Use of purple sweet potato anthocyanins in the preparation of products for preventing or improving intestinal aging
By reshaping gut microbiota metabolism and activating the PI3K-Akt signaling pathway through anthocyanins from purple sweet potatoes, the problem of decreased barrier function and weakened stem cell function caused by intestinal aging was solved, thus improving intestinal structure and function.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-31
- Publication Date
- 2026-06-02
Smart Images

Figure CN122124077A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of biomedicine and food nutrition technology, specifically to the application of purple sweet potato anthocyanins in the preparation of products for preventing or improving intestinal aging. Background Technology
[0002] The gut is a crucial interface for the exchange of substances between the body and the external environment, playing multiple roles including nutrient absorption, barrier defense, and immune regulation. Intestinal epithelial homeostasis is the core foundation for maintaining normal function. With age, intestinal epithelial homeostasis gradually undergoes degenerative changes. At the tissue morphology level, aging is often accompanied by degeneration of the colonic crypt structure, thinning of the mucosal layer, and damage to the epithelial ultrastructure, leading to a decline in the intestinal epithelium's renewal and repair capabilities. Regarding mechanical barriers, aging can lead to downregulation of tight junction protein expression, loosening of intercellular connections, and increased intestinal permeability.
[0003] Furthermore, aging significantly impacts the intestinal stem cell system, leading to decreased proliferative activity, lineage differentiation imbalance, and weakened regenerative capacity, thereby affecting the continuous replenishment of epithelial cells. Currently, exploring feasible dietary intervention strategies is of significant scientific importance and practical value for achieving healthy intestinal aging. While food-derived polyphenols exhibit strong intestinal lumen exposure characteristics, their role in improving the intestinal barrier and intestinal stem cell function under the background of natural aging, and their clearly defined applications, still lack systematic evidence. Summary of the Invention
[0004] This invention aims to provide an application of purple sweet potato anthocyanins in the preparation of products for preventing or improving intestinal aging, and provides a new approach for the development and application of food-derived polyphenols targeting the intestine to promote healthy aging.
[0005] To achieve the above-mentioned objectives, the present invention is implemented through the following technical solution: The application of purple sweet potato anthocyanins in the preparation of products for preventing or improving intestinal aging is characterized in that the purple sweet potato anthocyanins improve intestinal aging by remodeling intestinal flora metabolism and activating intestinal cell autophagy via the PI3K-Akt signaling pathway; the improvement of intestinal aging includes at least one of the following: improving intestinal epithelial barrier function, improving intestinal epithelial renewal capacity, and improving intestinal cell autophagy function.
[0006] This invention demonstrates that purple sweet potato anthocyanins can significantly improve the degenerative changes and barrier fragility of the colon caused by natural aging, restore the morphology of colonic crypts and the ultrastructure of the epithelium, and upregulate the expression of tight junction proteins and mucus barrier-related indicators. Furthermore, purple sweet potato anthocyanins can effectively enhance crypt proliferation activity and promote the differentiation of intestinal stem cells into secretory lineages (such as goblet cells and enteroendocrine cells). Its mechanism of action does not rely on direct anti-inflammatory pathways, but rather on remodeling intestinal flora metabolism (such as increasing short-chain fatty acids) and activating intestinal cell autophagy via the PI3K-Akt signaling pathway, thereby supporting the continuous renewal and maintenance of the intestinal barrier. This invention provides a new approach for the development and application of food-derived polyphenols targeting the gut to promote healthy aging.
[0007] Preferably, the purple sweet potato anthocyanins include peony pigment derivatives and cyanidin derivatives.
[0008] Preferably, the peony pigment derivative and cyanidin derivative are acylated anthocyanins.
[0009] Preferably, the acylated anthocyanin is any one or a combination of paeonol 3-caffeoylsophoroside-5-glucoside, paeonol 3-dicaffeoylsophoroside-5-glucoside, and cyanidin 3-caffeoylsophoroside-5-glucoside.
[0010] Preferably, the product is a pharmaceutical, food, or health product.
[0011] As a further preferred option, the food includes ordinary food, health food, or food for special medical purposes.
[0012] Preferably, the improvement in intestinal epithelial barrier function is manifested by upregulating the expression of tight junction proteins and / or mucins.
[0013] As a further preferred embodiment, the tight junction protein includes at least one of Zo-1 and Claudin-3; the mucin includes at least Muc2.
[0014] Preferably, the improvement in intestinal epithelial renewal capacity is manifested in promoting the proliferation of colonic crypt cells and / or promoting the differentiation of intestinal stem cells into secretory lineage cells.
[0015] As a further preferred embodiment, the promotion of colonic crypt cell proliferation is manifested by increased Ki67 expression and / or upregulation of cell cycle positive regulators Ccnd1 and Cdk4; the secretory lineage cells include goblet cells, enteroendocrine cells and / or Paneth-like cells.
[0016] Preferably, the improvement of intestinal cell autophagy function is manifested by activating cell autophagy through the PI3K-Akt signaling pathway via intestinal flora metabolites, thereby upregulating the expression of autophagy-related proteins.
[0017] Preferably, the autophagy-related proteins are Atg5, Atg10, and / or LC3A / B.
