province. After being flash-frozen in liquid nitrogen, they were stored in a freezer at -80 ℃ for later use.
[0052] 2. Virus plasmids: Rehmannia glutinosa X virus (ReAV), broad bean wilt virus 2 (BBWV-2), cucurbit chlorosis virus (CCYV), tobacco mild green mosaic virus (TMGMV), Rehmannia glutinosa mosaic virus (ReMV), and goldfish flower latent viroid (CLVd) were preserved in the applicant's laboratory;
[0053] 3. Reagents and consumables: Column-type plant total RNA extraction kit, reverse transcription kit, 2×Taq mix, DL2000 DNA marker; test strip type nucleic acid amplification kit, lateral flow detection (LFD) test strips (purchased from Changzhou Anpu Future Biotechnology Co., Ltd.).
[0054] Example 1: Design and screening of primer sets for the detection of Rehmannia glutinosa X virus RT-RPA-LFD
[0055] 1. Primer design and synthesis
[0056] Based on previous transcriptome sequencing results and the conserved nucleotide sequence of the Rehmannia glutinosa X virus (ReAV) coat protein (CP) gene accessed in GenBank (GenBank accession number: PP097219), five sets of candidate RT-RPA-specific primers were designed using Primer Premier 5.0 software, following the principles of RT-RPA primer design. Each set of primers included a forward primer and a reverse primer. Compared to RT-PCR primers, RT-RPA primers are highly specific, more easily avoid complex high-GC regions, and require lower amplification temperatures and do not require a thermal cycler. Subsequently, a specific probe was designed within the amplification region of the selected primers for subsequent LFD detection. Probe design principles: 46-52 nt in length, 5' end labeled with a FAM group, 3' end blocked by a C3 spacer to prevent elongation, and a tetrahydrofuran (THF) site inserted in the middle of the probe sequence (approximately 30 nt from the 5' end) as a recognition site for exonuclease. Meanwhile, RT-PCR detection primers for ReAV were designed as controls for comparison of amplification efficiency in subsequent primer screening.
[0057] All primers and probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The sequences of the five candidate RT-RPA primers and corresponding probes and the primers for conventional RT-PCR are shown in Table 1.
[0058] Table 1. Candidate RT-RPA detection primers and conventional RT-PCR primers
[0059]
[0060] 2. Primer screening
[0061] Total RNA was extracted from Rehmannia glutinosa leaves confirmed to be infected with ReAV using a column-based plant total RNA extraction kit, and cDNA was synthesized according to the reverse transcription kit instructions. Using this cDNA as a template, conventional RT-PCR amplification was performed using the five sets of unmodified candidate primers (i.e., forward and reverse primers) mentioned above to preliminarily evaluate the amplification efficiency and specificity of each primer set.
[0062] Using ReAV cDNA as a template, conventional RT-PCR amplification was performed using five sets of RPA primers. The PCR reaction mixture consisted of 8 μL ddH2O, 10 μL 2×Taq mix, 0.5 μL forward primer, 0.5 μL reverse primer, and 1 μL cDNA, for a total volume of 20 μL. The amplification program was as follows: 94 °C pre-denaturation for 5 min; 94 °C denaturation for 30 s, 55 °C annealing for 30 s, 72 °C extension for 60 s, for 35 cycles; and a final extension at 72 °C for 10 min. The amplified products were detected by 1.5% agarose gel electrophoresis.
[0063] Electrophoresis results are shown below Figure 1 A. Primers in groups 1, 2, 3, 4, and 5 all amplified the target band, but the bands amplified by primers in groups 1, 2, 4, and 5 were weaker and accompanied by non-specific bands. In contrast, primer group 3 (lane 3) amplified a single, bright target band without any bands, indicating that it had better amplification efficiency and specificity.
[0064] 3. Probe matching verification
[0065] Based on the above screening results, group 3 was identified as a superior candidate primer set. To make this primer set suitable for RT-RPA-LFD detection, the 5' end of the downstream primer of group 3 was biotin-labeled (named ReAV-RPA-3Rp, shown in SEQ ID NO. 7), and a matching probe of group 3 (named ReAV-PE, SEQ ID NO. 8) was used. The selected primers ReAV-RPA-3F, ReAV-RPA-3Rp, and ReAV-PE were used together for subsequent RT-RPA-LFD detection.