[0018] Therefore, the present invention has the following beneficial effects: (1) This invention confirms that purple sweet potato anthocyanins can significantly improve the degenerative changes in colonic structure and barrier fragility caused by natural aging. Specifically, purple sweet potato anthocyanins can restore the depth of colonic crypts and the ultrastructure of intestinal epithelial microvilli, and significantly reduce DNA double-strand break damage (reducing γH2AX positive cells) and cellular senescence load (downregulating the expression of the senescence marker gene p21) in intestinal tissue. (2) This invention confirms that purple sweet potato anthocyanins can significantly enhance the mechanical and mucus barrier functions of the aging intestine. By upregulating the expression of tight junction proteins (such as Zo-1 and Claudin-3) and mucin (Muc2), it effectively repairs the abnormal permeability of the intestinal epithelium caused by aging; (3) The purple sweet potato anthocyanins of the present invention can enhance the proliferative activity of colonic crypt cells (significantly increase the expression of Ki67 and the number of positive cells, activate the Wnt / β-catenin signaling pathway target gene Axin2 and cell cycle positive regulators Ccnd1 and Cdk4), and significantly promote the differentiation of intestinal stem cells into secretory lineage cells such as goblet cells, enteroendocrine cells (ChgA positive) and Paneth-like cells (Lyz1 positive), providing sufficient cellular support for the continuous renewal of the intestinal barrier; (4) The purple sweet potato anthocyanins of the present invention improve intestinal homeostasis without relying on the classic direct anti-inflammatory pathway (which has no significant effect on various inflammatory factors such as TNF-α and IL-6), but indirectly and effectively improve the intestinal epithelial barrier and stem cell function by reshaping the intestinal flora structure (such as increasing the ratio of Bacteroidetes to Firmicutes) and reshaping the microbial metabolite profile (significantly increasing the production of short-chain fatty acids such as butyric acid and valeric acid); (5) The present invention also reveals that purple sweet potato anthocyanins can activate intestinal cell autophagy (significantly upregulate Atg5, Atg10 and LC3A / B, etc.) through microbiome-dependent metabolic reprogramming via the PI3K-Akt signaling pathway, thereby clearing damaged components in senescent cells and supporting the maintenance of intestinal epithelial homeostasis. Attached Figure Description
[0019] Figure 1 This figure shows the effect of purple sweet potato anthocyanin intervention on the colonic tissue structure of aged mice; among them, Figure 1 In the figure, A represents the statistical graph of colon length in each group of mice; Figure 1 B in the image represents a representative H&E staining image of colon tissue and a quantitative analysis of crypt depth. Figure 1 C in the diagram represents the morphology and length of colonic epithelial microvilli under a transmission electron microscope.
[0020] Figure 2 The figure shows the effect of purple sweet potato anthocyanins on the expression of colonic barrier-related proteins in aged mice; among them, Figure 2 In the diagram, A represents the immunofluorescence staining, fluorescence intensity, and relative gene expression level of Zo-1. Figure 2 In the diagram, B represents the immunofluorescence staining, fluorescence intensity, and relative gene expression level of Claudin-3. Figure 2 In the diagram, C represents the immunofluorescence staining of Muc2, the percentage of Muc2 intensity / area, and the relative gene expression level.
[0021] Figure 3 This figure shows the effects of purple sweet potato anthocyanins on colonic epithelial cell proliferation and cell cycle regulation in aged mice; among them... Figure 3 A and B in the figure represent Lgr5 protein imprinting analysis and mRNA expression level diagrams; Figure 3 C and D in the image represent Ki67 mRNA expression levels and immunofluorescence staining. Figure 3 E~H in the figure represent the relative expression levels of Ccnd1, Cdk4, Cdkn1a, and Axin2 mRNA.
[0022] Figure 4 The figure shows the effect of purple sweet potato anthocyanins on the differentiation of colonic secretory cells in aged mice; among them... Figure 4 A in the figure represents the alicin blue staining of colon tissue and the quantitative analysis of goblet cells in the crypts; Figure 4 B and C in the image represent the ChgA mRNA expression level and immunofluorescence staining. Figure 4 D in the figure represents the Lyz1 immunofluorescence staining and quantitative analysis diagram.
[0023] Figure 5 This figure illustrates the effects of colonic contents supernatant on the growth of aging colonic organoids and the expression of related genes; among them... Figure 5 In the image, A represents a representative image of the growth of senescent colon organoids and a map showing the fold increase in organoid area. Figure 5 In the diagram, B represents the relative expression levels of Lgr5, Ki67, and ChgA mRNA in organoids. Figure 5 The figure C represents the relative expression levels of Zo-1, Occludin, and Claudin-3 mRNA in organoids. Detailed Implementation
[0024] The present invention will be further described below with reference to the accompanying drawings and specific embodiments. Those skilled in the art will be able to implement the present invention based on these descriptions. Furthermore, the embodiments of the present invention described below are generally only some, not all, of the embodiments of the present invention. Therefore, all other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort should fall within the scope of protection of the present invention.
[0025] The experimental materials and methods used in the following examples are shown below: (1) Laboratory animals: Male C57BL / 6J mice were housed in an animal facility at a temperature of 24±1℃ and a relative humidity of 50%±5%, using a 12-hour light / 12-hour dark cycle. Mice had free access to standard maintenance feed and drinking water (purified water). All animal experimental procedures were reviewed and approved by the Experimental Animal Ethics Committee of Zhejiang University of Traditional Chinese Medicine, with ethics approval number IACUC-20230918-26.
[0026] After one week of acclimatization, mice were randomly divided into three experimental groups of 10 mice each: a young control group (Young, 2 months old), an old control group (Old, 17 months old), and a purple sweet potato anthocyanin intervention group (PSPAs, 17 months old). The Young and Old groups received a solvent control (drinking water containing 0.1% Tween-80) via gavage daily, while the PSPAs group received 100 mg / kg of purple sweet potato anthocyanin solution via gavage daily. Interspecies dose conversion was performed using the FDA-recommended body surface area normalization method; this dose is equivalent to approximately 88 mg of human equivalent dose per day for a 60 kg adult. Gavage was administered once daily at a fixed time, and changes in mouse body weight and food intake were recorded weekly for 8 consecutive weeks. After the intervention, mice were fasted for 4 hours, anesthetized with isoflurane, and euthanized. Tissues and colonic contents were rapidly collected, flash-frozen in liquid nitrogen, and stored at -80°C for subsequent molecular biology experiments and omics analysis.
[0027] (2) Experimental reagents and instruments: All are commonly used laboratory reagents and instruments.
[0028] (3) Experimental methods: 1. LC-MS PSPAs were identified by LC-MS. PSPAs were dissolved in a 1% formic acid aqueous solution, appropriately diluted, and filtered through a 0.22 μm filter membrane. The filtrate was used as the analyte. Chromatographic separation was performed using a Waters ACQUITY UPLC® BEH C18 column at 60℃. The mobile phase consisted of an aqueous solution (A) containing 1% formic acid and methanol (B), with a flow rate of 0.3 mL / min and an injection volume of 5 μL. Mass spectrometry was performed using a Waters Xevo TQD mass spectrometer in ESI positive ion mode, with a scan range of m / z 500-1500. Secondary fragment information was acquired using a data-dependent acquisition mode. Anthocyanin components were identified based on the molecular ion peak of the primary mass spectrometry, secondary mass spectrometry fragment information, retention time, and literature data.
[0029] 2. Mouse tissue sampling After euthanasia, mice were rapidly dissected on ice. Tissue was quickly washed in sterile PBS at 4°C, and surface moisture was aspirated. Colon length was measured, and the wet weight of the gastrocnemius muscle and liver was weighed and recorded. The tissue was divided into two parts: one part was fixed in 4% paraformaldehyde, ensuring each sample came from the same region; the other part was placed in cryovials and rapidly frozen in liquid nitrogen. The contents of the colon were collected into sterile cryovials and rapidly frozen in liquid nitrogen for subsequent analysis.
[0030] 3. Tissue embedding and sectioning Fresh tissues were fixed in 4% paraformaldehyde for at least 24 hours to reduce morphological changes during subsequent processing. The tissues were then dehydrated and paraffin-impregnated using the following procedure: 75% alcohol for 1.5 hours, 85% ethanol for 1.5 hours, 90% ethanol for 1.5 hours, 95% ethanol for 1 hour, anhydrous ethanol for 1 hour, anhydrous ethanol for 1 hour, ethanol and xylene for 10 minutes, xylene for 10 minutes, xylene for 20 minutes, paraffin melted at 65°C for 0.5 hours, paraffin melted at 65°C for 1 hour, and paraffin melted at 65°C for 1.5 hours. The paraffin-impregnated tissues were then embedded, and continuous sections with a thickness of 4 μm were prepared using a paraffin microtome. After being spread at 40°C, the sections were attached to glass slides and baked in a 60°C oven until ready for use.
[0031] Liver tissue was fixed in 4% paraformaldehyde for at least 24 hours, and then dehydrated. The dehydration process was as follows: 0.5 hours in 15% sucrose solution (to rinse the tissue surface and remove the fixative), 1 hour in 15% sucrose solution, 3 hours in 30% sucrose solution, and 4 hours in 40% sucrose solution. The dehydrated tissue was embedded in OCT embedding medium and rapidly frozen. 8 μm thick sections were prepared using a cryostat, mounted on glass slides, and stored at -80°C for later use.
[0032] 4. Hematoxylin-eosin (H&E) staining Paraffin-embedded tissue sections were prepared and stained using standard H&E staining methods, with appropriate adjustments made to the experimental conditions. Sections were dewaxed in xylene for 10 min (repeated once), then rehydrated in anhydrous ethanol, 90%, 80%, and 70% ethanol for 5 min each, and rinsed with ultrapure water for 2 min. Sections were then stained in hematoxylin for 5 min, rinsed with running water for 10 min, briefly washed with ultrapure water, treated with hydrochloric acid-ethanol differentiation solution for approximately 10 s, and then bluing again under running water for 10 min. Next, sections were stained in eosin for 2 min to visualize the cytoplasm and extracellular matrix. After staining, sections were dehydrated in 70%, 80%, and 90% ethanol and anhydrous ethanol, then cleared in xylene for 5 min (repeated once). Finally, sections were mounted with neutral resin, and tissue morphology was observed and images acquired under an optical microscope.
[0033] 5. Immunofluorescence staining Paraffin sections were subjected to immunofluorescence staining. Following the H&E staining procedure described above, sections were dewaxed and rehydrated in a gradient manner. Afterward, sections were placed in citrate buffer (pH 6.0) for heat-induced antigen retrieval. Subsequently, sections were permeabilized with PBS containing 0.3% Triton X-100 and blocked with blocking buffer containing 20% donkey serum and 5% bovine serum albumin. Primary antibodies were added, and the sections were incubated overnight at 4°C. The primary antibodies used were: anti-γ-H2AX, anti-Muc2, anti-ChromograninA, anti-Ki67, anti-Lysozyme, anti-Zo-1, and anti-Claudin-3. After washing, the corresponding secondary antibodies were added: Alexa Fluor 680-labeled goat anti-rabbit antibody, Alexa Fluor 488-labeled goat anti-rabbit antibody, and Alexa Fluor 555-labeled donkey anti-rabbit antibody. After incubating with the secondary antibody at room temperature for 1 h, the tissue was incubated with 5 μg / mL DAPI for 5 min, washed three times with ultrapure water, and two drops of Fluoroshield mounting medium were added to the tissue. A coverslip was then gently placed on top for mounting. Images were acquired using a Leica confocal microscope.