[0066] The primer and probe sequences selected by this invention are as follows:
[0067] (1) The nucleotide sequence of the forward primer ReAV-RPA-3F is as follows:
[0068] ReAV-RPA-F:5´- ACGGGCGACAACCGCTCAGTTCCAGTTCCG -3´ (SEQ ID NO.5);
[0069] (2) Reverse primer ReAV-RPA-3Rp nucleotide sequence:
[0070] ReAV-RPA-R:
[0071] 5´-[biotin]-GTAGGGTGCAATGTTGCTCCACTATGTCCTTCA-3´ (SEQ ID NO.7);
[0072] (3) The probe ReAV-PE has a fluorescein group labeled at its 5' end, a tetrahydrofuran site inserted in the middle of the sequence, and is blocked at its 3' end by a C3 spacer. Its nucleotide sequence is as follows:
[0073] ReAV-PE:5´-FAM-CTCCATCGCCACACAACAGACAGTGCGAG-THF-CGTTCTCGCTATGGCGCAG / C3-spacer / -3´ (SEQ ID NO. 8).
[0074] Using ReAV-positive sample cDNA as a template, RT-RPA-LFD detection was performed using the aforementioned primers and probes (see Example 2 for specific methods). Results are as follows: Figure 1 As shown in Figure B, both the test line and the control line showed clear red bands, indicating a positive result; however, when a negative sample was used as a template, only the control line showed a band. The results indicate that the third set of primers and probes screened performed well in the RT-RPA-LFD reaction system and demonstrated high usability.
[0075] Example 2: Establishment of a RT-RPA-LFD detection method for Rehmannia glutinosa X virus
[0076] Based on the optimal primer set (ReAV-RPA-3F, ReAV-RPA-3Rp and ReAV-PE) selected in Example 1, a complete ReAV RT-RPA-LFD detection method was established, and its reaction conditions were optimized.
[0077] 1. Extraction of total viral RNA and synthesis of cDNA
[0078] Take approximately 0.1 g of the leaf sample of Rehmannia glutinosa, which has been flash-frozen in liquid nitrogen, and grind it into powder thoroughly in liquid nitrogen. Extract total RNA from the sample according to the instructions of the column-based plant total RNA extraction kit (Sangon Biotech (Shanghai) Co., Ltd.). Using the extracted total RNA as a template, reverse transcription is performed to synthesize first-strand cDNA according to the instructions of the PrimeScript™ II 1st Strand cDNA Synthesis Kit (Takara).
[0079] 2. RT-RPA amplification reaction
[0080] Using the synthesized cDNA as a template, RT-RPA amplification was performed according to the following system:
[0081] Add the following to a 0.2 mL reaction tube containing lyophilized enzyme powder in sequence: 29.4 μL of AD buffer (provided by the RPA kit), 2 μL of 10 μM ReAV-RPA-3F primer, 2 μL of 10 μM ReAV-RPA-3Rp primer, 0.6 μL of 10 μM ReAV-PE probe, and 5 μL of cDNA template. Then, bring the volume to 47.5 μL with double-distilled water (ddH2O) to obtain the premix solution.
[0082] Mix the premixed solution thoroughly and transfer it to a reaction tube. Combine the premixed solution with the lyophilized enzyme powder, vortex to mix, and briefly centrifuge. Add 2.5 μL of activator (280 mM magnesium acetate) to the tube cap, cap the tube, vortex thoroughly to mix, and centrifuge again quickly. Incubate the reaction tube in a 42 ℃ water bath for 10 min. After the reaction is complete, immediately place the reaction tube on ice to stop the reaction. Collect the amplification product after the ice bath for subsequent LFD detection.
[0083] 3. Sideflow chromatography strip (LFD) detection
[0084] After the reaction, take 5 μL of RT-RPA amplification product and dilute it 20-fold with single nucleic acid diluent (as per the RPA test strip), i.e., add 95 μL of diluent. After mixing, vertically insert the sample pad end of the lateral flow chromatography test strip into the diluted mixture and let it stand for 7-10 min. Interpret the test results based on the color development of the test strip.
[0085] If both the control line (C line) and the test line (T line) show red bands, the result is considered positive, indicating that the sample contains ReAV.