[0034] 6. Transmission electron microscopy Fresh colon tissue was immediately placed in 2.5% glutaraldehyde fixative after excision and trimmed to approximately 0.5-1 mm. 3Tissue blocks were fixed overnight at 4°C. After fixation, glutaraldehyde was discarded, and the tissue was rinsed three times with 0.1 M phosphate buffer for 15 min each time. The tissue blocks were then transferred to 1% osmium tetroxide solution and fixed at room temperature for 2 h, followed by rinsing three times with 0.1 M phosphate buffer. The samples were dehydrated in a gradient of 50%, 70%, 80%, 90%, and 95% ethanol for 15 min each, and then dehydrated twice with anhydrous ethanol for 20 min each time. After dehydration, the samples were embedded in acetone and epoxy resin through a stepwise infiltration process, and polymerized at 60°C for 48 h. After the resin-embedded blocks solidified, ultrathin sections with a thickness of approximately 60-80 nm were prepared using an ultramicrotome, retrieved onto a copper grid, and stained sequentially with uranium acetate and lead citrate. After drying, the sections were observed and images were acquired under a transmission electron microscope.
[0035] 7. Alixin Blue Staining Paraffin-embedded tissue sections were dewaxed and rehydrated. The sections were then stained in aloxine blue solution at room temperature for 15 min to reveal acidic mucopolysaccharides and acidic mucus components in the tissue. After staining, the sections were thoroughly rinsed under running tap water and counterstained in nuclear solid red solution for 3 min to reveal nuclear structures. After counterstaining, the sections were rinsed again with running tap water. The sections were then treated with anhydrous ethanol for 5 min (repeated twice) to ensure thorough dehydration; subsequently, they were cleared in xylene for 5 min (repeated once). After removal from the slides, they were mounted with neutral resin, and the morphological changes were observed and images acquired under an optical microscope.
[0036] 8. RNA reverse transcription and real-time quantitative PCR Total RNA was extracted from tissues using the Trizol method. A suitable amount of fresh tissue was washed with pre-chilled PBS and transferred to a 1.5 mL RNase-free centrifuge tube. 1 mL of TRIzol lysis buffer was added, and the mixture was homogenized thoroughly using a cryogenic homogenizer until no visible fragments remained. 200 μL of chloroform was added, and the mixture was vortexed for approximately 15 s until the liquid turned a uniform milky white color. The mixture was then allowed to stand at room temperature for 15 min. Centrifuged at 12000 × g for 15 min at 4 °C. The mixture separated into three layers. The upper colorless aqueous phase was carefully transferred to a new 1.5 mL centrifuge tube, and isopropanol was added at a 1:1 volume ratio. The mixture was inverted and mixed thoroughly, then allowed to stand at room temperature for 10 min. Centrifuged at 12000 × g for 15 min at 4 °C. The supernatant was discarded, and the precipitate was gently washed with 1 mL of 75% ethanol (prepared with DEPC water). The precipitate was centrifuged at 7500 × g for 5 min, and the washing was repeated once. The supernatant was discarded, and the precipitate was allowed to air dry in a clean bench until transparent. 20 μL of DEPC water was added, and the precipitate was gently resuspended by pipetting.
[0037] Take 1 μL of sample and determine its concentration and purity using a NanoDrop micro-volume spectrophotometer. 260 / OD 280 A purity level within the range of 1.8-2.1 is considered acceptable, while also referring to OD. 260 / OD 230 Assess residual organic reagents. Dilute all samples to approximately 800 ng / μL with DEPC-treated water. Using the HiScript III RT SuperMix for qPCR (+gDNA wiper) kit purchased from Vazyme, reverse transcribe equal volumes of RNA to synthesize cDNA. The resulting cDNA was aliquoted and stored at -40°C for later use.
[0038] Real-time quantitative PCR was performed using ChamQ Universal SYBR qPCR Master Mix. cDNA was diluted with nuclease-free water at a 1:4 ratio, and all primers were diluted with nuclease-free water to a working concentration of 10 μM. 1 μL of the diluted cDNA template was added to 0.4 μL of forward primer, 0.4 μL of reverse primer, 5 μL of 2× ChamQ UniversalSYBR qPCR Master Mix, and 3.2 μL of nuclease-free water to prepare a 10 μL reaction mixture. After brief centrifugation, the reaction plate was placed in a real-time quantitative PCR instrument. The reaction program was set as follows: 95℃ pre-denaturation for 30 s; followed by amplification: 95℃ denaturation for 10 s, 60℃ annealing and extension for 30 s, for a total of 40 cycles. After amplification, melting curve analysis was performed to verify the product specificity. Mouse GAPDH gene was used as an internal reference gene, and 2... -ΔΔCt The relative expression levels of each target gene mRNA were calculated using the following method. Primer sequences are shown in Table 1 below: Table 1: Primer Name Primer Sequence (5’→3’) Gapdh F: GCATGGCCTTCCGTGTTCCTAR: GATGCCTGCTTCACCACCTTCT Zo-1 F: GGAGATGTTTATGCGGACGGR: CCATTGCTGTGCTCTTAGCG Occludin F: TTGAAAGTCCACCTCCTTACAGAR: CCGGATAAAAAGAGTACGCTGG Claudin-3 F: GTACAAGACGAGACGGCCAAR: CGTACAACCCAGCTCCCATC Muc2 F: CTGACCAAGAGCGAACACAAR: CATGACTGGAAGCAACTGGA Lgr5 F: GAGTCAACCCAAGCCTTAGTATCCR: CATGGGACAAATGCAACTGAAG Ki67 F: CAGTACTCGGAATGCAGCAAR: CAGTCTTCAGGGGCTCTGTC ChgA F: CGATCCAGAAAGATGATGGTCR: CGGAAGCCTCTGTCTTTCC Ccnd1 F: AGGCGGATGAGAACAAGCAGACR: TGGAGGGTGGGTTGGAAATGAAC Cdk4 F: AGGACCTGAGGACATACCTGGACR: GCCGCTTAGAAACTGACGCATTAG Cdkn1a F: CGAGAACGGTGGAACTTTGACTTCR: CGGGACCCAGGGCTCAGG Axin2 F: GCAGGCTGGCAGAGGTGTCR: CTTGGGTTGGCGAAGGGTGAG Atoh1 F: CTTGCCGGACTCGCTTCTCAGR: TCTGTGCCATCATCGCTGTTAGG p16 F: CGGTATCTACTCTCCTCCGCR: GTTGCCAGAAGTGAAGCCAA p21 F: TCCACAGCGATATCCAGACAR: GGACATCACCAGATTGGAC TNF-α F: CACCATGAGCACAGAAAGCAR: TAGACAGAAGAGCGTGGTGG IL-6 F: TACCACTCCCAACAGACCTGR: GGTACTCCAGAAACCAGAGG IL-10 F: GAAGACCCTCAGGATGCGR: CCAAGGAGTTGTTTCCGTTA IL-12 F: AGTGACATGTGGAATGGCGTR: CAGTTCAATGGGCAGGGTCT IL-1β F: ACTCATTGTGGCTGTGGAGAR: TTGTTCATCTCGGAGCCTGT Gapdh F: GCATGGCCTTCCGTGTTCCTAR: GATGCCTGCTTCACCACCTTCT Atg5 F: AAAGATGTGCTTCGAGATGTGTR: CACTTTGTCAGTTACCAACGTCA Atg10 F: CATCTCACCAGATCTCAAGAAGGAR: CGACATGCGTAAGCAACGTT Atg12 F: CTGCTGGCGACACCAAGAAAR: CGTGTTCGCTCTACTGCCC Atg101 F: GGAGGTGTGGACTGTCAAGGR: ACACGTTGTCCACCTCTGAC
[0039] 9. Western blot detection (WB) of proteins Approximately 20 mg of colon tissue was collected and lysed with 200 μL of pre-chilled RIPA lysis buffer containing protease inhibitors and phosphatase inhibitors. The mixture was homogenized thoroughly on ice using a cryogenic tissue homogenizer and centrifuged at 12000 × g for 15 min at 4°C. The supernatant was collected to obtain the total protein extract. Protein concentration was determined using the BCA method to standardize the concentration of each sample. After adding loading buffer, the sample was denatured at 100°C for 10 min. Equal volumes of protein were loaded onto a 4-20% Tris-Glycine SDS-PAGE precast gel for electrophoresis separation, followed by wet transfer to a methanol-activated 0.45 μm PVDF membrane. After blocking with blocking buffer at room temperature for 1 h, the membrane was incubated overnight at 4°C with Lgr5 and GAPDH primary antibodies, respectively. The next day, the membrane was washed three times for 10 min each time, and incubated with HRP-labeled goat anti-rabbit IgG secondary antibody at room temperature for 1 h, followed by three more washes. The ECL chemiluminescence reagent kit was used for color development, and strip images were acquired in a chemiluminescence imaging system. GAPDH was used as an internal control, and the grayscale values were semi-quantitatively analyzed using ImageJ software.
[0040] 10. ELISA To detect the protein concentration of corresponding cytokines in colon tissue, the capture antibody was diluted to the working concentration with 1× coating buffer, 100 μL per well, and incubated overnight at 4°C to complete the coating. Total protein extract was used, and protein concentration was determined by the BCA method to standardize the concentration of each sample. The following day, the plate was washed three times, blocked with 1× dilution buffer for 1 h, and then 100 μL each of the standard serial dilution and tissue protein sample were added to the corresponding wells, and incubated with shaking at room temperature for 2 h. After washing, biotin-labeled detection antibody was added and incubated for 1 h, followed by Avidin-HRP enzyme conjugate incubation in the dark for 30 min, with thorough washing between each step. After the final wash, TMB substrate solution was added for color development for approximately 15 min, and the reaction was terminated with 1 M H₂SO₄. The absorbance was measured at 450 nm using a microplate reader, corrected at 570 nm, and the protein concentration of the factor was calculated based on the standard curve.
[0041] 11. Data Analysis Experimental images were analyzed using ImageJ, and experimental data were statistically analyzed and plotted using GraphPad Prism 9.0 software. Results are presented as mean ± standard error (Mean ± SEM). One-way ANOVA was performed, combined with Tukey's post-hoc multiple comparison test for inter-group comparisons. A p-value < 0.05 was considered statistically significant (*p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001).