[0086] If only the control line shows a red band, while the test line does not, the result is considered negative, indicating that the sample does not contain ReAV.
[0087] If no red band appears on the control line, the test strip is considered invalid regardless of whether there is a band on the test line, and it needs to be tested again.
[0088] Example 3: Optimization of RT-RPA-LFD amplification reaction conditions
[0089] To determine the optimal reaction conditions for the RT-RPA-LFD detection of the present invention, the reaction temperature and reaction time were optimized according to the steps of Example 2.
[0090] Temperature optimization: Five temperature gradients were set at 38, 40, 42, 44, and 46 ℃ for incubation, and the reaction time was fixed at 10 min.
[0091] Time optimization: Four incubation time gradients were set at 5, 10, 15, and 20 min, with the reaction temperature fixed at 42 ℃. A negative control (CK) was set for each temperature gradient.
[0092] The results of the temperature optimization experiment are shown below Figure 2 As can be seen from -A, positive bands can be detected in all ReAV positive templates within the temperature range of 38 ℃ to 46 ℃, with the clearest bands observed between 40 ℃ and 46 ℃. Therefore, the optimal reaction temperature was determined to be 42 ℃.
[0093] The results of the time optimization experiment are shown below Figure 2 As shown in Figure -B, a positive band can be detected after 5 minutes of amplification, with the band being brightest at 10 minutes, while the negative control shows no band. When the amplification time is extended to 15 or 20 minutes, a red band also appears in the negative control detection line, resulting in false positives, possibly due to the accumulation of non-specific amplification products. Therefore, the optimal reaction time is determined to be 10 minutes.
[0094] Therefore, the optimal amplification reaction conditions for RT-RPA-LFD of the present invention are: constant temperature incubation at 42 °C for 10 min.
[0095] Example 4: Specificity of ReAV RT-RPA-LFD detection
[0096] To verify the specificity of the detection method of the present invention, the method of Example 2 was used to detect related viruses infecting Rehmannia glutinosa. The following viruses were detected: Rehmannia glutinosa virus X (ReAV), broad bean wilt virus 2 (BBWV-2), cucurbit chlorosis virus (CCYV), tobacco mild green mosaic virus (TMGMV), Rehmannia glutinosa mosaic virus (ReMV), and goldfish flower latent viroid (CLVd).
[0097] See results Figure 3 Only the detection group using ReAV virus X as a template showed clear red bands on both the test line and the control line of the test strip; while the other five viral templates only showed bands on the control line. This result indicates that the ReAV RT-RPA-LFD detection method established in this invention has good specificity and shows no cross-reaction with other common viruses that infect Rehmannia glutinosa.
[0098] Example 5: Sensitivity Detection of ReAV RT-RPA-LFD
[0099] The ReAV plasmid (initial concentration 134.4 ng / μL, copy number 6.99 × 10⁻⁶) stored in the applicant's laboratory was used. 10 The sample was serially diluted 10-fold (copy / μL) to obtain a final volume of 6.99 × 10⁻⁶. 3 6.99×10 2 6.99×10 1 6.99×10 0 6.99×10 -1 6.99×10 -2 6.99×10 -3 6.99×10 -4 A series of dilutions per copy / μL were prepared. Using these as templates, RT-RPA-LFD detection was performed according to the method in Example 2. Simultaneously, conventional PCR detection using ReAV-CPF and ReAV-CPR primers was performed using the same template according to the method in Example 1 for comparison.
[0100] See results Figure 4 Conventional RT-PCR ( Figure 4 The detection limit of A) is 6.99 × 10⁻⁶. 1 Copy / μL; while the RT-RPA-LFD method of the present invention ( Figure 4 The detection limit for B) is 6.99 × 10⁻⁶. -1 Copy / μL. Experimental results show that the sensitivity of the RT-RPA-LFD detection method of the present invention is 100 times that of conventional RT-PCR.
[0101] Example 6: Comparison of the accuracy of RT-RPA-LFD detection of field samples and conventional RT-PCR detection according to the present invention.
[0102] The RT-RPA-LFD method of this invention was used to test 16 field-collected Rehmannia glutinosa samples suspected of viral disease (numbered 1-16). Simultaneously, conventional RT-PCR detection was performed using ReAV-CPF and ReAV-CPR primers as controls. The detection methods are as described in Examples 1 and 2.