[0042] 12. Preparation of colonic supernatant The preparation of colonic content supernatant (CCS) was performed under aseptic conditions. Approximately 200 mg of fresh colonic contents was placed in a pre-chilled sterile centrifuge tube, 1 mL of pre-chilled complete culture medium was added, sterile grinding beads were added, and the mixture was thoroughly homogenized using a cryo-tissue homogenizer. The entire procedure was performed on ice to minimize metabolite degradation. The homogenate was centrifuged at 12000 × g for 15 min at 4°C, and the supernatant was carefully aspirated to avoid disturbing the precipitate. The obtained supernatant was further sterilized by filtration through a 0.22 μm sterile filter, aliquoted, and stored at -80°C, avoiding repeated freeze-thaw cycles before use. After three passages to stabilize the organoids, starting from the first day of the next passage, CCS from different donor sources was added to the organoid complete culture medium at 2% by volume. The intervention lasted for 72 h, with the culture medium changed on the second day of intervention. The growth status and morphological changes of the organoids were continuously observed and recorded.
[0043] 13. Non-targeted metabolomics detection of colon contents Colonic contents samples were stored at -80°C and thawed on ice before testing. An appropriate amount of sample was weighed and added to a methanol-acetonitrile solution (1:1, v / v) containing an internal standard mixture for metabolite extraction. After thorough vortexing, the mixture was sonicated at low temperature to promote metabolite release. Subsequently, the samples were centrifuged at 4°C, and the supernatant was collected for subsequent analysis. To ensure detection stability, equal volumes of supernatant from each group were mixed to prepare a QC sample for evaluating instrument repeatability and data reliability.
[0044] Untargeted metabolomics detection was performed using ultra-high performance liquid chromatography-mass spectrometry (UHPLC-MS). The chromatographic system was an Agilent 1290 UHPLC, and the mass spectrometry platform was an AB Sciex TripleTOF 5600+ high-resolution mass spectrometer. Data were acquired in both positive and negative ion modes using electrospray ionization (ESI). Chromatographic separation employed a reversed-phase C18 column with a gradient elution of aqueous and organic phases to achieve effective separation of complex metabolites. Raw data were peak identified, aligned, and normalized before multivariate statistical analysis. Orthogonal partial least squares discriminant analysis (OPLS-DA) was used to construct a discriminant model, and differentially expressed metabolites were screened based on variable importance projection values (VIP) and fold changes. Metabolite annotation was performed using matching identification based on public databases such as HMDB and METLIN. Furthermore, Spearman correlation analysis was used to assess the correlation between differentially expressed microbiota and differentially expressed metabolites to explore the potential association between gut microbiota and metabolites.
[0045] 14. Transcriptome sequencing of mouse colon tissue RNA was extracted and its concentration and purity were measured, and its integrity was assessed. Samples that passed quality control were used for subsequent library construction and mRNA sequencing using an Illumina NovaSeq 6000 platform. After obtaining the raw sequencing data, quality control was performed to remove adapter sequences and low-quality reads, resulting in clean reads used for expression quantification and intergroup comparison analysis. Differentially expressed genes were screened using statistical methods and visualized using volcano plots and heatmaps. Principal component analysis was performed using the R ggplot2 package to assess overall expression differences between samples. Functional interpretation of differentially expressed genes was performed using Gene Ontology GO functional annotation and Kyoto Encyclopedia of Genes and Genomes KEGG pathway enrichment analysis using the R ClusterProfiler package. Significantly enriched functional items and pathways were selected for subsequent biological interpretation.
[0046] Example 1: Component characteristics of anthocyanins from purple sweet potato The purple sweet potato anthocyanin samples used in this invention were identified and quantitatively analyzed by LC-MS. Seven major anthocyanin compounds were detected, primarily cyanidin and paeonol as aglycones, all existing in the form of acylated sophoroside-5-glucoside. The component with the highest relative content was paeonol 3-caffeoyl sophoroside-5-glucoside (71.708 mg / g), followed by paeonol 3-dicaffeoyl sophoroside-5-glucoside (31.486 mg / g) and cyanidin 3-caffeoyl sophoroside-5-glucoside (26.026 mg / g). Other components included paeonol 3-caffeoyl-p-hydroxybenzoyl sophoroside-5-glucoside, indicating that the purple sweet potato anthocyanins are characterized by relatively stable acylated anthocyanins.
[0047] Example 2: Improvement of colonic structure and barrier function in aging mice by purple sweet potato anthocyanins Seventeen-month-old naturally aging C57BL / 6J mice were randomly divided into two groups. The intervention group was administered 100 mg / kg of purple sweet potato anthocyanin solution by gavage at a fixed time every day for 8 weeks. The effects of purple sweet potato anthocyanin intervention on the colonic tissue structure of aged mice were investigated. Figure 1 As shown. Among them, Figure 1 In the figure, A represents the statistical graph of colon length in each group of mice; Figure 1 B in the image represents a representative H&E staining image of colon tissue and a quantitative analysis of crypt depth. Figure 1 In the image, C represents the morphology and length of colonic epithelial microvilli under transmission electron microscopy. The effects of purple sweet potato anthocyanins on the expression of colonic barrier-related proteins in aged mice are shown below. Figure 2 As shown. Among them, Figure 2In the diagram, A represents the immunofluorescence staining, fluorescence intensity, and relative gene expression level of Zo-1. Figure 2 In the diagram, B represents the immunofluorescence staining, fluorescence intensity, and relative gene expression level of Claudin-3. Figure 2 In the diagram, C represents the immunofluorescence staining of Muc2, the percentage of Muc2 intensity / area, and the relative gene expression level.
[0048] from Figures 1-2 H&E staining and transmission electron microscopy showed no significant difference in colon length among the groups of mice, indicating that aging and purple sweet potato anthocyanin (PSPAs) intervention did not significantly affect colon morphology (see [link to study]). Figure 1 (A) Compared with young mice (Young group), aged mice (Old group) showed significantly reduced colonic crypt depth, and significantly shortened and disordered microvilli on the surface of intestinal epithelial cells; while after intervention with purple sweet potato anthocyanins (PSPAs group), crypt depth significantly increased, microvilli length significantly recovered, and the arrangement became more orderly and dense again. This indicates that purple sweet potato anthocyanins can promote intestinal epithelial proliferation and renewal, and have a good protective effect on the ultrastructure of the brush border of intestinal epithelium.
[0049] In terms of barrier function, such as Figure 2 As shown in Figure A, compared with the Young group, the fluorescence signal intensity of Zo-1 in the colon tissue of the Old group was significantly weakened, and the mRNA expression level was also downregulated. After PSPAs intervention, the fluorescence signal intensity of Zo-1 was significantly enhanced compared with the Old group, and the mRNA expression level of Zo-1 was also significantly upregulated. Meanwhile, compared with the Young group, the fluorescence signal of Claudin-3 in the Old group was weakened, and the mRNA expression level was downregulated. After PSPAs intervention, the fluorescence intensity of this protein significantly recovered, and its mRNA expression level also significantly increased (see Figure A). Figure 2 (B in the text). The above results indicate that aging leads to the disruption of the intestinal tight junction structure, but PSPAs intervention can effectively restore the expression of colonic tight junction proteins in aged mice, which helps maintain the integrity of the intestinal epithelial mechanical barrier.
[0050] Regarding the mucus barrier, such as Figure 2As shown in Figure C, the immunofluorescence signal of Muc2 in the colon tissue of the Old group was significantly weaker than that of the Young group, reflecting the decline in goblet cell mucin secretion function associated with aging; the Muc2 protein level was significantly enhanced after PSPAs intervention compared to the Old group. However, the researchers of this invention found that the mRNA expression level of Muc2 after PSPAs intervention only showed an upward trend and did not reach statistical significance. This may be related to the post-translational modification regulation of Muc2 protein and the accumulation and storage characteristics of mucin in tissues, that is, the change in protein level does not completely depend on the immediate regulation at the transcriptional level. This indicates that purple sweet potato anthocyanin intervention significantly enhanced the fluorescence signal intensity and mRNA expression level of the mechanical barrier tight junction proteins Zo-1 and Claudin-3 in aging colon tissue, while significantly enhancing the protein level of the mucus barrier goblet cell marker Muc2, demonstrating that it can effectively repair damaged intestinal epithelial homeostasis at both the tissue and protein levels.
[0051] Example 3: Purple sweet potato anthocyanins promote the proliferation and differentiation of intestinal stem cells The function and proliferation and differentiation indices of colonic stem cells in mice were detected. The effects of purple sweet potato anthocyanins on colonic epithelial cell proliferation and cell cycle regulation in aged mice were investigated. Figure 3 As shown. Among them, Figure 3 A and B in the figure represent Lgr5 protein imprinting analysis and mRNA expression level diagrams; Figure 3 C and D in the image represent Ki67 mRNA expression levels and immunofluorescence staining (scale bar is 20 μm). Figure 3 The E~H values represent the relative expression levels of Ccnd1, Cdk4, Cdkn1a, and Axin2 mRNAs. The effects of purple sweet potato anthocyanins on the differentiation of colonic secretory cells in aged mice are shown below. Figure 4 As shown. Among them, Figure 4 A in the figure represents the alicin blue staining of colon tissue and the quantitative analysis of goblet cells in the crypts; Figure 4 B and C in the image represent the ChgA mRNA expression level and immunofluorescence staining (scale bar is 50 μm). Figure 4 D in the figure represents the Lyz1 immunofluorescence staining and quantitative analysis diagram (scale bar is 10 μm).
[0052] Figures 3-4The results showed that while purple sweet potato anthocyanin intervention did not significantly expand the Lgr5-positive stem cell pool, it significantly upregulated the mRNA level of the proliferation marker Ki67 and the number of positive cells within the crypts. At the molecular level, purple sweet potato anthocyanin intervention significantly upregulated the cell cycle regulators Ccnd1 and Cdk4, downregulated the expression of the inhibitor Cdkn1a, and upregulated the Wnt / β-catenin pathway target gene Axin2, confirming its reactivation of the blocked cell cycle program in the aging gut. Alixin blue staining and immunofluorescence results showed that after purple sweet potato anthocyanin intervention, the number of goblet cells per crypt significantly increased, the expression of the enteroendocrine cell marker ChgA significantly increased, and the signal of secretory cells with Panethian features (Lyz1 positive) was significantly enhanced. These results confirm that purple sweet potato anthocyanins can support barrier renewal of the aging intestinal epithelium by promoting the differentiation of various secretory cell lineages. Furthermore, the tests showed no significant changes in inflammatory factors such as TNF-α and IL-6 in the colon, indicating that the recovery of this function does not depend on the classic direct anti-inflammatory pathway.