[0103] See results Figure 5 , Figure 5 A represents the electrophoresis results of routine RT-PCR detection. Among the 16 samples, 10 samples (numbered 2, 4, 6, 7, 8, 10, 11, 14, 15, and 16) amplified specific bands and were judged as positive.
[0104] Figure 5 -B represents the detection results of the RT-RPA-LFD of this invention. 14 samples (numbered 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16) showed red bands on their test strips and were judged as positive.
[0105] The comparative results showed that the RT-RPA-LFD method of the present invention detected 14 positive samples out of 16 field samples, while conventional RT-PCR detected only 10 positive samples. This indicates that the RT-RPA-LFD detection method of the present invention has a higher detection rate and accuracy in actual sample detection, and is more consistent with the actual infection situation in the field, and can be more effectively used for the early diagnosis of ReAV in the field.
Claims
1. A set of RT-RPA-LFD primers for detecting Rehmannia glutinosa virus X, characterized in that, The primer set includes the forward primer ReAV-RPA-3F, the reverse primer ReAV-RPA-3Rp, and the probe ReAV-PE, with the following nucleotide sequences: (1) The forward primer ReAV-RPA-3F has the following nucleotide sequence: ReAV-RPA-F:5´- ACGGGCGACAACCGCTCAGTTCCAGTTCCG-3´; (2) The reverse primer ReAV-RPA-3Rp, with biotin labeled at its 5' end, has the following nucleotide sequence: ReAV-RPA-Rp: 5´-[biotin]-GTAGGGTGCAATGTTGCTCCACTATGTCCTTCA-3´; (3) The probe ReAV-PE has a fluorescein group labeled at its 5' end, a tetrahydrofuran site inserted approximately 30 nt from the 5' end in the middle of the sequence, and is closed at the 3' end by a C3 spacer. Its nucleotide sequence is as follows: ReAV-PE:5´-FAM-CTCCATCGCCACACAACAGACAGTGCGAG-THF-CGTTCTCGCTATGGCGCAG / C3-spacer / -3´.
2. A method for detecting Rehmannia glutinosa virus X using RT-RPA-LFD, characterized in that, Using the primer set described in claim 1, cDNA from a Rehmannia glutinosa sample was used as a template for RT-RPA isothermal amplification, and the amplification products were visualized and detected using an LFD lateral flow chromatography test strip.
3. The RT-RPA-LFD detection method according to claim 2, characterized in that, Includes the following steps: (1) Extract total RNA from the Rehmannia glutinosa sample to be tested, and reverse transcribe the total RNA into cDNA using the total RNA as a template; (2) Prepare 47.5 μL of premixed solution, including: 29.4 μL of AD buffer (the solvent for the RPA kit), 2 μL of 10 μM ReAV-RPA-3F primer, 2 μL of 10 μM ReAV-RPA-3Rp primer, 0.6 μL of 10 μM ReAV-PE probe, 5 μL of cDNA template, and make up to 47.5 μL with double-distilled water; transfer the premixed solution to an amplification tube, vortex to mix and centrifuge briefly, add 2.5 μL of magnesium acetate activator, vortex again to mix and centrifuge quickly; (3) Incubate the amplification tube at a constant temperature of 42 ℃ for 10 min to complete RT-RPA amplification; (4) Dilute the amplification product with single nucleic acid diluent, insert the lateral flow chromatography test strip into the diluent, let it stand at room temperature for 7-10 minutes, and interpret the results based on the color development of the control line and the detection line on the test strip.
4. The method according to claim 3, characterized in that, The method for interpreting the test strip results in step (4) is as follows: A positive result is indicated when both the control line and the test line show red bands; a negative result is indicated when the control line shows a red band but the test line shows no band; and a negative result is indicated when neither the control line nor the test line shows a band.
5. The application of the RT-RPA-LFD primer set according to claim 1 in the rapid field detection of Rehmannia glutinosa virus X.
6. The application of the RT-RPA-LFD detection method according to claim 2 in the early rapid field diagnosis and epidemic monitoring of Rehmannia glutinosa virus X.
7. The use of the RT-RPA-LFD primer set according to claim 1 in the preparation of a rapid detection kit or reagent for Rehmannia glutinosa X virus.