[0053] Example 4: Direct effects of anthocyanin-remodeled gut microbiota metabolites (CCS from the contents supernatant) on intestinal epithelial homeostasis. To investigate whether microbial metabolites can enhance intestinal epithelial homeostasis, aging colonic organoids were treated with sterile colonic contents supernatant (CCS) from different donor groups. Fresh colonic contents supernatant from purple sweet potato anthocyanin-treated mice (CCS-PSPAs) was prepared and added at 2% (v / v) to the culture medium of naturally aging colonic organoids for 72 hours. Similarly, fresh colonic contents supernatant from young and old mice (CCS-Young and CCS-Old) was prepared and added at 2% (v / v) to the culture medium of naturally aging colonic organoids for 72 hours. The effects of colonic contents supernatant on the growth and related gene expression of aging colonic organoids are as follows: Figure 5 As shown. Among them, Figure 5 A in the image represents the growth of senescent colon organoids and the fold increase map of organoid area (scale bar is 200 μm). Figure 5 In the diagram, B represents the relative expression levels of Lgr5, Ki67, and ChgA mRNA in organoids. Figure 5 The figure C represents the relative expression levels of Zo-1, Occludin, and Claudin-3 mRNA in organoids.
[0054] Figure 5 The results showed that, compared with the CCS-Old group, CCS-PSPAs treatment significantly increased the area expansion fold of senescent organoids (see [link to study]). Figure 5 In the A), it significantly upregulated the expression levels of Ki67 and ChgA (see A in the A), and significantly upregulated the expression levels of Ki67 and ChgA (see A in the A). Figure 5In the B group), the expression levels of tightly linked genes Zo-1, Occludin, and Claudin-3 were significantly increased (see [link to B]). Figure 5 (C in the example). This embodiment demonstrates that purple sweet potato anthocyanins can directly and effectively improve the intestinal barrier and stem cell function by reshaping the metabolic function of the gut microbiota (such as the significant increase in the concentration of short-chain fatty acids such as butyric acid, valeric acid, and isobutyric acid detected by targeted metabolomics).
[0055] Example 5: Purple sweet potato anthocyanins activate colonic autophagy pathway through metabolic reprogramming Decreased autophagy is a significant cause of intestinal aging. To verify whether PSPAs can activate autophagy levels in the colon of aged mice, immunofluorescence detection of autophagy-related proteins was performed on colon tissue from aged mice. It was found that purple sweet potato anthocyanin intervention significantly enhanced the immunofluorescence signal intensity of autophagy-related proteins Atg10 and Atg5 in colon tissue and significantly increased the number of LC3A / B positive spots, effectively reversing the age-related decline in colonic autophagy activity. Further transcriptomic and non-targeted metabolomics analyses revealed that the changes in transcriptional gene expression induced by purple sweet potato anthocyanin intervention showed significant enrichment in the PI3K-Akt signaling pathway and significantly reduced the levels of various phosphatidylethanolamine (PE) molecules, which are key substrates for autophagosome membrane formation, in the colon. This example demonstrates that purple sweet potato anthocyanins can activate autophagy in senescent colon cells via the PI3K-Akt signaling pathway through a microbiota-dependent metabolic reprogramming pathway, thereby supporting the clearance of damaged intracellular components and the maintenance of intestinal epithelial homeostasis.
[0056] The above description is merely a detailed explanation of preferred embodiments and principles of the present invention. For those skilled in the art, there may be changes in specific implementation methods based on the ideas provided by the present invention, and these changes should also be considered within the scope of protection of the present invention.
Claims
1. The application of purple sweet potato anthocyanins in the preparation of products for preventing or improving intestinal aging, characterized in that, The purple sweet potato anthocyanins improve intestinal aging by reshaping intestinal flora metabolism and activating intestinal cell autophagy via the PI3K-Akt signaling pathway. The improvement in intestinal aging includes at least one of the following: improving intestinal epithelial barrier function, improving intestinal epithelial renewal capacity, and improving intestinal cell autophagy function.
2. The application according to claim 1, characterized in that, The purple sweet potato anthocyanins include peony pigment derivatives and cyanidin derivatives.
3. The application according to claim 2, characterized in that, The peony pigment derivative and cyanidin derivative are acylated anthocyanins.
4. The application according to claim 3, characterized in that, The acylated anthocyanin is any one or a combination of paeonol 3-caffeoyl sophoroside-5-glucoside, paeonol 3-dicaffeoyl sophoroside-5-glucoside, and cyanidin 3-caffeoyl sophoroside-5-glucoside.
5. The application according to claim 1, characterized in that, The product in question is a pharmaceutical, food, or health supplement.
6. The application according to claim 1, characterized in that, The improvement in intestinal epithelial barrier function is manifested by upregulating the expression of tight junction proteins and / or mucins.
7. The application according to claim 1, characterized in that, The improvement in intestinal epithelial renewal capacity is manifested in promoting the proliferation of colonic crypt cells and / or promoting the differentiation of intestinal stem cells into secretory lineage cells.
8. The application according to claim 1, characterized in that, The improvement in intestinal cell autophagy function is manifested by activating cell autophagy through the PI3K-Akt signaling pathway via intestinal flora metabolites, and upregulating the expression of autophagy-related proteins.
9. The application according to claim 8, characterized in that, The autophagy-related proteins are Atg5, Atg10, and / or LC3A / B.